Clone Name	basd3m13
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|BC079674.1| Mus musculus ubiquitin specific peptidase 20, mRN...	48	0.034
2	gb|BC037199.1| Mus musculus ubiquitin specific peptidase 20, mRN...	48	0.034
3	gb|AF449715.1| Mus musculus pVHL-interacting deubiquitinating en...	48	0.034
4	dbj|AK163663.1| Mus musculus 10 days neonate medulla oblongata c...	48	0.034
5	dbj|AK047242.1| Mus musculus 10 days neonate cerebellum cDNA, RI...	48	0.034
6	dbj|AK087412.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN f...	48	0.034
7	dbj|AK054279.1| Mus musculus 2 days pregnant adult female ovary ...	48	0.034
8	dbj|AK029890.1| Mus musculus adult male testis cDNA, RIKEN full-...	48	0.034
9	dbj|AK173083.1| Mus musculus mRNA for mKIAA1003 protein	48	0.034
10	ref|NM_028846.2| Mus musculus ubiquitin specific peptidase 20 (U...	48	0.034
11	emb|AL844546.8| Mouse DNA sequence from clone RP23-243I3 on chro...	48	0.034
12	emb|AL031686.2|HS981L23 Human DNA sequence from clone RP5-981L23...	44	0.53
13	gb|AC009469.4| Homo sapiens BAC clone RP11-20N16 from 2, complet...	44	0.53
14	gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence	42	2.1
15	emb|AL590423.14| Human DNA sequence from clone RP13-364K23 on ch...	42	2.1
16	emb|AL157703.14| Human DNA sequence from clone RP11-79K3 on chro...	42	2.1
17	emb|AL157877.11| Human DNA sequence from clone RP11-2P5 on chrom...	42	2.1
18	gb|AE009602.1| Brucella melitensis 16M chromosome I, section 159...	42	2.1
19	dbj|AB178530.1| Caiman crocodilus GARS-AIRS-GART mRNA for glycin...	42	2.1
20	gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I...	42	2.1
21	emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I,...	42	2.1
22	ref|XM_475143.1| Oryza sativa (japonica cultivar-group), predic...	40	8.2
23	gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome...	40	8.2
24	gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome	40	8.2
25	gb|AC127411.3| Mus musculus BAC clone RP23-60E24 from chromosome...	40	8.2
26	gb|AC159503.10| Mus musculus 10 BAC RP24-293I2 (Roswell Park Can...	40	8.2
27	gb|AC096909.10| Rattus norvegicus 8 BAC CH230-88B13 (Children's ...	40	8.2
28	emb|AL391724.7| Human DNA sequence from clone RP11-350A18 on chr...	40	8.2
29	gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome	40	8.2
30	gb|AC068189.11| Homo sapiens chromosome 8, clone RP11-320N21, co...	40	8.2
31	ref|XM_941210.1| PREDICTED: Homo sapiens kinesin family member 2...	40	8.2
32	ref|XM_050278.8| PREDICTED: Homo sapiens kinesin family member 2...	40	8.2
33	dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D...	40	8.2
34	gb|AC079585.3| Homo sapiens BAC clone RP11-161A24 from 2, comple...	40	8.2
35	gb|AC018801.4|AC018801 Homo sapiens BAC clone RP11-279O19 from 8...	40	8.2
36	ref|XM_231148.3| PREDICTED: Rattus norvegicus ubiquitin specific...	40	8.2
37	dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ...	40	8.2
38	gb|AC153911.5| Mus musculus 10 BAC RP23-182J19 (Roswell Park Can...	40	8.2
39	emb|AL110479.1|CEY105C5B Caenorhabditis elegans YAC Y105C5B, com...	40	8.2
40	gb|AC153021.2| Mus musculus 10 BAC RP23-37G3 (Roswell Park Cance...	40	8.2
41	dbj|AB033062.2| Homo sapiens mRNA for KIAA1236 protein, partial cds	40	8.2

---

>gb|BC079674.1| Mus musculus ubiquitin specific peptidase 20, mRNA (cDNA clone
           MGC:90775 IMAGE:30531994), complete cds
          Length = 5012

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 466 tgctcgggactccgattccagtga 489
           ||||||||||||||||||||||||
Sbjct: 904 tgctcgggactccgattccagtga 927

---

>gb|BC037199.1| Mus musculus ubiquitin specific peptidase 20, mRNA (cDNA clone
           IMAGE:3672749)
          Length = 3544

