Clone Name | rbart29d08 |
---|---|
Clone Library Name | barley_pub |
>emb|AJ318884.1|TTU318884 Triticum turgidum subsp. durum xip-II gene for putative xylanase inhibitor protein Length = 2143 Score = 67.9 bits (34), Expect = 3e-08 Identities = 40/42 (95%) Strand = Plus / Minus Query: 192 tcccagaccatgaccccgccatagttggccgccttctgcacc 233 ||||||||||||||||||||||||||| ||||||||||||| Sbjct: 1886 tcccagaccatgaccccgccatagttgttcgccttctgcacc 1845 Score = 44.1 bits (22), Expect = 0.44 Identities = 25/26 (96%) Strand = Plus / Minus Query: 328 acgccgccgtccacttgtcccactgc 353 |||||||||||||||| ||||||||| Sbjct: 1729 acgccgccgtccacttctcccactgc 1704
>dbj|AB204556.1| Triticum aestivum Xip-III gene for xylanase inhibitor XIP-III, complete cds Length = 934 Score = 61.9 bits (31), Expect = 2e-06 Identities = 61/71 (85%) Strand = Plus / Minus Query: 192 tcccagaccatgaccccgccatagttggccgccttctgcaccacctgtatgacgccgtag 251 ||||||| |||||||||||| |||||| || ||||||||||||| | ||| ||||||| Sbjct: 877 tcccagagcatgaccccgccgtagttgtccttcttctgcaccaccggcgtgatgccgtag 818 Query: 252 tagaggttctt 262 |||| |||||| Sbjct: 817 tagacgttctt 807 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 327 tacgccgccgtccacttgtcccac 350 ||||||||||||||| |||||||| Sbjct: 742 tacgccgccgtccacctgtcccac 719
>emb|AL929214.6| Mouse DNA sequence from clone RP23-195I21 on chromosome 2, complete sequence Length = 43009 Score = 50.1 bits (25), Expect = 0.007 Identities = 25/25 (100%) Strand = Plus / Minus Query: 59 gcaagcacatgcacatgcacatgca 83 ||||||||||||||||||||||||| Sbjct: 8647 gcaagcacatgcacatgcacatgca 8623
>ref|NM_193094.1| Oryza sativa (japonica cultivar-group), mRNA Length = 951 Score = 48.1 bits (24), Expect = 0.028 Identities = 36/40 (90%) Strand = Plus / Minus Query: 192 tcccagaccatgaccccgccatagttggccgccttctgca 231 ||||||| ||||| ||||| ||||||||||||||||||| Sbjct: 896 tcccagatcatgaagccgccgtagttggccgccttctgca 857 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 327 tacgccgccgtccacttgtcccac 350 ||||||||||||||| |||||||| Sbjct: 737 tacgccgccgtccacctgtcccac 714
>emb|AJ422119.1|TAE422119 Triticum aestivum mRNA for xylanase inhibitor protein I (xipI gene) Length = 915 Score = 48.1 bits (24), Expect = 0.028 Identities = 24/24 (100%) Strand = Plus / Minus Query: 327 tacgccgccgtccacttgtcccac 350 |||||||||||||||||||||||| Sbjct: 725 tacgccgccgtccacttgtcccac 702 Score = 44.1 bits (22), Expect = 0.44 Identities = 85/106 (80%) Strand = Plus / Minus Query: 157 agctgctgtaatttgtccgcttgtcctcgtaacgttcccagaccatgaccccgccatagt 216 |||||||||| || ||| ||||||| ||| || ||||||| ||||| ||||| |||| Sbjct: 895 agctgctgtagttggtctgcttgtcgaagtatcggtcccagagcatgatgccgccgtagt 836 Query: 217 tggccgccttctgcaccacctgtatgacgccgtagtagaggttctt 262 || || ||||||| ||||| | |||||||||||||| |||||| Sbjct: 835 tgtccttcttctgcgccaccggcgcgacgccgtagtagacgttctt 790
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 48.1 bits (24), Expect = 0.028 Identities = 36/40 (90%) Strand = Plus / Minus Query: 192 tcccagaccatgaccccgccatagttggccgccttctgca 231 ||||||| ||||| ||||| ||||||||||||||||||| Sbjct: 26162457 tcccagatcatgaagccgccgtagttggccgccttctgca 26162418 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 327 tacgccgccgtccacttgtcccac 350 ||||||||||||||| |||||||| Sbjct: 26162298 tacgccgccgtccacctgtcccac 26162275
>dbj|AK111717.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023022A01, full insert sequence Length = 1165 Score = 48.1 bits (24), Expect = 0.028 Identities = 36/40 (90%) Strand = Plus / Minus Query: 192 tcccagaccatgaccccgccatagttggccgccttctgca 231 ||||||| ||||| ||||| ||||||||||||||||||| Sbjct: 944 tcccagatcatgaagccgccgtagttggccgccttctgca 905 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 327 tacgccgccgtccacttgtcccac 350 ||||||||||||||| |||||||| Sbjct: 785 tacgccgccgtccacctgtcccac 762
>dbj|AP004339.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0519E12 Length = 152448 Score = 48.1 bits (24), Expect = 0.028 Identities = 36/40 (90%) Strand = Plus / Minus Query: 192 tcccagaccatgaccccgccatagttggccgccttctgca 231 ||||||| ||||| ||||| ||||||||||||||||||| Sbjct: 54315 tcccagatcatgaagccgccgtagttggccgccttctgca 54276 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 327 tacgccgccgtccacttgtcccac 350 ||||||||||||||| |||||||| Sbjct: 54156 tacgccgccgtccacctgtcccac 54133
>gb|AC104270.3| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1037_G10, complete sequence Length = 181130 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 445 ggtccgggtagccgcaccgcggcgtggccgt 475 ||||||||||||||||||||| ||| ||||| Sbjct: 71607 ggtccgggtagccgcaccgcgtcgtcgccgt 71577
>gb|U83904.1|HVU83904 Hordeum vulgare lipoxygenase isoenzyme 1 (Lox:Hv1) gene, promoter region and partial cds Length = 5236 Score = 46.1 bits (23), Expect = 0.11 Identities = 23/23 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgcagt 85 ||||||||||||||||||||||| Sbjct: 3181 gcacatgcacatgcacatgcagt 3203
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 445 ggtccgggtagccgcaccgcggcgtggccgt 475 ||||||||||||||||||||| ||| ||||| Sbjct: 8859682 ggtccgggtagccgcaccgcgtcgtcgccgt 8859652
>dbj|AK073843.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033068H05, full insert sequence Length = 1152 Score = 46.1 bits (23), Expect = 0.11 Identities = 29/31 (93%) Strand = Plus / Minus Query: 445 ggtccgggtagccgcaccgcggcgtggccgt 475 ||||||||||||||||||||| ||| ||||| Sbjct: 633 ggtccgggtagccgcaccgcgtcgtcgccgt 603
>gb|AC127290.3| Mus musculus BAC clone RP23-364F13 from chromosome 5, complete sequence Length = 187121 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 60 caagcacatgcacatgcacatg 81 |||||||||||||||||||||| Sbjct: 101713 caagcacatgcacatgcacatg 101734
>emb|CR716376.2|CNS0GFPD Tetraodon nigroviridis full-length cDNA Length = 952 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgcag 84 |||||||||||||||||||||| Sbjct: 451 gcacatgcacatgcacatgcag 472 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 446 cacatgcacatgcacatgca 465
>gb|AE012162.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 70 of 460 of the complete genome Length = 11262 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 455 gccgcaccgcggcgtggccgtg 476 |||||||||||||||||||||| Sbjct: 3532 gccgcaccgcggcgtggccgtg 3553
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Minus Query: 455 gccgcaccgcggcgtggccgtg 476 |||||||||||||||||||||| Sbjct: 4273288 gccgcaccgcggcgtggccgtg 4273267
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 377 ggcgtcgtcgtagaacctgaca 398 |||||||||||||||||||||| Sbjct: 25771478 ggcgtcgtcgtagaacctgaca 25771499
>dbj|AP004622.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0689E12 Length = 147516 Score = 44.1 bits (22), Expect = 0.44 Identities = 22/22 (100%) Strand = Plus / Plus Query: 377 ggcgtcgtcgtagaacctgaca 398 |||||||||||||||||||||| Sbjct: 43689 ggcgtcgtcgtagaacctgaca 43710
>ref|NM_101931.2| Arabidopsis thaliana unknown protein AT1G20790 mRNA, complete cds Length = 1308 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 1101 gcacatgcacatgcacatgca 1121 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 1107 gcacatgcacatgcacatgc 1126
>gb|AC165299.13| Mus musculus chromosome 15, clone RP23-266F2, complete sequence Length = 186266 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 168582 gcacatgcacatgcacatgca 168602 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 168576 gcacatgcacatgcacatgca 168596
>gb|AC167164.6| Mus musculus chromosome 7, clone RP24-276M8, complete sequence Length = 171048 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 65280 gcacatgcacatgcacatgca 65300 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 65274 gcacatgcacatgcacatgca 65294 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 65268 gcacatgcacatgcacatgca 65288 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 65262 gcacatgcacatgcacatgca 65282 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 65256 gcacatgcacatgcacatgca 65276
>gb|AC101807.12| Mus musculus chromosome 18, clone RP24-251J22, complete sequence Length = 171409 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 118959 gcacatgcacatgcacatgca 118979
>gb|AC155300.2| Mus musculus BAC clone RP24-232D3 from chromosome 12, complete sequence Length = 176261 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 109047 gcacatgcacatgcacatgca 109027 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 109041 gcacatgcacatgcacatgca 109021 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 109035 gcacatgcacatgcacatgca 109015 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 109029 gcacatgcacatgcacatgca 109009 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 109023 gcacatgcacatgcacatgca 109003 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 109017 gcacatgcacatgcacatgca 108997 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 109052 cacatgcacatgcacatgca 109033
>gb|AC155235.2| Mus musculus BAC clone RP24-406H23 from chromosome 12, complete sequence Length = 158341 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 12885 gcacatgcacatgcacatgca 12865 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 12879 gcacatgcacatgcacatgca 12859 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 12873 gcacatgcacatgcacatgca 12853 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 12867 gcacatgcacatgcacatgca 12847 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 12861 gcacatgcacatgcacatgca 12841 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 12855 gcacatgcacatgcacatgca 12835 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 12890 cacatgcacatgcacatgca 12871
