Clone Information

Sequence Data

Clone Name	rbastl40g12
Clone Library Name	barley_pub
Definition	emb\|AL136380.22\| Human DNA sequence from clone RP5-882O7 on chromosome 1p33-34.2 Contains the 5NULL end of the PTCH2 gene for patched homolog 2 (Drosophila), a ribosomal protein S2 (RPS2) pseudogene, the EIF2B3 gene for eukaryotic translation initiation fact

GGGCAACCGAGACTACAAAGTTTGTATAACATAGAAAAAACAACACTAGTCAAG

Download to file. (under entry)