>emb|AL672185.7| Zebrafish DNA sequence from clone BUSM1-172P2 in linkage group 19
Contains the 3' part of the abcb3l2 gene for ATP-binding
cassette, sub-family B (MDR/TAP), member 3 like 2, the 5'
part of the mhc1uaa gene (major histocompatibility complex
class I UAA protein) and four CpG islands, complete
sequence
Length = 47697
Score = 44.1 bits (22), Expect = 0.17
Identities = 24/25 (96%)
Strand = Plus / Minus
Query: 50 tcttttaattagattacagnaaata 74
||||||||||||||||||| |||||
Sbjct: 41435 tcttttaattagattacagcaaata 41411
>gb|AC026124.35| Homo sapiens 12 BAC RP11-305O6 (Roswell Park Cancer Institute Human BAC
Library) complete sequence
Length = 181835
Score = 40.1 bits (20), Expect = 2.7
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 44 ttcccctcttttaattagat 63
||||||||||||||||||||
Sbjct: 164299 ttcccctcttttaattagat 164318
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,795,943
Number of Sequences: 3902068
Number of extensions: 1795943
Number of successful extensions: 123059
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 123048
Number of HSP's gapped (non-prelim): 11
length of query: 210
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 188
effective length of database: 17,147,199,772
effective search space: 3223673557136
effective search space used: 3223673557136
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)