>gb|AC161580.12| Mus musculus chromosome 3, clone RP23-422D10, complete sequence Length = 224193 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 96469 gcacatgcacatgcacatgca 96449
>gb|CP000152.1| Burkholderia sp. 383 chromosome 2, complete sequence Length = 3587082 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 3539276 gcacatgcacatgcacatgca 3539256 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 3539270 gcacatgcacatgcacatgca 3539250
>gb|AC117807.7| Mus musculus chromosome 8, clone RP24-568P2, complete sequence Length = 175586 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgcag 84 ||||||||||||||||||||| Sbjct: 54154 cacatgcacatgcacatgcag 54174
>gb|AC139025.9| Mus musculus chromosome 8, clone RP23-426K13, complete sequence Length = 203230 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgcag 84 ||||||||||||||||||||| Sbjct: 181556 cacatgcacatgcacatgcag 181536
>gb|CP000079.1| Leishmania major strain Friedlin chromosome 27, complete sequence Length = 1130447 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 859544 gcacatgcacatgcacatgca 859564
>gb|AC166648.4| Mus musculus chromosome 5, clone RP23-102C14, complete sequence Length = 203566 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 158681 gcacatgcacatgcacatgca 158701 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 158687 gcacatgcacatgcacatgc 158706
>gb|AC115968.10| Mus musculus chromosome 1, clone RP24-72P6, complete sequence Length = 229959 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 29909 gcacatgcacatgcacatgca 29929
>gb|AC168275.4| Mus musculus 10 BAC RP23-350O21 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 188458 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgcag 84 ||||||||||||||||||||| Sbjct: 45613 cacatgcacatgcacatgcag 45633
>gb|AC168276.3| Mus musculus BAC RP24-485I12 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 186675 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgcag 84 ||||||||||||||||||||| Sbjct: 159516 cacatgcacatgcacatgcag 159536
>gb|AC008097.5| Drosophila melanogaster clone BACR20D06, complete sequence Length = 185670 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 183297 gcacatgcacatgcacatgca 183317
>gb|AC113104.15| Mus musculus chromosome 18, clone RP23-321L15, complete sequence Length = 207418 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 90180 gcacatgcacatgcacatgca 90160 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 90185 cacatgcacatgcacatgca 90166
>gb|AC134795.10| Mus musculus chromosome 15, clone RP24-456M21, complete sequence Length = 166650 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 129383 gcacatgcacatgcacatgca 129363 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 129377 gcacatgcacatgcacatgca 129357
>gb|AY687385.1| Pelodiscus sinensis mitochondrion, complete genome Length = 17364 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16787 gcacatgcacatgcacatgca 16807 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16781 gcacatgcacatgcacatgca 16801 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16775 gcacatgcacatgcacatgca 16795 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16769 gcacatgcacatgcacatgca 16789 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16763 gcacatgcacatgcacatgca 16783 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16757 gcacatgcacatgcacatgca 16777 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16649 gcacatgcacatgcacatgca 16669 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16643 gcacatgcacatgcacatgca 16663 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16637 gcacatgcacatgcacatgca 16657 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16631 gcacatgcacatgcacatgca 16651 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16625 gcacatgcacatgcacatgca 16645 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16619 gcacatgcacatgcacatgca 16639 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16613 gcacatgcacatgcacatgca 16633 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16607 gcacatgcacatgcacatgca 16627 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16601 gcacatgcacatgcacatgca 16621 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16595 gcacatgcacatgcacatgca 16615 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16589 gcacatgcacatgcacatgca 16609 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16583 gcacatgcacatgcacatgca 16603 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16577 gcacatgcacatgcacatgca 16597 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16571 gcacatgcacatgcacatgca 16591 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16565 gcacatgcacatgcacatgca 16585 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16559 gcacatgcacatgcacatgca 16579 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16553 gcacatgcacatgcacatgca 16573 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 16752 cacatgcacatgcacatgca 16771
>gb|AC132440.3| Mus musculus BAC clone RP23-239I24 from chromosome 8, complete sequence Length = 183218 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 68833 gcacatgcacatgcacatgca 68853
>gb|AC147263.3| Mus musculus BAC clone RP24-213I13 from chromosome 13, complete sequence Length = 182371 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 11344 gcacatgcacatgcacatgca 11324
>gb|AC142270.4| Mus musculus BAC clone RP24-115G23 from chromosome 3, complete sequence Length = 170870 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 42080 gcacatgcacatgcacatgca 42060
>gb|AC102369.21| Mus musculus chromosome 12, clone RP23-246F14, complete sequence Length = 214580 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 59875 gcacatgcacatgcacatgca 59855 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 59869 gcacatgcacatgcacatgca 59849 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 59863 gcacatgcacatgcacatgca 59843 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 59857 gcacatgcacatgcacatgca 59837 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 59851 gcacatgcacatgcacatgca 59831 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 59845 gcacatgcacatgcacatgca 59825 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 59880 cacatgcacatgcacatgca 59861
>gb|AC150413.2| Branchiostoma floridae clone CH302-61A17, complete sequence Length = 240260 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 226264 gcacatgcacatgcacatgca 226244 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 226269 cacatgcacatgcacatgca 226250
>gb|AC158951.5| Mus musculus chromosome 8, clone RP23-265B11, complete sequence Length = 191700 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 155892 gcacatgcacatgcacatgca 155912 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 155887 cacatgcacatgcacatgca 155906
>gb|AC129567.8| Mus musculus chromosome 8, clone RP23-50L10, complete sequence Length = 228046 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 88701 gcacatgcacatgcacatgca 88721
>gb|AC164300.3| Mus musculus BAC clone RP23-310J6 from chromosome 8, complete sequence Length = 200605 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 179708 gcacatgcacatgcacatgca 179728
>gb|AC101787.11| Mus musculus chromosome 1, clone RP24-147F6, complete sequence Length = 172617 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 59989 gcacatgcacatgcacatgca 59969 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 59983 gcacatgcacatgcacatgca 59963 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 59977 gcacatgcacatgcacatgca 59957 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 59971 gcacatgcacatgcacatgca 59951 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 59965 gcacatgcacatgcacatgca 59945 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 59959 gcacatgcacatgcacatgca 59939 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 59953 gcacatgcacatgcacatgca 59933 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 59994 cacatgcacatgcacatgca 59975
>gb|AC118702.8| Mus musculus chromosome 5, clone RP24-166J1, complete sequence Length = 171263 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 4155 gcacatgcacatgcacatgca 4135 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 4149 gcacatgcacatgcacatgca 4129
>gb|AC113098.12| Mus musculus chromosome 8, clone RP23-314K9, complete sequence Length = 190888 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 149713 gcacatgcacatgcacatgca 149733 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 149707 gcacatgcacatgcacatgca 149727 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 149702 cacatgcacatgcacatgca 149721