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 466 tgctcgggactccgattccagtga 489
           ||||||||||||||||||||||||
Sbjct: 399 tgctcgggactccgattccagtga 422

---

>gb|AF449715.1| Mus musculus pVHL-interacting deubiquitinating enzyme 2 (Vdu2)
           mRNA, complete cds
          Length = 4094

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 466 tgctcgggactccgattccagtga 489
           ||||||||||||||||||||||||
Sbjct: 966 tgctcgggactccgattccagtga 989

---

>dbj|AK163663.1| Mus musculus 10 days neonate medulla oblongata cDNA, RIKEN
           full-length enriched library, clone:B830039L20
           product:ubiquitin specific protease 20, full insert
           sequence
          Length = 4052

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 466 tgctcgggactccgattccagtga 489
           ||||||||||||||||||||||||
Sbjct: 925 tgctcgggactccgattccagtga 948

---

>dbj|AK047242.1| Mus musculus 10 days neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:B930041H10 product:BA409K20.4
           (UBIQUITIN SPECIFIC PROTEASE 20 (KIAA1003)) homolog
           [Homo sapiens], full insert sequence
          Length = 4065

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 466 tgctcgggactccgattccagtga 489
           ||||||||||||||||||||||||
Sbjct: 934 tgctcgggactccgattccagtga 957

---

>dbj|AK087412.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched
           library, clone:E130012I02 product:ubiquitin specific
           protease 20, full insert sequence
          Length = 4053

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 466 tgctcgggactccgattccagtga 489
           ||||||||||||||||||||||||
Sbjct: 926 tgctcgggactccgattccagtga 949

---

>dbj|AK054279.1| Mus musculus 2 days pregnant adult female ovary cDNA, RIKEN
           full-length enriched library, clone:E330009O13
           product:ubiquitin specific protease 20, full insert
           sequence
          Length = 4101

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 466 tgctcgggactccgattccagtga 489
           ||||||||||||||||||||||||
Sbjct: 958 tgctcgggactccgattccagtga 981

---

>dbj|AK029890.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4931427A11 product:ubiquitin specific
           protease 20, full insert sequence
          Length = 4980

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 466 tgctcgggactccgattccagtga 489
           ||||||||||||||||||||||||
Sbjct: 912 tgctcgggactccgattccagtga 935

---

>dbj|AK173083.1| Mus musculus mRNA for mKIAA1003 protein
          Length = 4044

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 466 tgctcgggactccgattccagtga 489
           ||||||||||||||||||||||||
Sbjct: 917 tgctcgggactccgattccagtga 940

---

>ref|NM_028846.2| Mus musculus ubiquitin specific peptidase 20 (Usp20), mRNA
          Length = 5012

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                   
Query: 466 tgctcgggactccgattccagtga 489
           ||||||||||||||||||||||||
Sbjct: 904 tgctcgggactccgattccagtga 927

---

>emb|AL844546.8| Mouse DNA sequence from clone RP23-243I3 on chromosome 2, complete
             sequence
          Length = 170475

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 24/24 (100%)
 Strand = Plus / Plus

                                     
Query: 466   tgctcgggactccgattccagtga 489
             ||||||||||||||||||||||||
Sbjct: 35834 tgctcgggactccgattccagtga 35857

---

>emb|AL031686.2|HS981L23 Human DNA sequence from clone RP5-981L23 on chromosome 20q12.1-13.2
            Contains the 5' end of the ELMO2 gene for engulfment and
            cell motility 2 (ced-12 homolog, C. elegans), a Krueppel
            type zinc-finger protein pseudogene, a Makorin (MKRN1 or
            MKRN3) ring finger protein pseudogene, a novel KRAB box
            type zinc-finger protein gene, a novel gene
            (DKFZp547G0215) and a CpG island, complete sequence
          Length = 94817

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                  
Query: 560  tggaaatgaccatgttgccctt 581
            ||||||||||||||||||||||
Sbjct: 8269 tggaaatgaccatgttgccctt 8290

---

>gb|AC009469.4| Homo sapiens BAC clone RP11-20N16 from 2, complete sequence
          Length = 168448

 Score = 44.1 bits (22), Expect = 0.53
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 487   tgattccaaagcccacgtcttc 508
             ||||||||||||||||||||||
Sbjct: 39383 tgattccaaagcccacgtcttc 39404

