Clone Information

Sequence Data

Clone Name	rbastl02f07
Clone Library Name	barley_pub
Definition	emb\|AL445190.9\| Human DNA sequence from clone RP11-349J5 on chromosome 6 Contains the 5NULL end of the ALDH8A1 gene for aldehyde dehydrogenase 8 family, member A1, a novel gene and the 3NULL end of the HBS1L gene for HBS1-like (S. cerevisiae) (KIAA1038, EFRS),

AAGCTTATCATACAATTTCAAGTTTCAACACTCCAAGGAAAATAACATGAAAAAAGAACC
TACAGGGGGTCTATCAAACACTTTTGAAAAATCAAGCCCACAGTCTTGGCTCGTCCTCTA
AAGATCAAATGCAAAAAAAAAAAGAAGGCCATAG

Download to file. (under entry)

full-length cDNA and EST

Clone Information

Sequence Data