>gb|AC133648.3| Mus musculus BAC clone RP23-291B1 from chromosome 7, complete sequence Length = 207234 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 137950 gcacatgcacatgcacatgca 137930 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 137944 gcacatgcacatgcacatgca 137924 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 137938 gcacatgcacatgcacatgca 137918 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 137932 gcacatgcacatgcacatgca 137912 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 137926 gcacatgcacatgcacatgca 137906 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 137920 gcacatgcacatgcacatgca 137900 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 137914 gcacatgcacatgcacatgca 137894 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 137908 gcacatgcacatgcacatgca 137888 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 137902 gcacatgcacatgcacatgca 137882 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 137896 gcacatgcacatgcacatgca 137876 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 137890 gcacatgcacatgcacatgca 137870 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 137884 gcacatgcacatgcacatgca 137864
>emb|CR936412.13| Zebrafish DNA sequence from clone DKEY-181M21 in linkage group 18, complete sequence Length = 151872 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 140340 gcacatgcacatgcacatgca 140320 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 140334 gcacatgcacatgcacatgca 140314
>gb|AC147546.1| Rattus norvegicus chromosome 1 clone RP32-323A19 map q33, complete sequence Length = 118946 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 91027 gcacatgcacatgcacatgca 91007
>gb|AC132430.3| Mus musculus BAC clone RP23-208D22 from chromosome 9, complete sequence Length = 192991 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 96817 gcacatgcacatgcacatgca 96837
>gb|AC123843.4| Mus musculus BAC clone RP23-407D18 from chromosome 8, complete sequence Length = 205875 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 113309 gcacatgcacatgcacatgca 113329 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 113303 gcacatgcacatgcacatgca 113323 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 113297 gcacatgcacatgcacatgca 113317 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 113291 gcacatgcacatgcacatgca 113311 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 113285 gcacatgcacatgcacatgca 113305 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 113279 gcacatgcacatgcacatgca 113299 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 113273 gcacatgcacatgcacatgca 113293 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 113268 cacatgcacatgcacatgca 113287
>gb|AC121946.3| Mus musculus BAC clone RP24-212F15 from chromosome 10, complete sequence Length = 181828 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16975 gcacatgcacatgcacatgca 16955 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 16980 cacatgcacatgcacatgca 16961
>gb|AC122008.4| Mus musculus BAC clone RP24-344F8 from chromosome 3, complete sequence Length = 209378 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 164877 gcacatgcacatgcacatgca 164897
>gb|AC122900.3| Mus musculus BAC clone RP23-39N24 from 15, complete sequence Length = 203855 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 107689 gcacatgcacatgcacatgca 107669 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 107683 gcacatgcacatgcacatgca 107663
>gb|AC121857.2| Mus musculus BAC clone RP24-98A9 from 1, complete sequence Length = 171124 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 157732 gcacatgcacatgcacatgca 157752
>gb|AC125277.1| Mus musculus BAC clone RP24-554P24 from 13, complete sequence Length = 141866 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 116030 gcacatgcacatgcacatgca 116010
>gb|AC109805.8| Mus musculus chromosome 3, clone RP23-91D14, complete sequence Length = 171006 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 40198 gcacatgcacatgcacatgca 40178
>gb|AC135605.25| Medicago truncatula clone mth2-7m1, complete sequence Length = 121648 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 68485 gcacatgcacatgcacatgca 68465
>gb|AC124964.17| Medicago truncatula clone mth2-27c4, complete sequence Length = 114519 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 51403 gcacatgcacatgcacatgca 51423
>gb|AC165165.3| Mus musculus BAC clone RP23-121B15 from chromosome 3, complete sequence Length = 228648 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 23710 gcacatgcacatgcacatgca 23730
>emb|AL353621.19| Human DNA sequence from clone RP11-490D19 on chromosome 9 Contains a novel pseudogene, the MRPL50 gene for mitochondrial ribosomal protein L50, the ZNF189 gene for zinc finger protein 189, the ALDOB gene for aldolase B, fructose-bisphosphate, a NADH dehydrogenase (ubiquinone) 1 alpha subcomplex (NDUFA4) pseudogene, three novel genes, the 5' end of the RNF20 gene for ring finger protein 20 and three CpG islands, complete sequence Length = 164115 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 138236 gcacatgcacatgcacatgca 138216 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 138241 cacatgcacatgcacatgca 138222
>gb|AC162899.5| Mus musculus chromosome 1, clone RP24-222G3, complete sequence Length = 176916 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 145466 gcacatgcacatgcacatgca 145486 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 145460 gcacatgcacatgcacatgca 145480 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 145454 gcacatgcacatgcacatgca 145474 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 145448 gcacatgcacatgcacatgca 145468 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 145442 gcacatgcacatgcacatgca 145462 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 145436 gcacatgcacatgcacatgca 145456 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 145430 gcacatgcacatgcacatgca 145450 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 145425 cacatgcacatgcacatgca 145444
>gb|AC162946.4| Mus musculus BAC clone RP23-38M11 from chromosome 9, complete sequence Length = 183012 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 19626 gcacatgcacatgcacatgca 19606
>emb|AJ627388.1| Yersinia pseudotuberculosis adhesion pathogenicity island (YAPI), complete sequence, strain 32777 Length = 102752 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 64731 gcacatgcacatgcacatgca 64751
>emb|AJ421451.1|LCA421451 Lemur catta mitochondrion complete mitochondrial genome Length = 17036 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16410 gcacatgcacatgcacatgca 16430 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16404 gcacatgcacatgcacatgca 16424 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16398 gcacatgcacatgcacatgca 16418 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16392 gcacatgcacatgcacatgca 16412 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16386 gcacatgcacatgcacatgca 16406 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16380 gcacatgcacatgcacatgca 16400 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16374 gcacatgcacatgcacatgca 16394 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16368 gcacatgcacatgcacatgca 16388 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16362 gcacatgcacatgcacatgca 16382 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16356 gcacatgcacatgcacatgca 16376 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16350 gcacatgcacatgcacatgca 16370 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16344 gcacatgcacatgcacatgca 16364 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16338 gcacatgcacatgcacatgca 16358 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16332 gcacatgcacatgcacatgca 16352 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16326 gcacatgcacatgcacatgca 16346 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16320 gcacatgcacatgcacatgca 16340 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16314 gcacatgcacatgcacatgca 16334 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16308 gcacatgcacatgcacatgca 16328 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16302 gcacatgcacatgcacatgca 16322 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16296 gcacatgcacatgcacatgca 16316 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16290 gcacatgcacatgcacatgca 16310 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16284 gcacatgcacatgcacatgca 16304 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16278 gcacatgcacatgcacatgca 16298 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16272 gcacatgcacatgcacatgca 16292 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16266 gcacatgcacatgcacatgca 16286 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16260 gcacatgcacatgcacatgca 16280 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16254 gcacatgcacatgcacatgca 16274 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16248 gcacatgcacatgcacatgca 16268 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 16242 gcacatgcacatgcacatgca 16262
>gb|AC160536.4| Mus musculus chromosome 8, clone RP24-92K22, complete sequence Length = 202719 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 94992 gcacatgcacatgcacatgca 95012 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 94986 gcacatgcacatgcacatgca 95006 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 94981 cacatgcacatgcacatgca 95000