---

>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence
          Length = 2107794

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 58     cgccggtcattgccacggcca 78
              |||||||||||||||||||||
Sbjct: 263955 cgccggtcattgccacggcca 263975

---

>emb|AL590423.14| Human DNA sequence from clone RP13-364K23 on chromosome Xq22.1-23
             Contains the DSIPI gene for delta sleep inducing peptide,
             immunoreactor (DIP, GILZ, TSC-22R), the 5' end of a novel
             gene and two CpG islands, complete sequence
          Length = 83167

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 98    cctccccaagctctgggtcct 118
             |||||||||||||||||||||
Sbjct: 49083 cctccccaagctctgggtcct 49103

---

>emb|AL157703.14| Human DNA sequence from clone RP11-79K3 on chromosome 9p23-24.3,
             complete sequence
          Length = 90278

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 209   tccactgctgccttggccagg 229
             |||||||||||||||||||||
Sbjct: 70583 tccactgctgccttggccagg 70603

---

>emb|AL157877.11| Human DNA sequence from clone RP11-2P5 on chromosome 13 Contains the 5'
             end of a novel gene, the gene for suppressor of G2 allele
             of SKP1, S. cerevisiae, the 5' end of a gene similar to
             TPTE and PTEN homologous inositol lipid phosphatase (TPIP)
             , a pseudogene similar to part of regulator of G-protein
             signalling 17 (RGS17), the WBP4 gene for WW domain binding
             protein 4 (formin binding protein 21) and 4 CpG islands,
             complete sequence
          Length = 198567

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 417   ttatttattttgcagactagc 437
             |||||||||||||||||||||
Sbjct: 30696 ttatttattttgcagactagc 30716

---

>gb|AE009602.1| Brucella melitensis 16M chromosome I, section 159 of 195 of the
           complete sequence
          Length = 10281

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 58  cgccggtcattgccacggcca 78
           |||||||||||||||||||||
Sbjct: 910 cgccggtcattgccacggcca 890

---

>dbj|AB178530.1| Caiman crocodilus GARS-AIRS-GART mRNA for glycinamide
           ribonucleotide synthetase-aminoimidazole ribonucleotide
           synthetase-glycinamide ribonucleotide transformylase,
           partial cds
          Length = 2599

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 565 atgaccatgttgcccttgccc 585
           |||||||||||||||||||||
Sbjct: 99  atgaccatgttgcccttgccc 119

---

>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence
          Length = 2124241

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 58     cgccggtcattgccacggcca 78
              |||||||||||||||||||||
Sbjct: 286180 cgccggtcattgccacggcca 286200

---

>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence,
              strain 2308
          Length = 2121359

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 58     cgccggtcattgccacggcca 78
              |||||||||||||||||||||
Sbjct: 282547 cgccggtcattgccacggcca 282567

---

>ref|XM_475143.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1164

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 235 gagcgggaggaggacgaagg 254
           ||||||||||||||||||||
Sbjct: 418 gagcgggaggaggacgaagg 437

---

>gb|AC119289.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone
             OSJNBa0025P09, complete sequence
          Length = 167318

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 235   gagcgggaggaggacgaagg 254
             ||||||||||||||||||||
Sbjct: 48777 gagcgggaggaggacgaagg 48758

---

>gb|CP000360.1| Acidobacteria bacterium Ellin345, complete genome
          Length = 5650368

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 585    cgtaaacagcaccttcgaga 604
              ||||||||||||||||||||
Sbjct: 398931 cgtaaacagcaccttcgaga 398912

---

>gb|AC127411.3| Mus musculus BAC clone RP23-60E24 from chromosome 5, complete sequence
          Length = 217636

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 208    gtccactgctgccttggcca 227
              ||||||||||||||||||||
Sbjct: 180973 gtccactgctgccttggcca 180954

---

>gb|AC159503.10| Mus musculus 10 BAC RP24-293I2 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 199258

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 388    agctgctctgcccaggggcc 407
              ||||||||||||||||||||
Sbjct: 168331 agctgctctgcccaggggcc 168350

---

>gb|AC096909.10| Rattus norvegicus 8 BAC CH230-88B13 (Children's Hospital Oakland
             Research Institute) complete sequence
          Length = 241078

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 543   actatgtgatctcacaatgg 562
             ||||||||||||||||||||
Sbjct: 39334 actatgtgatctcacaatgg 39315

