Clone Information

Sequence Data

Clone Name	basd3p22
Clone Library Name	barley_pub
Definition	emb\|AL358074.22\| Human DNA sequence from clone RP11-423C15 on chromosome 9 Contains the 5NULL end of the MAPKAP1 gene for mitogen-activated protein kinase associated protein 1, a novel gene, the 5NULL end of the PBX3 gene for pre-B-cell leukemia transcription f

GTATTTTGCCTACAAACATGGCAAATCATTTGTGAAGTTGTTGTGTCATCCTTTAGAAGT
AACTGCATTACAAAAAAAAAA

Download to file. (under entry)