>gb|AC022018.10| Homo sapiens chromosome 10 clone RP11-214N15, complete sequence Length = 159617 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 69413 gcacatgcacatgcacatgca 69393
>gb|AC013549.9| Homo sapiens chromosome 11, clone RP11-47J17, complete sequence Length = 163180 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 99803 gcacatgcacatgcacatgca 99783
>gb|AC151617.2| Emiliania huxleyi clone JGIACCU-13M3, complete sequence Length = 33456 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13356 gcacatgcacatgcacatgca 13336 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13350 gcacatgcacatgcacatgca 13330 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13344 gcacatgcacatgcacatgca 13324 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13338 gcacatgcacatgcacatgca 13318 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13332 gcacatgcacatgcacatgca 13312 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13326 gcacatgcacatgcacatgca 13306 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13320 gcacatgcacatgcacatgca 13300 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13314 gcacatgcacatgcacatgca 13294 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13308 gcacatgcacatgcacatgca 13288 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13302 gcacatgcacatgcacatgca 13282 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13296 gcacatgcacatgcacatgca 13276 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13290 gcacatgcacatgcacatgca 13270 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13284 gcacatgcacatgcacatgca 13264 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13278 gcacatgcacatgcacatgca 13258 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13272 gcacatgcacatgcacatgca 13252 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13266 gcacatgcacatgcacatgca 13246 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13260 gcacatgcacatgcacatgca 13240 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13254 gcacatgcacatgcacatgca 13234 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13248 gcacatgcacatgcacatgca 13228 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13242 gcacatgcacatgcacatgca 13222 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13236 gcacatgcacatgcacatgca 13216 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13230 gcacatgcacatgcacatgca 13210 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13224 gcacatgcacatgcacatgca 13204 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 13218 gcacatgcacatgcacatgca 13198
>emb|BX649331.16| Zebrafish DNA sequence from clone DKEY-12N3 in linkage group 11, complete sequence Length = 252675 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 10592 gcacatgcacatgcacatgca 10612 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 10587 cacatgcacatgcacatgca 10606
>gb|AC010711.5| Drosophila melanogaster 3L BAC RP98-22D12 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 187438 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 70416 gcacatgcacatgcacatgca 70436 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 70410 gcacatgcacatgcacatgca 70430
>gb|AF453501.1| Actinosynnema pretiosum subsp. auranticum maytansinoid antitumor agent ansamitocin biosynthetic gene cluster I, partial sequence Length = 82746 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 368 ggcgcagtcggcgtcgtcgta 388 ||||||||||||||||||||| Sbjct: 48835 ggcgcagtcggcgtcgtcgta 48855
>gb|AC107326.4| Drosophila melanogaster X BAC RP98-33A8 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 177096 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 48160 gcacatgcacatgcacatgca 48140
>gb|AC100795.2| Homo sapiens chromosome 18, clone RP11-956K8, complete sequence Length = 193569 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgcag 84 ||||||||||||||||||||| Sbjct: 96146 cacatgcacatgcacatgcag 96126
>gb|AC079617.5| Homo sapiens BAC clone RP11-623K14 from 4, complete sequence Length = 112615 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 28613 gcacatgcacatgcacatgca 28593 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 28607 gcacatgcacatgcacatgca 28587 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 28618 cacatgcacatgcacatgca 28599
>gb|AC112031.4| Rattus norvegicus BAC CH230-99K18 (Children's Hospital Oakland Research Institute Rat (BN/SsNHsd/MCW) BAC library) complete sequence Length = 242158 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgcag 84 ||||||||||||||||||||| Sbjct: 121225 cacatgcacatgcacatgcag 121245
>gb|AC099012.1| Drosophila melanogaster, chromosome 2R, region 56F-57X, BAC clone BACR23F24, complete sequence Length = 183592 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 31529 gcacatgcacatgcacatgca 31549
>gb|AC110911.18| Mus musculus chromosome 7, clone RP24-357A15, complete sequence Length = 146978 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 51702 gcacatgcacatgcacatgca 51722 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 51696 gcacatgcacatgcacatgca 51716 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 51690 gcacatgcacatgcacatgca 51710 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 51684 gcacatgcacatgcacatgca 51704 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 51678 gcacatgcacatgcacatgca 51698
>gb|AC157567.6| Mus musculus chromosome 5, clone RP23-246I12, complete sequence Length = 157519 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 89387 gcacatgcacatgcacatgca 89367 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 89381 gcacatgcacatgcacatgca 89361
>gb|CP000011.2| Burkholderia mallei ATCC 23344 chromosome 2, complete sequence Length = 2325379 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 2058901 gcacatgcacatgcacatgca 2058881 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 2058895 gcacatgcacatgcacatgca 2058875 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 2058889 gcacatgcacatgcacatgc 2058870
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 1349847 gcacatgcacatgcacatgca 1349867 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 acatgcacatgcacatgcag 84 |||||||||||||||||||| Sbjct: 13094744 acatgcacatgcacatgcag 13094763 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 1349842 cacatgcacatgcacatgca 1349861
>gb|AY843546.1| Acacia brevispica microsatellite Ab15 sequence Length = 224 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 194 gcacatgcacatgcacatgca 214
>gb|AC091657.3| Rattus norvegicus strain Brown Norway clone RP31-29N16, complete sequence Length = 141898 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 2916 gcacatgcacatgcacatgca 2896 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 2910 gcacatgcacatgcacatgca 2890 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 2904 gcacatgcacatgcacatgc 2885
>gb|AC104417.14| Homo sapiens chromosome 8, clone RP11-953B20, complete sequence Length = 186063 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgcag 84 ||||||||||||||||||||| Sbjct: 43146 cacatgcacatgcacatgcag 43166
>gb|AC069251.5|AC069251 Genomic sequence for Arabidopsis thaliana BAC F2D10 from chromosome I, complete sequence Length = 143879 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 111625 gcacatgcacatgcacatgca 111605 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 111619 gcacatgcacatgcacatgc 111600
>gb|AC091710.3| Rattus norvegicus strain Brown Norway clone RP31-580N24, complete sequence Length = 87280 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 77034 gcacatgcacatgcacatgca 77014 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 77028 gcacatgcacatgcacatgca 77008 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 77022 gcacatgcacatgcacatgc 77003
>gb|AC117729.9| Mus musculus chromosome 8, clone RP24-126M11, complete sequence Length = 193119 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 119858 gcacatgcacatgcacatgca 119838 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 119863 cacatgcacatgcacatgca 119844
>gb|AC154311.2| Mus musculus BAC clone RP23-359C9 from 16, complete sequence Length = 194103 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 58117 gcacatgcacatgcacatgca 58097
>emb|CT571248.10| Mouse DNA sequence from clone RP24-355C16 on chromosome 16, complete sequence Length = 136128 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 60753 gcacatgcacatgcacatgca 60773 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 60747 gcacatgcacatgcacatgca 60767 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 60741 gcacatgcacatgcacatgca 60761 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 60735 gcacatgcacatgcacatgca 60755 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 60729 gcacatgcacatgcacatgca 60749 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 60724 cacatgcacatgcacatgca 60743
>gb|AC156387.5| Mus musculus 10 BAC RP24-396H15 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 230270 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgcag 84 ||||||||||||||||||||| Sbjct: 7462 cacatgcacatgcacatgcag 7482
>gb|AE003793.3| Drosophila melanogaster chromosome 2R, section 57 of 73 of the complete sequence Length = 271902 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 125790 gcacatgcacatgcacatgca 125810