---

>emb|AL391724.7| Human DNA sequence from clone RP11-350A18 on chromosome 13 Contains a
              novel gene, complete sequence
          Length = 141628

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 487    tgattccaaagcccacgtct 506
              ||||||||||||||||||||
Sbjct: 114694 tgattccaaagcccacgtct 114713

---

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 73      cggccaagggcgtgctcgag 92
               ||||||||||||||||||||
Sbjct: 3029875 cggccaagggcgtgctcgag 3029856

---

>gb|AC068189.11| Homo sapiens chromosome 8, clone RP11-320N21, complete sequence
          Length = 147543

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 97    ccctccccaagctctgggtcctac 120
             |||||||||||| |||||||||||
Sbjct: 35593 ccctccccaagccctgggtcctac 35616

---

>ref|XM_941210.1| PREDICTED: Homo sapiens kinesin family member 26A (KIF26A), mRNA
          Length = 6745

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 210 ccactgctgccttggccaggcacgcgagcgggagga 245
           |||| ||||||| ||||||||||||  |||||||||
Sbjct: 751 ccaccgctgcctcggccaggcacgccggcgggagga 716

---

>ref|XM_050278.8| PREDICTED: Homo sapiens kinesin family member 26A (KIF26A), mRNA
          Length = 6751

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 210 ccactgctgccttggccaggcacgcgagcgggagga 245
           |||| ||||||| ||||||||||||  |||||||||
Sbjct: 751 ccaccgctgcctcggccaggcacgccggcgggagga 716

---

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 235      gagcgggaggaggacgaagg 254
                ||||||||||||||||||||
Sbjct: 17788823 gagcgggaggaggacgaagg 17788804

---

>gb|AC079585.3| Homo sapiens BAC clone RP11-161A24 from 2, complete sequence
          Length = 63107

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 532   gtaccattttcactatgtga 551
             ||||||||||||||||||||
Sbjct: 13902 gtaccattttcactatgtga 13883

---

>gb|AC018801.4|AC018801 Homo sapiens BAC clone RP11-279O19 from 8, complete sequence
          Length = 177130

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 97     ccctccccaagctctgggtcctac 120
              |||||||||||| |||||||||||
Sbjct: 130637 ccctccccaagccctgggtcctac 130660

---

>ref|XM_231148.3| PREDICTED: Rattus norvegicus ubiquitin specific protease 20
            (predicted) (Usp20_predicted), mRNA
          Length = 5067

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 466  tgctcgggactccgattccagtga 489
            |||||||||||| |||||||||||
Sbjct: 1029 tgctcgggactcagattccagtga 1052

---

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 55      cgacgccggtcattgccacg 74
               ||||||||||||||||||||
Sbjct: 3720830 cgacgccggtcattgccacg 3720811

---

>gb|AC153911.5| Mus musculus 10 BAC RP23-182J19 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 219859

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 388   agctgctctgcccaggggcc 407
             ||||||||||||||||||||
Sbjct: 97450 agctgctctgcccaggggcc 97431

---

>emb|AL110479.1|CEY105C5B Caenorhabditis elegans YAC Y105C5B, complete sequence
          Length = 321304

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 537    attttcactatgtgatctcacaat 560
              ||||||||||| ||||||||||||
Sbjct: 235279 attttcactatttgatctcacaat 235302

---

>gb|AC153021.2| Mus musculus 10 BAC RP23-37G3 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 187132

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 388   agctgctctgcccaggggcc 407
             ||||||||||||||||||||
Sbjct: 15132 agctgctctgcccaggggcc 15151

---

>dbj|AB033062.2| Homo sapiens mRNA for KIAA1236 protein, partial cds
          Length = 6627

 Score = 40.1 bits (20), Expect = 8.2
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 210 ccactgctgccttggccaggcacgcgagcgggagga 245
           |||| ||||||| ||||||||||||  |||||||||
Sbjct: 625 ccaccgctgcctcggccaggcacgccggcgggagga 590


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,207,022
Number of Sequences: 3902068
Number of extensions: 5207022
Number of successful extensions: 87802
Number of sequences better than 10.0: 41
Number of HSP's better than 10.0 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 87513
Number of HSP's gapped (non-prelim): 289
length of query: 606
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 583
effective length of database: 17,143,297,704
effective search space: 9994542561432
effective search space used: 9994542561432
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---