ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd2o18
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL672185.7| Zebrafish DNA sequence from clone BUSM1-172P2 in... 44 0.17
2gb|AC125352.4| Mus musculus BAC clone RP23-451M13 from chromosom... 42 0.67
3gb|AC122131.4| Homo sapiens BAC clone RP13-597L20 from 4, comple... 42 0.67
4gb|AC157478.3| Mus musculus BAC clone RP23-33K19 from chromosome... 42 0.67
5gb|AC172891.1| Mus musculus BAC clone RP24-323I12 from chromosom... 42 0.67
6gb|AC026124.35| Homo sapiens 12 BAC RP11-305O6 (Roswell Park Can... 40 2.7

>emb|AL672185.7| Zebrafish DNA sequence from clone BUSM1-172P2 in linkage group 19
             Contains the 3' part of the abcb3l2 gene for  ATP-binding
             cassette, sub-family B (MDR/TAP), member 3 like 2, the 5'
             part of the mhc1uaa gene (major histocompatibility complex
             class I UAA protein) and four CpG islands, complete
             sequence
          Length = 47697

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 50    tcttttaattagattacagnaaata 74
             ||||||||||||||||||| |||||
Sbjct: 41435 tcttttaattagattacagcaaata 41411



to top

>gb|AC125352.4| Mus musculus BAC clone RP23-451M13 from chromosome 8, complete sequence
          Length = 203416

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 150   aaataggtttaaaataatgta 170
             |||||||||||||||||||||
Sbjct: 66948 aaataggtttaaaataatgta 66968



to top

>gb|AC122131.4| Homo sapiens BAC clone RP13-597L20 from 4, complete sequence
          Length = 38020

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 9    ttattgccttagggtccctaa 29
            |||||||||||||||||||||
Sbjct: 2445 ttattgccttagggtccctaa 2465



to top

>gb|AC157478.3| Mus musculus BAC clone RP23-33K19 from chromosome 15, complete sequence
          Length = 229783

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 136    tgctagaaaggggaaaatagg 156
              |||||||||||||||||||||
Sbjct: 204560 tgctagaaaggggaaaatagg 204540



to top

>gb|AC172891.1| Mus musculus BAC clone RP24-323I12 from chromosome 15, complete sequence
          Length = 169101

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 136    tgctagaaaggggaaaatagg 156
              |||||||||||||||||||||
Sbjct: 114530 tgctagaaaggggaaaatagg 114510



to top

>gb|AC026124.35| Homo sapiens 12 BAC RP11-305O6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 181835

 Score = 40.1 bits (20), Expect = 2.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 44     ttcccctcttttaattagat 63
              ||||||||||||||||||||
Sbjct: 164299 ttcccctcttttaattagat 164318


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,795,943
Number of Sequences: 3902068
Number of extensions: 1795943
Number of successful extensions: 123059
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 123048
Number of HSP's gapped (non-prelim): 11
length of query: 210
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 188
effective length of database: 17,147,199,772
effective search space: 3223673557136
effective search space used: 3223673557136
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top