>emb|AL591488.7| Mouse DNA sequence from clone RP23-36P22 on chromosome 2, complete
              sequence
          Length = 191494

 Score = 44.1 bits (22), Expect = 0.15
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 139    atgcttgggtgggtggattcct 160
              ||||||||||||||||||||||
Sbjct: 101346 atgcttgggtgggtggattcct 101367

>gb|AC154215.1| Mus musculus BAC clone RP24-134E18 from 13, complete sequence
          Length = 171014

 Score = 42.1 bits (21), Expect = 0.59
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 127    tcttgtgagattatgcttggg 147
              |||||||||||||||||||||
Sbjct: 114951 tcttgtgagattatgcttggg 114931

>emb|AL831777.5| Mouse DNA sequence from clone RP23-465E7 on chromosome X, complete
             sequence
          Length = 109143

 Score = 42.1 bits (21), Expect = 0.59
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 127   tcttgtgagattatgcttggg 147
             |||||||||||||||||||||
Sbjct: 89305 tcttgtgagattatgcttggg 89285

>ref|XM_524772.1| PREDICTED: Pan troglodytes similar to hypothetical protein MGC45474
            (LOC469387), mRNA
          Length = 5016

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 95   ctggtagcctgggacagagt 114
            ||||||||||||||||||||
Sbjct: 2650 ctggtagcctgggacagagt 2631

>gb|AC104706.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1116_F05,
             complete sequence
          Length = 119573

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 83    ggaggtcactgcctggtagcctgg 106
             ||||| ||||||||||||||||||
Sbjct: 36519 ggaggacactgcctggtagcctgg 36496

>gb|BT011336.1| Drosophila melanogaster SD02170 full insert cDNA
          Length = 3923

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 2   gcttgtgatcctggcctggctgat 25
           |||| |||||||||||||||||||
Sbjct: 725 gcttctgatcctggcctggctgat 702

>ref|XM_502718.1| Yarrowia lipolytica CLIB122, YALI0D11858g predicted mRNA
          Length = 1653

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 21  ctgatcaaggcgcttgacaa 40
           ||||||||||||||||||||
Sbjct: 943 ctgatcaaggcgcttgacaa 962

>gb|AF480881.1| Yarrowia lipolytica integral peroxisomal membrane peroxin (PEX24)
            gene, complete cds
          Length = 2680

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 21   ctgatcaaggcgcttgacaa 40
            ||||||||||||||||||||
Sbjct: 1417 ctgatcaaggcgcttgacaa 1436

>ref|NM_166616.1| Drosophila melanogaster Phosphodiesterase 8 CG5411-RA, transcript
           variant A (Pde8), mRNA
          Length = 4850

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 2   gcttgtgatcctggcctggctgat 25
           |||| |||||||||||||||||||
Sbjct: 752 gcttctgatcctggcctggctgat 729

>ref|NM_137970.3| Drosophila melanogaster Phosphodiesterase 8 CG5411-RE, transcript
           variant E (Pde8), mRNA
          Length = 5390

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 2   gcttgtgatcctggcctggctgat 25
           |||| |||||||||||||||||||
Sbjct: 502 gcttctgatcctggcctggctgat 479

>gb|AC090489.8| Genomic sequence for Mus musculus, clone RP23-104O10, complete sequence
          Length = 207424

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 59     tagaaaaggacggaagcagt 78
              ||||||||||||||||||||
Sbjct: 103736 tagaaaaggacggaagcagt 103717

>gb|AC126687.3| Mus musculus BAC clone RP23-149L23 from chromosome 12, complete
             sequence
          Length = 186742

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                         
Query: 40    attgttgtagagctttatc-tagaaaag 66
             ||||||||||||||||||| ||||||||
Sbjct: 88530 attgttgtagagctttatcgtagaaaag 88503

>gb|AC010842.5|AC010842 Drosophila melanogaster, chromosome 2R, region 59F5-59F8, BAC clone
            BACR02E09, complete sequence
          Length = 175118

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 2    gcttgtgatcctggcctggctgat 25
            |||| |||||||||||||||||||
Sbjct: 9197 gcttctgatcctggcctggctgat 9174

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 83       ggaggtcactgcctggtagcctgg 106
                ||||| ||||||||||||||||||
Sbjct: 15852448 ggaggacactgcctggtagcctgg 15852471

>gb|AC005639.2|AC005639 Drosophila melanogaster, chromosome 2R, region 59E3-59F4, BAC clone
              BACR48M01, complete sequence
          Length = 188272

