>emb|AL358074.22| Human DNA sequence from clone RP11-423C15 on chromosome 9 Contains
            the 5' end of the MAPKAP1 gene for mitogen-activated
            protein kinase associated protein 1, a novel gene, the 5'
            end of the PBX3 gene for pre-B-cell leukemia
            transcription factor 3 and three CpG islands, complete
            sequence
          Length = 109081

 Score = 42.1 bits (21), Expect = 0.21
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 22   caaatcatttgtgaagttgtt 42
            |||||||||||||||||||||
Sbjct: 2601 caaatcatttgtgaagttgtt 2621

>gb|AC022537.8| Homo sapiens chromosome 10 clone RP11-40C11, complete sequence
          Length = 154939

 Score = 40.1 bits (20), Expect = 0.85
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 21     gcaaatcatttgtgaagttgttgtgtca 48
              |||||||||||||| |||||| ||||||
Sbjct: 124096 gcaaatcatttgtggagttgtagtgtca 124123

>gb|AC157562.8| Mus musculus chromosome 1, clone RP24-304A3, complete sequence
          Length = 120189

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 29    tttgtgaagttgttgtgtc 47
             |||||||||||||||||||
Sbjct: 32525 tttgtgaagttgttgtgtc 32543

>gb|AC117778.10| Mus musculus chromosome 1, clone RP24-540L1, complete sequence
          Length = 168025

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 52    tttagaagtaactgcatta 70
             |||||||||||||||||||
Sbjct: 58431 tttagaagtaactgcatta 58413

>gb|AC139349.4| Mus musculus BAC clone RP24-318A14 from chromosome 8, complete sequence
          Length = 199464

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 49     tcctttagaagtaactgca 67
              |||||||||||||||||||
Sbjct: 156942 tcctttagaagtaactgca 156924

>gb|AC146163.3| Pan troglodytes BAC clone RP43-24D16 from 7, complete sequence
          Length = 162475

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 46     tcatcctttagaagtaactgcat 68
              |||||||||| ||||||||||||
Sbjct: 135494 tcatcctttaaaagtaactgcat 135472

>gb|AE014303.1| Homo sapiens chromosome 13q34 schizophrenia region contig 2 section 3 of
              3 of the complete sequence
          Length = 209806

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 46     tcatcctttagaagtaact 64
              |||||||||||||||||||
Sbjct: 166982 tcatcctttagaagtaact 167000

>gb|AC166548.2| Nectria haematococca clone JGIAYWI-9B5, complete sequence
          Length = 41007

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 15   aacatggcaaatcatttgt 33
            |||||||||||||||||||
Sbjct: 2393 aacatggcaaatcatttgt 2411

>emb|BX664742.15| Zebrafish DNA sequence from clone DKEY-193L3 in linkage group 8, complete
              sequence
          Length = 215608

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 26     tcatttgtgaagttgttgt 44
              |||||||||||||||||||
Sbjct: 179103 tcatttgtgaagttgttgt 179085

>emb|AL512629.7| Human DNA sequence from clone RP11-564N10 on chromosome 13 Contains the
             5' end of the FGF14 gene for fibroblast growth factor 14,
             a lipoyltransferase (LOC51601) pseudogene and a CpG
             island, complete sequence
          Length = 188696

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 46    tcatcctttagaagtaact 64
             |||||||||||||||||||
Sbjct: 17877 tcatcctttagaagtaact 17895

>gb|AF503504.2| Photorhabdus luminescens MtaD-like protein gene, partial cds;
            putative inner membrane protein, putative efflux protein,
            MhpE-like protein, hypothetical protein, DlpA-like
            protein, CinA-like protein, DlpA-like protein; complete
            cds; mcf pathogenicity island, complete sequence;
            tRNA-Phe gene, complete sequence; and TetR-family-like
            regulatory protein (tetR) gene, partial cds
          Length = 35876

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 22   caaatcatttgtgaagttg 40
            |||||||||||||||||||
Sbjct: 8455 caaatcatttgtgaagttg 8473

>gb|AC126917.1| Homo sapiens chromosome 5 clone RP11-467F22, complete sequence
          Length = 206737

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 13    caaacatggcaaatcattt 31
             |||||||||||||||||||
Sbjct: 42845 caaacatggcaaatcattt 42863

>gb|AC138393.2| Homo sapiens chromosome 1 clone RP11-504P24, complete sequence
          Length = 184644

 Score = 38.2 bits (19), Expect = 3.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 18     atggcaaatcatttgtgaa 36
              |||||||||||||||||||
Sbjct: 171312 atggcaaatcatttgtgaa 171294


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 722,820
Number of Sequences: 3902068
Number of extensions: 722820
Number of successful extensions: 47485
Number of sequences better than 10.0: 13
Number of HSP's better than 10.0 without gapping: 13
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 47466
Number of HSP's gapped (non-prelim): 19
length of query: 81
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 60
effective length of database: 17,151,101,840
effective search space: 1029066110400
effective search space used: 1029066110400
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)