ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd3f16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC006126.1|AC006126 Homo sapiens chromosome 19, cosmid F18718... 46 0.086
2gb|AC125229.3| Mus musculus BAC clone RP23-45P1 from 5, complete... 44 0.34
3ref|XM_389637.1| Gibberella zeae PH-1 chromosome 4 hypothetical ... 42 1.3
4gb|AC129492.6| Homo sapiens chromosome 17, clone RP11-599B13, co... 42 1.3
5gb|AC131702.3| Mus musculus BAC clone RP24-177J5 from chromosome... 42 1.3
6gb|AC091297.3| Sus scrofa clone RP44-52N13, complete sequence 42 1.3
7emb|AL603764.27| Human DNA sequence from clone RP11-481L19 on ch... 42 1.3
8gb|AC107913.7| Homo sapiens chromosome 17, clone CTD-3051C7, com... 42 1.3
9gb|AC104762.7| Homo sapiens chromosome 17, clone RP11-769H22, co... 42 1.3
10gb|AC009383.8| Drosophila melanogaster 3L BAC RP98-31C3 (Roswell... 42 1.3
11dbj|BA000043.1| Geobacillus kaustophilus HTA426 DNA, complete ge... 42 1.3
12gb|AC145691.5| Mus musculus chromosome 1, clone RP24-278B15, com... 42 1.3
13gb|AE003514.4| Drosophila melanogaster chromosome 3L, section 71... 42 1.3
14emb|AJ305027.1|HSA305027 Homo sapiens partial ALOX12B gene for a... 42 1.3
15gb|AC109163.16| Mus musculus chromosome 8, clone RP24-174F12, co... 42 1.3
16gb|AC167185.4| Mus musculus chromosome 3, clone RP23-355G8, comp... 40 5.3
17ref|XM_366649.1| Magnaporthe grisea 70-15 chromosome VII hypothe... 40 5.3
18gb|AC124361.4| Mus musculus BAC clone RP24-528I8 from chromosome... 40 5.3
19gb|AC008581.11| Homo sapiens chromosome 5 clone CTC-564N23, comp... 40 5.3
20gb|AC027342.5| Homo sapiens chromosome 5 clone CTD-2294O13, comp... 40 5.3
21dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 5.3
22gb|AF267176.1|AF267176 Pyricularia grisea chromosome 7 clone BAC... 40 5.3
23dbj|AP005658.3| Oryza sativa (japonica cultivar-group) genomic D... 40 5.3
24emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,comp... 40 5.3
25gb|AC166336.15| Mus musculus chromosome 1, clone RP24-74G12, com... 40 5.3
26gb|AC131699.4| Mus musculus BAC clone RP23-440F17 from 1, comple... 40 5.3
27gb|AC167197.6| Mus musculus chromosome 1, clone RP23-62B14, comp... 40 5.3

>gb|AC006126.1|AC006126 Homo sapiens chromosome 19, cosmid F18718, complete sequence
          Length = 46100

 Score = 46.1 bits (23), Expect = 0.086
 Identities = 26/27 (96%)
 Strand = Plus / Plus

                                       
Query: 25   ctctcctccctccgaccctccctcttc 51
            ||||||||||||| |||||||||||||
Sbjct: 9820 ctctcctccctcccaccctccctcttc 9846



to top

>gb|AC125229.3| Mus musculus BAC clone RP23-45P1 from 5, complete sequence
          Length = 167771

 Score = 44.1 bits (22), Expect = 0.34
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 287    ggaggcatggagccttcagagt 308
              ||||||||||||||||||||||
Sbjct: 103944 ggaggcatggagccttcagagt 103923



to top

>ref|XM_389637.1| Gibberella zeae PH-1 chromosome 4 hypothetical protein (FG09461.1)
            partial mRNA
          Length = 1731

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 239  acatggctgtagcggcggcgc 259
            |||||||||||||||||||||
Sbjct: 1517 acatggctgtagcggcggcgc 1537



to top

>gb|AC129492.6| Homo sapiens chromosome 17, clone RP11-599B13, complete sequence
          Length = 196037

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 309   cccctcctcctgccggtggcc 329
             |||||||||||||||||||||
Sbjct: 67872 cccctcctcctgccggtggcc 67892



to top

>gb|AC131702.3| Mus musculus BAC clone RP24-177J5 from chromosome 7, complete sequence
          Length = 154632

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    cctgggatctctcctccctcc 37
             |||||||||||||||||||||
Sbjct: 38407 cctgggatctctcctccctcc 38427



to top

>gb|AC091297.3| Sus scrofa clone RP44-52N13, complete sequence
          Length = 142057

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 24    tctctcctccctccgaccctccctc 48
             |||||||||||||| ||||||||||
Sbjct: 92833 tctctcctccctcccaccctccctc 92809



to top

>emb|AL603764.27| Human DNA sequence from clone RP11-481L19 on chromosome 10 Contains the
              3' end of the PRSS11 gene for protease serine 11 (IGF
              binding) and the DMBT1 gene for deleted in malignant brain
              tumors 1, complete sequence
          Length = 191741

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 25     ctctcctccctccgaccctccctct 49
              |||||||||||||||||| ||||||
Sbjct: 157377 ctctcctccctccgacccaccctct 157353



to top

>gb|AC107913.7| Homo sapiens chromosome 17, clone CTD-3051C7, complete sequence
          Length = 128953

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 309   cccctcctcctgccggtggcc 329
             |||||||||||||||||||||
Sbjct: 50223 cccctcctcctgccggtggcc 50203



to top

>gb|AC104762.7| Homo sapiens chromosome 17, clone RP11-769H22, complete sequence
          Length = 162678