>emb|AL359220.4|CNS05TEI Human chromosome 14 DNA sequence BAC R-855C23 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 196698 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 135322 gcacatgcacatgcacatgca 135342
>gb|AE003470.4| Drosophila melanogaster chromosome 3L, section 4 of 83 of the complete sequence Length = 318699 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 194964 gcacatgcacatgcacatgca 194984 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 194958 gcacatgcacatgcacatgca 194978
>emb|AL049775.2|CNS00006 Human chromosome 14 DNA sequence BAC R-497E19 of library RPCI-11 from chromosome 14 of Homo sapiens (Human), complete sequence Length = 181433 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 60 caagcacatgcacatgcacat 80 ||||||||||||||||||||| Sbjct: 123883 caagcacatgcacatgcacat 123863
>gb|AE003421.2| Drosophila melanogaster chromosome X, section 5 of 74 of the complete sequence Length = 304204 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 110470 gcacatgcacatgcacatgca 110450
>dbj|AP001980.6| Homo sapiens genomic DNA, chromosome 11 clone:RP11-264L21, complete sequence Length = 151939 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 105911 gcacatgcacatgcacatgca 105891
>dbj|AP003460.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-285P16, complete sequence Length = 171738 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 28586 gcacatgcacatgcacatgca 28566
>gb|AC115809.8| Mus musculus chromosome 8, clone RP23-416L3, complete sequence Length = 193884 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgcag 84 ||||||||||||||||||||| Sbjct: 19626 cacatgcacatgcacatgcag 19606
>gb|AC171680.5| Mus musculus chromosome 7, clone RP23-146B24, complete sequence Length = 200031 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 139469 gcacatgcacatgcacatgca 139489
>gb|AC110192.14| Mus musculus chromosome 7, clone RP23-227K15, complete sequence Length = 181287 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 158851 gcacatgcacatgcacatgca 158871
>gb|AC151998.6| Mus musculus BAC clone RP23-98L16 from chromosome 8, complete sequence Length = 219376 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 155969 gcacatgcacatgcacatgca 155949
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 1349847 gcacatgcacatgcacatgca 1349867 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 65 acatgcacatgcacatgcag 84 |||||||||||||||||||| Sbjct: 13049018 acatgcacatgcacatgcag 13049037 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 1349842 cacatgcacatgcacatgca 1349861
>emb|AL591417.9| Mouse DNA sequence from clone RP23-272C1 on chromosome 11, complete sequence Length = 131385 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 8084 gcacatgcacatgcacatgca 8104
>gb|AC005286.1|AC005286 Drosophila melanogaster DNA sequence (P1s DS01995 (D179), DS03499 (D217), and DS08132 (D174)), complete sequence Length = 173970 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 37904 gcacatgcacatgcacatgca 37924
>emb|BX000507.2|CNS08CDX Oryza sativa chromosome 12, . BAC OJ1003_C01 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 157453 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 79322 gcacatgcacatgcacatgca 79302 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 79327 cacatgcacatgcacatgca 79308
>emb|CT009765.9| Mouse DNA sequence from clone RP23-235B7 on chromosome 12, complete sequence Length = 197822 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 3935 gcacatgcacatgcacatgca 3955 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 3929 gcacatgcacatgcacatgca 3949 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 3923 gcacatgcacatgcacatgca 3943 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 3917 gcacatgcacatgcacatgca 3937 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 3911 gcacatgcacatgcacatgca 3931 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 3905 gcacatgcacatgcacatgca 3925 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 3900 cacatgcacatgcacatgca 3919
>gb|AC151735.3| Mus musculus BAC clone RP23-24D16 from 9, complete sequence Length = 201762 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 161188 gcacatgcacatgcacatgca 161168
>gb|AC154344.1| Mus musculus BAC clone RP23-226G16 from 16, complete sequence Length = 171340 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 116938 gcacatgcacatgcacatgca 116958
>gb|AC134457.4| Mus musculus BAC clone RP23-340O18 from 10, complete sequence Length = 186273 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 98905 gcacatgcacatgcacatgca 98885 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 98910 cacatgcacatgcacatgca 98891
>emb|AL713990.16| Mouse DNA sequence from clone RP23-224N1 on chromosome X, complete sequence Length = 163330 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 11303 gcacatgcacatgcacatgca 11323
>emb|CT030152.4| Mouse DNA sequence from clone RP24-323G18 on chromosome 13, complete sequence Length = 129293 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 120165 gcacatgcacatgcacatgca 120185
>gb|AC163446.2| Mus musculus chromosome 5, clone RP23-151G22, complete sequence Length = 190466 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 155791 gcacatgcacatgcacatgca 155771 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 155785 gcacatgcacatgcacatgca 155765
>emb|AL671269.11| Mouse DNA sequence from clone RP23-143P22 on chromosome 4, complete sequence Length = 183416 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 70527 gcacatgcacatgcacatgca 70507
>emb|AL772402.5| Mouse DNA sequence from clone RP23-65J9 on chromosome 11, complete sequence Length = 242502 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 81189 gcacatgcacatgcacatgca 81169 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 81183 gcacatgcacatgcacatgca 81163 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 81177 gcacatgcacatgcacatgca 81157 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 81171 gcacatgcacatgcacatgca 81151
>gb|AC140979.17| Mus musculus chromosome 1, clone RP23-307M11, complete sequence Length = 209748 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 18836 gcacatgcacatgcacatgca 18816
>gb|AC163685.4| Mus musculus BAC clone RP23-4M16 from chromosome 13, complete sequence Length = 242910 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 169818 gcacatgcacatgcacatgca 169798
>emb|AL021067.1|DMC123F11 Drosophila melanogaster cosmid clone 123F11 Length = 23109 Score = 42.1 bits (21), Expect = 1.7 Identities = 21/21 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgca 83 ||||||||||||||||||||| Sbjct: 488 gcacatgcacatgcacatgca 468
>gb|AC154262.1| Mus musculus chromosome 14 clone RP24-304G19, complete sequence Length = 162962 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 60 caagcacatgcacatgcaca 79 |||||||||||||||||||| Sbjct: 154838 caagcacatgcacatgcaca 154857
>gb|AC110560.11| Mus musculus chromosome 3, clone RP23-254K1, complete sequence Length = 156067 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 2462 cacatgcacatgcacatgca 2481
>gb|AC166650.7| Mus musculus chromosome 5, clone RP23-434O9, complete sequence Length = 207176 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 128882 gcacatgcacatgcacatgc 128901
>gb|AC109147.19| Mus musculus chromosome 8, clone RP23-341D16, complete sequence Length = 184600 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 53534 cacatgcacatgcacatgca 53553
>gb|AC102735.9| Mus musculus chromosome 5, clone RP24-237I4, complete sequence Length = 167871 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 107712 cacatgcacatgcacatgca 107731
>gb|AC166649.5| Mus musculus chromosome 5, clone RP23-379D24, complete sequence Length = 176315 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 96798 gcacatgcacatgcacatgc 96779
>gb|AC101716.6| Mus musculus chromosome 7, clone RP23-287I20, complete sequence Length = 182151 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 151531 cacatgcacatgcacatgca 151512
>gb|AY486602.1| Hevea brasiliensis clone mHbCIRa380 microsatellite sequences Length = 687 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 99 cacatgcacatgcacatgca 80
>gb|CP000017.1| Streptococcus pyogenes MGAS5005, complete genome Length = 1838554 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tggcgtagctgctgtaattt 170 |||||||||||||||||||| Sbjct: 442767 tggcgtagctgctgtaattt 442748
>gb|AC161480.9| Mus musculus chromosome 15, clone RP23-404I10, complete sequence Length = 187202 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 157568 cacatgcacatgcacatgca 157587
>gb|AC111620.5| Rattus norvegicus 2 BAC CH230-123K4 (Children's Hospital Oakland Research Institute) complete sequence Length = 59971 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 41983 cacatgcacatgcacatgca 42002
>gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome Length = 1899877 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tggcgtagctgctgtaattt 170 |||||||||||||||||||| Sbjct: 475367 tggcgtagctgctgtaattt 475348
>gb|AC148336.4| Mus musculus BAC clone RP23-21J15 from chromosome 18, complete sequence Length = 238060 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 234459 cacatgcacatgcacatgca 234478
