>emb|AL138824.19| Human DNA sequence from clone RP11-14H3 on chromosome 6 Contains the 5'
end of an 60S ribosomal protein L7 (RPL7) pseudogene, the
3' end of the CAP2 gene encoding adenylyl
cyclase-associated protein 2, a pseudogene similar to
SMT3H2, the FAM8A1 gene for family with sequence
similarity 8 member A1, the 3'end of the NUP153 gene for
nucleoporin 153kD and CpG islands, complete sequence
Length = 96202
Score = 44.1 bits (22), Expect = 0.52
Identities = 22/22 (100%)
Strand = Plus / Minus
Query: 496 acagcaaaacaagccagaagaa 517
||||||||||||||||||||||
Sbjct: 66181 acagcaaaacaagccagaagaa 66160
>emb|AL138688.27| Human DNA sequence from clone RP11-264J4 on chromosome 13 Contains the 3'
end of the ZNF198 gene for zinc finger protein 198, a novel
gene, the GJA3 gene for gap junction protein, alpha3, 46kD
(connexin 46), a peptidylpropyl isomerase D (cylophilin D)
(PPID) pseudogene, the GJB2 gene for gap junction protein
beta 2, 26 kD (connexin 26) and 6 CpG islands, complete
sequence
Length = 127794
Score = 42.1 bits (21), Expect = 2.1
Identities = 21/21 (100%)
Strand = Plus / Minus
Query: 470 agcacataagaacttggaaga 490
|||||||||||||||||||||
Sbjct: 105929 agcacataagaacttggaaga 105909
>emb|AL160007.10| Human DNA sequence from clone RP4-798P15 on chromosome 1q24.1-25.2
Contains the 3' end of a gene for regucalcin gene promotor
region related protein (RGPR), DKFZp686C2486, complete
sequence
Length = 112732
Score = 40.1 bits (20), Expect = 8.1
Identities = 23/24 (95%)
Strand = Plus / Plus
Query: 351 ccttccttaccattggcagagttt 374
|||||| |||||||||||||||||
Sbjct: 83188 ccttccataccattggcagagttt 83211
>gb|AY885249.1| Danio rerio death effector domain-associated factor (Dedaf) mRNA,
complete cds
Length = 774
Score = 40.1 bits (20), Expect = 8.1
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 456 agaacattgacaggagcaca 475
||||||||||||||||||||
Sbjct: 536 agaacattgacaggagcaca 555
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,090,463
Number of Sequences: 3902068
Number of extensions: 5090463
Number of successful extensions: 87250
Number of sequences better than 10.0: 21
Number of HSP's better than 10.0 without gapping: 21
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 87208
Number of HSP's gapped (non-prelim): 42
length of query: 598
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 575
effective length of database: 17,143,297,704
effective search space: 9857396179800
effective search space used: 9857396179800
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)