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 309   cccctcctcctgccggtggcc 329
             |||||||||||||||||||||
Sbjct: 67872 cccctcctcctgccggtggcc 67892



to top

>gb|AC009383.8| Drosophila melanogaster 3L BAC RP98-31C3 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 179283

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 191    caatttcggggcaaatgataaaaag 215
              |||||||||||| ||||||||||||
Sbjct: 114215 caatttcggggcgaatgataaaaag 114191



to top

>dbj|BA000043.1| Geobacillus kaustophilus HTA426 DNA, complete genome
          Length = 3544776

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 244    gctgtagcggcggcgcagctc 264
              |||||||||||||||||||||
Sbjct: 985101 gctgtagcggcggcgcagctc 985081



to top

>gb|AC145691.5| Mus musculus chromosome 1, clone RP24-278B15, complete sequence
          Length = 164151

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 203   aaatgataaaaagtcctgtttcacc 227
             ||||| |||||||||||||||||||
Sbjct: 56053 aaatgttaaaaagtcctgtttcacc 56077



to top

>gb|AE003514.4| Drosophila melanogaster chromosome 3L, section 71 of 83 of the complete
              sequence
          Length = 299903

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 191    caatttcggggcaaatgataaaaag 215
              |||||||||||| ||||||||||||
Sbjct: 157232 caatttcggggcgaatgataaaaag 157208



to top

>emb|AJ305027.1|HSA305027 Homo sapiens partial ALOX12B gene for arachidonate 12R-lipoxygenase,
             exons 3 to 14 and partial ALOX15P pseudogene for
             arachidonate 15-lipoxygenase, exons 11 to 14
          Length = 13652

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 309   cccctcctcctgccggtggcc 329
             |||||||||||||||||||||
Sbjct: 10644 cccctcctcctgccggtggcc 10624



to top

>gb|AC109163.16| Mus musculus chromosome 8, clone RP24-174F12, complete sequence
          Length = 189849

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 376   ggagtgagtgggaagctgttt 396
             |||||||||||||||||||||
Sbjct: 16985 ggagtgagtgggaagctgttt 16965



to top

>gb|AC167185.4| Mus musculus chromosome 3, clone RP23-355G8, complete sequence
          Length = 213731

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 29     cctccctccgaccctccctc 48
              ||||||||||||||||||||
Sbjct: 110527 cctccctccgaccctccctc 110546



to top

>ref|XM_366649.1| Magnaporthe grisea 70-15 chromosome VII hypothetical protein
            (MG02725.4) partial mRNA
          Length = 1320

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 309  cccctcctcctgccggtggccacg 332
            ||||||||||||||||||| ||||
Sbjct: 1142 cccctcctcctgccggtgggcacg 1119



to top

>gb|AC124361.4| Mus musculus BAC clone RP24-528I8 from chromosome 1, complete sequence
          Length = 172848

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 358    ttttcagtttctaccagtgg 377
              ||||||||||||||||||||
Sbjct: 132788 ttttcagtttctaccagtgg 132769



to top

>gb|AC008581.11| Homo sapiens chromosome 5 clone CTC-564N23, complete sequence
          Length = 198564

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 160  caccaatttgggcaaatcat 179
            ||||||||||||||||||||
Sbjct: 4062 caccaatttgggcaaatcat 4081



to top

>gb|AC027342.5| Homo sapiens chromosome 5 clone CTD-2294O13, complete sequence
          Length = 112904

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 160   caccaatttgggcaaatcat 179
             ||||||||||||||||||||
Sbjct: 74405 caccaatttgggcaaatcat 74424



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 25       ctctcctccctccgaccctccctc 48
                ||||||||||||| ||||||||||
Sbjct: 22181595 ctctcctccctcctaccctccctc 22181572



to top

>gb|AF267176.1|AF267176 Pyricularia grisea chromosome 7 clone BAC 6J18, genomic sequence
          Length = 111865

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 309   cccctcctcctgccggtggccacg 332
             ||||||||||||||||||| ||||
Sbjct: 71995 cccctcctcctgccggtgggcacg 71972



to top

>dbj|AP005658.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0620D11
          Length = 140245

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 25    ctctcctccctccgaccctccctc 48
             ||||||||||||| ||||||||||
Sbjct: 98894 ctctcctccctcctaccctccctc 98871



to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 118     gccaaggcgacagcgacggcaagg 141
               ||||| ||||||||||||||||||
Sbjct: 2590892 gccaaagcgacagcgacggcaagg 2590915



to top

>gb|AC166336.15| Mus musculus chromosome 1, clone RP24-74G12, complete sequence
          Length = 215765

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 358    ttttcagtttctaccagtgg 377
              ||||||||||||||||||||
Sbjct: 201978 ttttcagtttctaccagtgg 201959



to top

>gb|AC131699.4| Mus musculus BAC clone RP23-440F17 from 1, complete sequence
          Length = 200544

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 358   ttttcagtttctaccagtgg 377
             ||||||||||||||||||||
Sbjct: 52990 ttttcagtttctaccagtgg 52971



to top

>gb|AC167197.6| Mus musculus chromosome 1, clone RP23-62B14, complete sequence
          Length = 220763

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 358   ttttcagtttctaccagtgg 377
             ||||||||||||||||||||
Sbjct: 35511 ttttcagtttctaccagtgg 35492


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,132,561
Number of Sequences: 3902068
Number of extensions: 3132561
Number of successful extensions: 68070
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 67932
Number of HSP's gapped (non-prelim): 138
length of query: 397
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 375
effective length of database: 17,147,199,772
effective search space: 6430199914500
effective search space used: 6430199914500
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top