>gb|AE006511.1| Streptococcus pyogenes M1 GAS, section 40 of 167 of the complete genome Length = 11131 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tggcgtagctgctgtaattt 170 |||||||||||||||||||| Sbjct: 6815 tggcgtagctgctgtaattt 6796
>gb|CP000125.1| Burkholderia pseudomallei 1710b chromosome II, complete sequence Length = 3181762 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 2104564 gcacatgcacatgcacatgc 2104583
>gb|AC091268.2| Rattus norvegicus strain Brown Norway clone RP31-536L14, complete sequence Length = 148631 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 39531 gcacatgcacatgcacatgc 39550
>gb|AC147502.2| Mus musculus BAC clone RP23-111N9 from chromosome 7, complete sequence Length = 202934 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 5745 cacatgcacatgcacatgca 5726
>gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome Length = 1937111 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tggcgtagctgctgtaattt 170 |||||||||||||||||||| Sbjct: 457540 tggcgtagctgctgtaattt 457521
>gb|CP000261.1| Streptococcus pyogenes MGAS2096, complete genome Length = 1860355 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tggcgtagctgctgtaattt 170 |||||||||||||||||||| Sbjct: 447756 tggcgtagctgctgtaattt 447737
>gb|CP000260.1| Streptococcus pyogenes MGAS10270, complete genome Length = 1928252 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tggcgtagctgctgtaattt 170 |||||||||||||||||||| Sbjct: 444861 tggcgtagctgctgtaattt 444842
>gb|CP000259.1| Streptococcus pyogenes MGAS9429, complete genome Length = 1836467 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tggcgtagctgctgtaattt 170 |||||||||||||||||||| Sbjct: 445846 tggcgtagctgctgtaattt 445827
>gb|AC156620.10| Mus musculus chromosome 5, clone RP23-80G18, complete sequence Length = 248320 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 60 caagcacatgcacatgcacatgca 83 |||||||||||||| ||||||||| Sbjct: 218760 caagcacatgcacaggcacatgca 218737
>gb|AC163328.6| Mus musculus chromosome 5, clone RP24-405J8, complete sequence Length = 141045 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 84001 gcacatgcacatgcacatgc 84020
>gb|AC109204.21| Mus musculus chromosome 17, clone RP23-55J9, complete sequence Length = 245496 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 5695 cacatgcacatgcacatgca 5676
>gb|AC165344.3| Mus musculus BAC clone RP23-390P7 from chromosome 16, complete sequence Length = 193532 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 119761 cacatgcacatgcacatgca 119742
>gb|AC166370.3| Mus musculus BAC clone RP23-20I24 from chromosome 9, complete sequence Length = 242229 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 69671 gcacatgcacatgcacatgc 69690
>gb|AC101796.8| Mus musculus chromosome 1, clone RP24-206P18, complete sequence Length = 171181 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 43169 cacatgcacatgcacatgca 43188
>gb|AC139940.5| Mus musculus chromosome 15, clone RP23-468K16, complete sequence Length = 212183 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 33272 cacatgcacatgcacatgca 33291
>gb|AC138093.7| Mus musculus chromosome 16, clone RP24-559J21, complete sequence Length = 123569 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 74233 cacatgcacatgcacatgca 74252
>gb|AC107667.12| Mus musculus chromosome 3, clone RP23-187C2, complete sequence Length = 229632 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 106204 cacatgcacatgcacatgca 106185
>emb|CT009736.8| Mouse DNA sequence from clone RP23-99F22 on chromosome 17, complete sequence Length = 210326 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 26450 cacatgcacatgcacatgca 26431
>emb|CR352310.15| Zebrafish DNA sequence from clone CH211-254E10 in linkage group 24, complete sequence Length = 181023 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 60 caagcacatgcacatgcaca 79 |||||||||||||||||||| Sbjct: 53191 caagcacatgcacatgcaca 53210
>emb|AJ418636.1|SAU418636 Sparus aurata satellite DNA, clone SAdi-IMBB05 Length = 374 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 39 cacatgcacatgcacatgca 58
>gb|AC124728.5| Mus musculus BAC clone RP23-470C22 from chromosome 6, complete sequence Length = 183845 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 141307 cacatgcacatgcacatgca 141326
>gb|AC138768.3| Mus musculus BAC clone RP24-465E14 from chromosome 18, complete sequence Length = 158065 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 51571 cacatgcacatgcacatgca 51552
>gb|AC124429.4| Mus musculus BAC clone RP24-239N4 from chromosome 13, complete sequence Length = 168858 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 153982 cacatgcacatgcacatgca 154001
>gb|AC124483.4| Mus musculus BAC clone RP24-127J3 from chromosome 5, complete sequence Length = 134272 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 15578 gcacatgcacatgcacatgc 15597
>gb|AC124763.4| Mus musculus BAC clone RP23-158P17 from 12, complete sequence Length = 208489 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 3 tattggatataaagcacaca 22 |||||||||||||||||||| Sbjct: 20891 tattggatataaagcacaca 20872
>gb|AC125207.5| Mus musculus BAC clone RP23-220C16 from 8, complete sequence Length = 189936 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 15523 cacatgcacatgcacatgca 15504
>gb|AC124184.3| Mus musculus BAC clone RP23-227N23 from 10, complete sequence Length = 182135 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 147254 cacatgcacatgcacatgca 147273
>emb|CR925759.7| Wallaby DNA sequence from clone MEKBa-346C2, complete sequence Length = 146757 Score = 40.1 bits (20), Expect = 6.8 Identities = 26/28 (92%) Strand = Plus / Plus Query: 55 gtaagcaagcacatgcacatgcacatgc 82 ||||||| ||||||||||| |||||||| Sbjct: 84905 gtaagcatgcacatgcacacgcacatgc 84932
>emb|CR936483.10| Human DNA sequence from clone DAAP-35D11 on chromosome 6, complete sequence Length = 67632 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 catgcacatgcacatgcagt 85 |||||||||||||||||||| Sbjct: 2471 catgcacatgcacatgcagt 2452
>gb|AC113316.14| Mus musculus chromosome 5, clone RP23-441I24, complete sequence Length = 247892 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 165924 cacatgcacatgcacatgca 165943
>gb|AC021218.9| Homo sapiens BAC clone RP11-525O1 from 7, complete sequence Length = 159482 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 27288 cacatgcacatgcacatgca 27269
>gb|AC102409.10| Mus musculus chromosome 18, clone RP24-365B20, complete sequence Length = 137137 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 76350 cacatgcacatgcacatgca 76331
>gb|AC164001.4| Mus musculus chromosome 7, clone RP23-332G12, complete sequence Length = 190345 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 57942 cacatgcacatgcacatgca 57961
>gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome Length = 1897573 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tggcgtagctgctgtaattt 170 |||||||||||||||||||| Sbjct: 445356 tggcgtagctgctgtaattt 445337
>gb|AC163994.4| Mus musculus chromosome 1, clone RP24-132H2, complete sequence Length = 160383 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 64270 cacatgcacatgcacatgca 64289
>emb|BX927314.11| Zebrafish DNA sequence from clone DKEYP-88H4 in linkage group 14, complete sequence Length = 79737 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 60 caagcacatgcacatgcaca 79 |||||||||||||||||||| Sbjct: 32759 caagcacatgcacatgcaca 32740
>emb|Z81008.1|HS369O24 Human DNA sequence from clone RP3-369O24 on chromosome X Contains part of the ODZ1 gene for odz, odd Oz/ten-m homolog 1(Drosophila), complete sequence Length = 110180 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 107146 cacatgcacatgcacatgca 107165
>emb|BX000688.11| Human DNA sequence from clone DAQB-36F16 on chromosome 6 Contains the GPR53P pseudogene for G protein-coupled receptor 53, the OR2I1P pseudogene for olfactory receptor, family 2, subfamily I, member 1, the UBD gene for ubiquitin D, the OR2H5P pseudogene for olfactory receptor, family 2, subfamily H, member 5, the RPL13AP pseudogene for ribosomal protein L13a, the OR2H2 gene for olfactory receptor, family 2, subfamily H, member 2, the GABBR1 gene for gamma-aminobutyric acid (GABA) B receptor, 1, and 3 CpG islands, complete sequence Length = 102684 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 catgcacatgcacatgcagt 85 |||||||||||||||||||| Sbjct: 75647 catgcacatgcacatgcagt 75628
>emb|AL662826.11| Human DNA sequence from clone XXbac-101I20 on chromosome 6 contains a MAS1 oncogene pseudogene, a olfactory receptor, family 2, subfamily I, member 1 pseudogene (OR2I1P, HS6M1-14P), the UBD gene for ubiquitin D (FAT10), a olfactory receptor, family 2, subfamily H, member 5 pseudogene (OR2H5P, HS6M1-13P), a 60S ribosomal protein L13A (RPL13A) pseudogene, the OR2H2 gene for olfactory receptor, family 2, subfamily H, member 2 (HS6M1-12), the GABBR1 gene for gamma-aminobutryic acid (GABA) B receptor, 1 (GPRC3A, GABABR1), the 5' end of the MOG gene for myelin oligodendrocyte protein and three CpG islands, complete sequence Length = 145431 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 catgcacatgcacatgcagt 85 |||||||||||||||||||| Sbjct: 82068 catgcacatgcacatgcagt 82049