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 2      gcttgtgatcctggcctggctgat 25
              |||| |||||||||||||||||||
Sbjct: 153255 gcttctgatcctggcctggctgat 153232

>gb|BT021326.1| Drosophila melanogaster RE07805 full insert cDNA
          Length = 5404

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 2   gcttgtgatcctggcctggctgat 25
           |||| |||||||||||||||||||
Sbjct: 502 gcttctgatcctggcctggctgat 479

>gb|AE003461.3| Drosophila melanogaster chromosome 2R, section 69 of 73 of the complete
              sequence
          Length = 598988

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 2      gcttgtgatcctggcctggctgat 25
              |||| |||||||||||||||||||
Sbjct: 186795 gcttctgatcctggcctggctgat 186772

>emb|CR382130.1| Yarrowia lipolytica chromosome D of strain CLIB122 of Yarrowia lipolytica
          Length = 3633272

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 21      ctgatcaaggcgcttgacaa 40
               ||||||||||||||||||||
Sbjct: 1470140 ctgatcaaggcgcttgacaa 1470159

>gb|AC170752.2| Mus musculus BAC clone RP23-116B8 from chromosome 10, complete sequence
          Length = 194054

 Score = 40.1 bits (20), Expect = 2.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 59    tagaaaaggacggaagcagt 78
             ||||||||||||||||||||
Sbjct: 10620 tagaaaaggacggaagcagt 10601

>gb|AC102775.6| Mus musculus chromosome 8, clone RP23-115C10, complete sequence
          Length = 185846

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 118    ttcacttgatcttgtgaga 136
              |||||||||||||||||||
Sbjct: 153594 ttcacttgatcttgtgaga 153576

>gb|AC113123.8| Mus musculus chromosome 8, clone RP23-349O15, complete sequence
          Length = 213829

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 118    ttcacttgatcttgtgaga 136
              |||||||||||||||||||
Sbjct: 131510 ttcacttgatcttgtgaga 131528

>emb|AL772337.17| Human DNA sequence from clone XXyac-21GA2 on chromosome 9 Contains a
             pseudogene similar to part of E74-like factor 2 (ets
             domain transcription factor) (EU32, NERF, NERF-2,
             NERF-1A,NERF-1B) (ELF2), a cathepsin L (MEP, CATL) (CTSL)
             pseudogene, a pseudogene similar to part of a
             fructose-1,6-bisphosphatase protein, two novel genes, a
             novel gene (FLJ35866) and a CpG island, complete sequence
          Length = 95932

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 81    tgggaggtcactgcctggt 99
             |||||||||||||||||||
Sbjct: 68786 tgggaggtcactgcctggt 68804

>emb|AL353788.33| Human DNA sequence from clone RP11-112K13 on chromosome Xq26.1-26.3,
             complete sequence
          Length = 162739

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 107   gacagagttgcttcacttg 125
             |||||||||||||||||||
Sbjct: 66113 gacagagttgcttcacttg 66131

>ref|XM_782268.1| PREDICTED: Strongylocentrotus purpuratus similar to CG7218-PA
            (LOC582312), mRNA
          Length = 3624

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 3    cttgtgatcctggcctggc 21
            |||||||||||||||||||
Sbjct: 3404 cttgtgatcctggcctggc 3422

>gb|AC117511.10| Homo sapiens 12 BAC RP11-545I15 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 68568

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 124   tgatcttgtgagattatgc 142
             |||||||||||||||||||
Sbjct: 22259 tgatcttgtgagattatgc 22277

>gb|AY833550.1| Pisum sativum transposon mariner-like transposon Psmar-1B transposase
            gene, complete cds
          Length = 5572

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 50   agctttatctagaaaagga 68
            |||||||||||||||||||
Sbjct: 4481 agctttatctagaaaagga 4499

>gb|M22509.1|AFARRDB A.xylosoxidans 16S ribosomal RNA, complete cds
          Length = 1466

 Score = 38.2 bits (19), Expect = 9.2
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 159 ctagctgttggggccttca 177
           |||||||||||||||||||
Sbjct: 819 ctagctgttggggccttca 837


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,703,852
Number of Sequences: 3902068
Number of extensions: 1703852
Number of successful extensions: 111743
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 111636
Number of HSP's gapped (non-prelim): 107
length of query: 187
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 165
effective length of database: 17,147,199,772
effective search space: 2829287962380
effective search space used: 2829287962380
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)