>emb|AL805917.3| Human DNA sequence from clone DAQB-10J12 on chromosome 6 Contains the
TIGD1L gene for tigger transposable element derived
1-like, the 5' end of the C6orf214 gene for chromosome 6
open reading frame 214, the 5' end of the DDR1 gene for
discoidin domain receptor family, member 1, and 1 CpG
island, complete sequence
Length = 65373
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 458 tgaggtggcgcacggctgta 477
||||||||||||||||||||
Sbjct: 55087 tgaggtggcgcacggctgta 55068
>emb|AL662870.16| Human DNA sequence from clone XXbac-70P20 on chromosome 6 contains the
DDR1 gene for discoidin domain receptor family, member 1,
a putative novel transcript and two CpG islands, complete
sequence
Length = 61698
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 458 tgaggtggcgcacggctgta 477
||||||||||||||||||||
Sbjct: 28233 tgaggtggcgcacggctgta 28214
>emb|AL662848.6| Human DNA sequence from clone XXbac-111D4 on chromosome 6 contains a
ribosomal protein L7 (RPL7) pseudogene, the gene for
KIAA0170 protein, the TUBB gene for tubulin, beta
polypeptide, the FLOT1 gene for flotillin 1, the IER3 gene
for immediate early response 3 , two putative novel
transcripts and three CpG islands, complete sequence
Length = 185617
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 458 tgaggtggcgcacggctgta 477
||||||||||||||||||||
Sbjct: 182990 tgaggtggcgcacggctgta 182971
>emb|AL121988.10|HSDJ34M23 Human DNA sequence from clone RP1-34M23 on chromosome 1p34.3-36.11
Contains the 3' end of a variant of a novel gene, the GJB5
gene for gap junction protein, beta 5 (connexin 31.1), the
GJB4 gene for gap junction protein, beta 4 (connexin
30.3), the GJB3 gene for gap junction protein, beta 3,
31kDa (connexin 31) and the GJA4 gene for gap junction
protein, alpha 4, 37kDa (connexin 37), complete sequence
Length = 126876
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Minus
Query: 296 ccgggtctctcgcctcctcg 315
||||||||||||||||||||
Sbjct: 93570 ccgggtctctcgcctcctcg 93551
>dbj|AB023050.1| Homo sapiens genomic DNA, chromosome 6p21.3, HLA class I region,
clone:832F2, complete sequence
Length = 112018
Score = 40.1 bits (20), Expect = 7.4
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 458 tgaggtggcgcacggctgta 477
||||||||||||||||||||
Sbjct: 42342 tgaggtggcgcacggctgta 42361
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,270,113
Number of Sequences: 3902068
Number of extensions: 3270113
Number of successful extensions: 55828
Number of sequences better than 10.0: 37
Number of HSP's better than 10.0 without gapping: 37
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 55434
Number of HSP's gapped (non-prelim): 390
length of query: 543
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 520
effective length of database: 17,143,297,704
effective search space: 8914514806080
effective search space used: 8914514806080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)