>emb|AL645936.5| Human DNA sequence from clone XXbac-126D10 on chromosome 6 contains the OR2H2 gene for olfactory receptor, family 2, subfamily H, member 2, the OR2I1P and OR2H5P pseudogenes for olfactory receptor, family 2, subfamily I, member 1 and subfamily H, member 5, the UBD gene for ubiquitin D, a 60S ribosomal protein L13A (RPL13A) pseudogene, the GABBR1 gene for gamma-aminobutyric acid (GABA) B receptor, 1, a SMT3 suppressor of mif two 3 homolog 1 (SMT3H1) pseudogene, the MOG gene for myelin oligodendrocyte glycoprotein, the gene for a novel KRAB box-containing C2H2 type zinc finger protein and four CpG islands, complete sequence Length = 155874 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 catgcacatgcacatgcagt 85 |||||||||||||||||||| Sbjct: 58940 catgcacatgcacatgcagt 58921
>gb|AC158571.3| Mus musculus chromosome 3, clone RP23-117E23, complete sequence Length = 197545 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 156696 cacatgcacatgcacatgca 156715
>gb|AC158575.3| Mus musculus chromosome 7, clone RP23-275H16, complete sequence Length = 221489 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 37710 cacatgcacatgcacatgca 37691
>gb|AC113633.5| Rattus norvegicus 4 BAC CH230-350N19 (Children's Hospital Oakland Research Institute) complete sequence Length = 133392 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 65791 gcacatgcacatgcacatgc 65772
>gb|AC010053.7| Drosophila melanogaster 3L BAC RP98-6H19 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 128765 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 4839 gcacatgcacatgcacatgc 4820
>emb|BX571966.1| Burkholderia pseudomallei strain K96243, chromosome 2, complete sequence Length = 3173005 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 266151 gcacatgcacatgcacatgc 266170
>gb|BC094506.1| Mus musculus mucin 15, mRNA (cDNA clone MGC:106271 IMAGE:5341608), complete cds Length = 3092 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 2251 cacatgcacatgcacatgca 2232
>gb|BC038066.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:3489729) Length = 2096 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 1254 cacatgcacatgcacatgca 1235
>gb|BC020027.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:3666894) Length = 2070 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 1230 cacatgcacatgcacatgca 1211
>gb|BC048853.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:5150458), with apparent retained intron Length = 2194 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 1354 cacatgcacatgcacatgca 1335
>gb|BC055469.1| Mus musculus mucin 15, mRNA (cDNA clone IMAGE:4024476), partial cds Length = 2433 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 1593 cacatgcacatgcacatgca 1574
>gb|AC117661.20| Mus musculus chromosome 6, clone RP23-343P1, complete sequence Length = 180209 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 30422 cacatgcacatgcacatgca 30403
>emb|CR407571.9| Zebrafish DNA sequence from clone CH211-140C16 in linkage group 1, complete sequence Length = 161017 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 110167 cacatgcacatgcacatgca 110186
>emb|AL646096.8| Mouse DNA sequence from clone RP23-176J13 on chromosome 11 Contains the 5' end of the Scpep1 gene for serine carboxypeptidase 1, two transcription elongation factor B (SIII) polypeptide 2 (Tceb2) pseudogenes, four novel genes (incl. A930013B10Rik), the Coil gene for coilin, the Trim25 gene for tripartite motif protein 25 and the Dgke gene for diacylglycerol kinase epsilon, complete sequence Length = 171512 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 96100 cacatgcacatgcacatgca 96081
>gb|AC078925.18| Homo sapiens 12q BAC RP11-76C10 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 153284 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 115612 cacatgcacatgcacatgca 115593
>emb|BX647858.1|HSM808004 Homo sapiens genomic DNA; cDNA DKFZp313K1416 (from clone DKFZp313K1416) Length = 2410 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 430 cacatgcacatgcacatgca 411
>emb|CR759766.5| Human DNA sequence from clone DAMA-BMC177C8 on chromosome 6, complete sequence Length = 127280 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 catgcacatgcacatgcagt 85 |||||||||||||||||||| Sbjct: 53966 catgcacatgcacatgcagt 53947
>emb|AL714006.13| Mouse DNA sequence from clone RP23-173E15 on chromosome 4 Contains a novel gene and the 3' end of a novel gene, complete sequence Length = 196097 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 14871 cacatgcacatgcacatgca 14852
>emb|CR457461.7| Zebrafish DNA sequence from clone DKEY-23O10 in linkage group 14, complete sequence Length = 213600 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 60 caagcacatgcacatgcaca 79 |||||||||||||||||||| Sbjct: 41131 caagcacatgcacatgcaca 41112
>gb|AC113029.23| Mus musculus chromosome 5, clone RP23-206J17, complete sequence Length = 223809 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 60 caagcacatgcacatgcacatgca 83 |||||||||||||| ||||||||| Sbjct: 182132 caagcacatgcacaggcacatgca 182155
>emb|CR759870.6| Human DNA sequence from clone DADB-225M10 on chromosome 6, complete sequence Length = 57743 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 catgcacatgcacatgcagt 85 |||||||||||||||||||| Sbjct: 30792 catgcacatgcacatgcagt 30773
>emb|CR388210.7| Human DNA sequence from clone DAMA-186H17 on chromosome 6, complete sequence Length = 64196 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 catgcacatgcacatgcagt 85 |||||||||||||||||||| Sbjct: 20317 catgcacatgcacatgcagt 20298
>gb|AC009779.18| Homo sapiens 12 BAC RP11-644F5 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 192550 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 35938 cacatgcacatgcacatgca 35919
>emb|AL928605.22| Mouse DNA sequence from clone RP23-139P14 on chromosome 4, complete sequence Length = 209024 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 186478 cacatgcacatgcacatgca 186497
>emb|BX537453.3|RN86L3 Rattus norvegicus chromosome 1 BAC RP32-86L3, complete sequence Length = 154099 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 85284 cacatgcacatgcacatgca 85265
>gb|AC010033.8| Drosophila melanogaster 3L BAC RP98-3I5 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 188653 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 131326 gcacatgcacatgcacatgc 131307
>gb|AC170742.3| Sorex araneus clone SA_Ba-580J7, complete sequence Length = 156998 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 35047 cacatgcacatgcacatgca 35066
>gb|AE009996.1| Streptococcus pyogenes strain MGAS8232, section 44 of 173 of the complete genome Length = 11130 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tggcgtagctgctgtaattt 170 |||||||||||||||||||| Sbjct: 6816 tggcgtagctgctgtaattt 6797
>gb|AC021979.6| Homo sapiens chromosome 15, clone RP11-30G8, complete sequence Length = 190692 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 27347 cacatgcacatgcacatgca 27328
>gb|AC104340.10| Mus musculus chromosome 7, clone RP24-495M13, complete sequence Length = 170605 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 15011 cacatgcacatgcacatgca 15030
>gb|AC009126.2| Homo sapiens chromosome 5 clone RP11-496M2, complete sequence Length = 177978 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 15885 cacatgcacatgcacatgca 15866
>gb|AC010837.2| Homo sapiens chromosome 18, clone RP11-307E5, complete sequence Length = 210074 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 58663 cacatgcacatgcacatgca 58644
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Plus Query: 359 ccagttggcggcgcagtcggcgtc 382 ||||||||||||| |||||||||| Sbjct: 3877672 ccagttggcggcgaagtcggcgtc 3877695
>gb|DP000052.1| Sus scrofa target 126 genomic scaffold Length = 432382 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 62 agcacatgcacatgcacatg 81 |||||||||||||||||||| Sbjct: 71903 agcacatgcacatgcacatg 71922
>gb|AC092752.2| Genomic sequence for Mus musculus, clone RP23-51O3, complete sequence Length = 226416 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 15947 cacatgcacatgcacatgca 15928
>gb|AC006137.3|AC006137 Homo sapiens clone SCb-254N2 (UWGC:rg254N02) from 6p21, complete sequence Length = 129806 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 66 catgcacatgcacatgcagt 85 |||||||||||||||||||| Sbjct: 49256 catgcacatgcacatgcagt 49275
>gb|AC157594.4| Mus musculus BAC clone RP23-279A2 from chromosome 17, complete sequence Length = 220526 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 52103 cacatgcacatgcacatgca 52122
>gb|AC154572.2| Mus musculus BAC clone RP23-392G15 from chromosome 13, complete sequence Length = 185090 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 49079 cacatgcacatgcacatgca 49060
>gb|AC154505.3| Mus musculus BAC clone RP24-92J14 from chromosome 13, complete sequence Length = 199707 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 105689 cacatgcacatgcacatgca 105708
>gb|AC159741.2| Mus musculus BAC clone RP23-178B21 from chromosome 9, complete sequence Length = 185878 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 158441 gcacatgcacatgcacatgc 158460
>gb|AC148698.1| Macaca mulatta Major Histocompatibility Complex BAC MMU268P23, complete sequence Length = 185838 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 catgcacatgcacatgcagt 85 |||||||||||||||||||| Sbjct: 34025 catgcacatgcacatgcagt 34006
