Clone Information

Sequence Data

Clone Name	rbastl54b08
Clone Library Name	barley_pub
Definition	emb\|Z97054.1\|HS339A18 Human DNA sequence from clone RP3-339A18 on chromosome Xp11.1-11.4 Contains the 5NULL end of the SMC1L1 gene for SMC1 structural maintenance of chromosomes 1-like 1 (yeast), a novel RIB43A domain containing protein (FLJ32783), the HADH2

CCAGGGAAACCAGAGTTCCAGGAATAATTATATTTCTTCTATATAATCCAGCCTTCAAAG
AAAAAATACAAAGGGTTACATTTACTAGGGGCTAAAATTCCTAAGGGAACCGA

Download to file. (under entry)