Clone Name | rbart45c05 |
---|---|
Clone Library Name | barley_pub |
>gb|AC147907.2| Xenopus tropicalis clone CH216-74C22, complete sequence Length = 184109 Score = 42.1 bits (21), Expect = 0.48 Identities = 21/21 (100%) Strand = Plus / Minus Query: 40 tttcatgagaaataaattccc 60 ||||||||||||||||||||| Sbjct: 148514 tttcatgagaaataaattccc 148494
>gb|AC147837.2| Xenopus tropicalis clone CH216-28I17, complete sequence Length = 181178 Score = 42.1 bits (21), Expect = 0.48 Identities = 21/21 (100%) Strand = Plus / Plus Query: 40 tttcatgagaaataaattccc 60 ||||||||||||||||||||| Sbjct: 46159 tttcatgagaaataaattccc 46179
>dbj|AK024838.1| Homo sapiens cDNA: FLJ21185 fis, clone CAS11646 Length = 674 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 23 cttggttaacctttccgttt 42 |||||||||||||||||||| Sbjct: 417 cttggttaacctttccgttt 398
>emb|AL954329.7| Zebrafish DNA sequence from clone CH211-226C11 in linkage group 23, complete sequence Length = 194284 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 tttcatgagaaataaattcc 59 |||||||||||||||||||| Sbjct: 10168 tttcatgagaaataaattcc 10187
>ref|NM_125823.2| Arabidopsis thaliana unknown protein AT5G64270 mRNA, complete cds Length = 4146 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 3 tgaagacgctctcatggac 21 ||||||||||||||||||| Sbjct: 3543 tgaagacgctctcatggac 3561
>gb|AC113005.10| Mus musculus chromosome 3, clone RP23-299B23, complete sequence Length = 218917 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 30 aacctttccgtttcatgag 48 ||||||||||||||||||| Sbjct: 79041 aacctttccgtttcatgag 79059
>gb|AC161496.6| Mus musculus chromosome 3, clone RP23-119A9, complete sequence Length = 203655 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 30 aacctttccgtttcatgag 48 ||||||||||||||||||| Sbjct: 34459 aacctttccgtttcatgag 34441
>emb|AL445239.8| Human DNA sequence from clone RP11-540L11 on chromosome X Contains the 3' end of the CASK gene for calcium/calmodulin-dependent serine protein kinase (MAGUK family) and a novel gene, complete sequence Length = 75677 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 40 tttcatgagaaataaattc 58 ||||||||||||||||||| Sbjct: 30692 tttcatgagaaataaattc 30710
>gb|AC092981.3| Homo sapiens 3 BAC RP11-305I9 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 160000 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 43 catgagaaataaattccct 61 ||||||||||||||||||| Sbjct: 39164 catgagaaataaattccct 39182
>ref|NM_166585.2| Drosophila melanogaster Gustatory receptor 59a CG30189-RA (Gr59a), mRNA Length = 1104 Score = 38.2 bits (19), Expect = 7.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 16 atggactcttggttaacctttcc 38 ||||||||||||||||| ||||| Sbjct: 479 atggactcttggttaacatttcc 501
>dbj|AK221391.1| Arabidopsis thaliana mRNA for nuclear protein-like, complete cds, clone: RAFL25-43-N10 Length = 1062 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 3 tgaagacgctctcatggac 21 ||||||||||||||||||| Sbjct: 512 tgaagacgctctcatggac 530
>gb|AC008352.2|AC008352 Drosophila melanogaster, chromosome 2R, region 59C-59D, BAC clone BACR08P09, complete sequence Length = 181463 Score = 38.2 bits (19), Expect = 7.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 16 atggactcttggttaacctttcc 38 ||||||||||||||||| ||||| Sbjct: 119326 atggactcttggttaacatttcc 119348
>emb|BX950767.1| Gallus gallus finished cDNA, clone ChEST816e20 Length = 1131 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Minus Query: 32 cctttccgtttcatgagaa 50 ||||||||||||||||||| Sbjct: 805 cctttccgtttcatgagaa 787
>emb|BX831020.1|CNS09ZEK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS4ZF06 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1263 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 3 tgaagacgctctcatggac 21 ||||||||||||||||||| Sbjct: 712 tgaagacgctctcatggac 730
>dbj|AB008268.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MSJ1 Length = 83594 Score = 38.2 bits (19), Expect = 7.5 Identities = 19/19 (100%) Strand = Plus / Plus Query: 3 tgaagacgctctcatggac 21 ||||||||||||||||||| Sbjct: 35106 tgaagacgctctcatggac 35124
>gb|AE003459.3| Drosophila melanogaster chromosome 2R, section 67 of 73 of the complete sequence Length = 283700 Score = 38.2 bits (19), Expect = 7.5 Identities = 22/23 (95%) Strand = Plus / Plus Query: 16 atggactcttggttaacctttcc 38 ||||||||||||||||| ||||| Sbjct: 185139 atggactcttggttaacatttcc 185161 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 920,324 Number of Sequences: 3902068 Number of extensions: 920324 Number of successful extensions: 65650 Number of sequences better than 10.0: 16 Number of HSP's better than 10.0 without gapping: 16 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 65628 Number of HSP's gapped (non-prelim): 22 length of query: 156 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 134 effective length of database: 17,147,199,772 effective search space: 2297724769448 effective search space used: 2297724769448 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)