>gb|AC148689.1| Macaca mulatta Major Histocompatibility Complex BAC MMU222I18, complete sequence Length = 174202 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 catgcacatgcacatgcagt 85 |||||||||||||||||||| Sbjct: 131087 catgcacatgcacatgcagt 131068
>dbj|AK043643.1| Mus musculus 10 days neonate cortex cDNA, RIKEN full-length enriched library, clone:A830014N07 product:unclassifiable, full insert sequence Length = 2863 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 1025 cacatgcacatgcacatgca 1006
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 40.1 bits (20), Expect = 6.8 Identities = 47/56 (83%) Strand = Plus / Plus Query: 175 gcttgtcctcgtaacgttcccagaccatgaccccgccatagttggccgccttctgc 230 ||||||| | ||| || ||||||| ||||| ||||| |||||| ||||||||||| Sbjct: 14484682 gcttgtcgtagtatcggtcccagatcatgaagccgccgtagttgtccgccttctgc 14484737
>gb|AC100738.8| Mus musculus chromosome 15, clone RP24-362K21, complete sequence Length = 128950 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 58627 cacatgcacatgcacatgca 58646
>gb|DP000027.1| Rattus norvegicus target 1 genomic scaffold Length = 1888123 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 1244995 gcacatgcacatgcacatgc 1245014
>gb|AC008906.5|AC008906 Homo sapiens chromosome 5 clone CTD-2260A17, complete sequence Length = 151801 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 88742 cacatgcacatgcacatgca 88723
>gb|AC155817.2| Mus musculus BAC clone RP23-473M8 from chromosome 12, complete sequence Length = 159497 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 29950 cacatgcacatgcacatgca 29931
>gb|AC156015.2| Mus musculus BAC clone RP24-345H1 from chromosome 16, complete sequence Length = 154624 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 50006 cacatgcacatgcacatgca 49987
>gb|AC012074.9| Homo sapiens BAC clone RP11-458N5 from 2, complete sequence Length = 197652 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 168710 gcacatgcacatgcacatgc 168691
>gb|AC013719.8| Homo sapiens BAC clone RP11-270E5 from 2, complete sequence Length = 152996 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 79453 cacatgcacatgcacatgca 79434
>gb|AE014074.1| Streptococcus pyogenes MGAS315, complete genome Length = 1900521 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 151 tggcgtagctgctgtaattt 170 |||||||||||||||||||| Sbjct: 427887 tggcgtagctgctgtaattt 427868
>gb|AC009073.8|AC009073 Homo sapiens chromosome 16 clone RP11-31O11, complete sequence Length = 177978 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 15885 cacatgcacatgcacatgca 15866
>gb|AC139849.5| Mus musculus BAC clone RP23-84M17 from chromosome 7, complete sequence Length = 189942 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 30858 cacatgcacatgcacatgca 30839
>dbj|BA000034.2| Streptococcus pyogenes SSI-1 DNA, complete genome Length = 1894275 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 151 tggcgtagctgctgtaattt 170 |||||||||||||||||||| Sbjct: 1468855 tggcgtagctgctgtaattt 1468874
>gb|AC103635.8| Mus musculus chromosome 1, clone RP24-397O8, complete sequence Length = 188226 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 37172 gcacatgcacatgcacatgc 37153
>dbj|AP004732.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0021M10 Length = 163416 Score = 40.1 bits (20), Expect = 6.8 Identities = 47/56 (83%) Strand = Plus / Plus Query: 175 gcttgtcctcgtaacgttcccagaccatgaccccgccatagttggccgccttctgc 230 ||||||| | ||| || ||||||| ||||| ||||| |||||| ||||||||||| Sbjct: 77856 gcttgtcgtagtatcggtcccagatcatgaagccgccgtagttgtccgccttctgc 77911
>emb|BX548065.6| Mouse DNA sequence from clone RP23-163B21 on chromosome X, complete sequence Length = 225082 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 82307 cacatgcacatgcacatgca 82326
>emb|AL844579.10| Mouse DNA sequence from clone RP23-219M22 on chromosome 2, complete sequence Length = 103290 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 42287 cacatgcacatgcacatgca 42268
>emb|BX294656.8| Zebrafish DNA sequence from clone CH211-238M13, complete sequence Length = 162077 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 59327 cacatgcacatgcacatgca 59308
>gb|AC154342.2| Mus musculus BAC clone RP23-227D10 from 17, complete sequence Length = 199709 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 62321 cacatgcacatgcacatgca 62302
>gb|AC154244.2| Mus musculus BAC clone RP24-321P20 from 17, complete sequence Length = 172093 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 50462 cacatgcacatgcacatgca 50443
>gb|AC122362.5| Mus musculus BAC clone RP23-430N1 from chromosome 6, complete sequence Length = 212275 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 191335 cacatgcacatgcacatgca 191316
>gb|AC140488.4| Mus musculus BAC clone RP24-142A8 from 9, complete sequence Length = 185649 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 124609 cacatgcacatgcacatgca 124628
>gb|AC122495.4| Mus musculus BAC clone RP24-397P10 from 9, complete sequence Length = 175838 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 129905 cacatgcacatgcacatgca 129886
>gb|AC155233.2| Mus musculus BAC clone RP24-381F23 from 12, complete sequence Length = 149905 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 2869 cacatgcacatgcacatgca 2888
>emb|CT954231.1| Medicago truncatula chromosome 5 clone mth2-166e2, COMPLETE SEQUENCE Length = 122895 Score = 40.1 bits (20), Expect = 6.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 60 caagcacatgcacatgcacatgca 83 |||||||| ||||||||||||||| Sbjct: 9247 caagcacaagcacatgcacatgca 9224
>gb|AC105335.27| Mus musculus chromosome 5, clone RP23-377H14, complete sequence Length = 171789 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 63343 cacatgcacatgcacatgca 63362
>gb|AC174449.2| Mus musculus BAC clone RP23-338O19 from chromosome 6, complete sequence Length = 217169 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 814 cacatgcacatgcacatgca 795
>emb|X95927.1|RNCFTR7 R.norvegicus CFTR gene Length = 4787 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 4003 gcacatgcacatgcacatgc 4022
>gb|AE003544.4| Drosophila melanogaster chromosome 3L, section 41 of 83 of the complete sequence Length = 280378 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 63 gcacatgcacatgcacatgc 82 |||||||||||||||||||| Sbjct: 149774 gcacatgcacatgcacatgc 149755
>gb|AC115296.6| Mus musculus BAC clone RP23-195I8 from chromosome 12, complete sequence Length = 211561 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 3 tattggatataaagcacaca 22 |||||||||||||||||||| Sbjct: 81700 tattggatataaagcacaca 81719
>emb|BX629359.1|CNS09SBT Tetraodon nigroviridis BAC sequence Length = 139693 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 109011 cacatgcacatgcacatgca 109030
>gb|AC115725.9| Mus musculus chromosome 5, clone RP23-21A18, complete sequence Length = 278172 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 254552 cacatgcacatgcacatgca 254571
>emb|CT571274.6| Mouse DNA sequence from clone RP24-142M17 on chromosome 14, complete sequence Length = 178159 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 60 caagcacatgcacatgcaca 79 |||||||||||||||||||| Sbjct: 150708 caagcacatgcacatgcaca 150727
>gb|AC154614.3| Mus musculus BAC clone RP23-255I2 from chromosome 14, complete sequence Length = 186187 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 65805 cacatgcacatgcacatgca 65824
>emb|AL691450.15| Mouse DNA sequence from clone RP23-20F9 on chromosome 2, complete sequence Length = 181372 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 37404 cacatgcacatgcacatgca 37385
>gb|AC119921.12| Mus musculus chromosome 12, clone RP24-252B23, complete sequence Length = 162290 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 64 cacatgcacatgcacatgca 83 |||||||||||||||||||| Sbjct: 22263 cacatgcacatgcacatgca 22282
>emb|AL031983.2|HS271M21 Human DNA sequence from clone RP1-271M21 on chromosome 6p21.31-22.2 Contains a MAS1 oncogene pseudogene, the OR2H2 gene for olfactory receptor 2H2, olfactory receptor 2I1 and 2H5 pseudogenes OR2I1P and OR2H5P, the gene for diubiquitin, an RPL13A (60S Ribosomal Protein L13A) pseudogene, the GABBR1 gene for gamma-aminobutyric acid (GABA) B receptor 1 and an SMT3H1 or SMT3H2 (SMT3 (suppressor of mif two 3, yeast) homolog) pseudogene and three CpG islands, complete sequence Length = 134292 Score = 40.1 bits (20), Expect = 6.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 66 catgcacatgcacatgcagt 85 |||||||||||||||||||| Sbjct: 104348 catgcacatgcacatgcagt 104329 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,339,625 Number of Sequences: 3902068 Number of extensions: 3339625 Number of successful extensions: 78227 Number of sequences better than 10.0: 271 Number of HSP's better than 10.0 without gapping: 273 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 76383 Number of HSP's gapped (non-prelim): 1678 length of query: 504 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 482 effective length of database: 17,147,199,772 effective search space: 8264950290104 effective search space used: 8264950290104 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)