ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd3b19
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC130604.4| Oryza sativa (japonica cultivar-group) chromosome... 165 2e-37
2dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 165 2e-37
3gb|AC102603.11| Mus musculus chromosome 14, clone RP23-385I17, c... 44 0.56
4gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 44 0.56
5gb|BT010229.1| Drosophila melanogaster RE64695 full insert cDNA 44 0.56
6gb|AC091221.3| Drosophila melanogaster 3L BAC RP98-9I19 (Roswell... 44 0.56
7gb|AC104609.10| Drosophila melanogaster X BAC RP98-39F18 (Roswel... 44 0.56
8gb|AC010037.7| Drosophila melanogaster 3L BAC RP98-6E4 (Roswell ... 44 0.56
9ref|NM_139931.2| Drosophila melanogaster CG8005-RA (CG8005), mRNA 44 0.56
10ref|NM_132224.1| Drosophila melanogaster G5 CG10763-RA (Gbeta5),... 44 0.56
11gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, comple... 44 0.56
12gb|AC084374.21| Homo sapiens 12q BAC RP11-134O3 (Roswell Park Ca... 44 0.56
13gb|BT004841.1| Drosophila melanogaster RH17413 full insert cDNA 44 0.56
14gb|AE003556.3| Drosophila melanogaster chromosome 3L, section 29... 44 0.56
15gb|AE003443.2| Drosophila melanogaster chromosome X, section 27 ... 44 0.56
16gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete... 44 0.56
17gb|AC170600.2| Mus musculus BAC clone RP23-300L16 from chromosom... 44 0.56
18gb|AC167421.2| Mus musculus BAC clone RP23-143K19 from chromosom... 42 2.2
19gb|AC137124.17| Mus musculus chromosome 3, clone RP24-229P11, co... 42 2.2
20gb|AC185523.2| Pan troglodytes chromosome X clone PTB-124O20 map... 42 2.2
21ref|XM_988518.1| PREDICTED: Mus musculus hypothetical protein LO... 42 2.2
22ref|XM_988194.1| PREDICTED: Mus musculus hypothetical protein LO... 42 2.2
23ref|XM_898427.2| PREDICTED: Mus musculus hypothetical LOC624685 ... 42 2.2
24emb|Z82200.1|HS333E23 Human DNA sequence from clone RP3-333E23 o... 42 2.2
25emb|AL731768.3| Human DNA sequence from clone RP13-324D24 on chr... 42 2.2
26emb|AL591409.3| Human DNA sequence from clone RP11-161K18 on chr... 42 2.2
27emb|AL590364.5| Human DNA sequence from clone RP11-342D14 on chr... 42 2.2
28emb|AL445986.14| Human DNA sequence from clone RP11-310F24 on ch... 42 2.2
29emb|AL355587.14| Human DNA sequence from clone RP11-561H23 on ch... 42 2.2
30emb|AL354737.12| Human DNA sequence from clone RP11-569H20 on ch... 42 2.2
31gb|AC124153.2| Homo sapiens chromosome 3 clone RP11-21D1, comple... 42 2.2
32emb|AL022718.1|HS1052M9 Human DNA sequence from clone RP5-1052M9... 42 2.2
33gb|AC087238.25| Homo sapiens 12 BAC RP11-174M10 (Roswell Park Ca... 42 2.2
34gb|AC114978.2| Homo sapiens chromosome 5 clone RP11-512I16, comp... 42 2.2
35gb|AC087315.21| Homo sapiens 12p BAC RP11-626A3 (Roswell Park Ca... 42 2.2
36gb|AC089985.14| Homo sapiens 12q BAC RP11-798P24 (Roswell Park C... 42 2.2
37dbj|AK154950.1| Mus musculus NOD-derived CD11c +ve dendritic cel... 42 2.2
38gb|AC008883.6| Homo sapiens chromosome 5 clone CTD-2215E18, comp... 42 2.2
39gb|AC016555.6| Homo sapiens chromosome 5 clone CTC-358I24, compl... 42 2.2
40gb|AC016612.6| Homo sapiens chromosome 5 clone CTD-2197M16, comp... 42 2.2
41dbj|AK039704.1| Mus musculus adult male spinal cord cDNA, RIKEN ... 42 2.2
42gb|AC008766.4|AC008766 Homo sapiens chromosome 5 clone CTD-2004A... 42 2.2
43gb|AC010105.12| Homo sapiens BAC clone RP11-563E24 from 2, compl... 42 2.2
44emb|AL049829.4|CNS0000B Human chromosome 14 DNA sequence BAC R-1... 42 2.2
45dbj|AP002795.3| Homo sapiens genomic DNA, chromosome 11q, clone:... 42 2.2
46emb|AL352979.4|CNS05TBZ Human chromosome 14 DNA sequence BAC R-3... 42 2.2
47emb|AL772228.5| Mouse DNA sequence from clone RP23-236D1 on chro... 42 2.2
48emb|AL117258.4|CNS01DRI Human chromosome 14 DNA sequence BAC R-2... 42 2.2
49gb|AY234384.1|AY234384S1 Rubrivivax gelatinosus strain S1 5' reg... 40 8.8
50emb|BX601645.15| Zebrafish DNA sequence from clone CH211-207J7 i... 40 8.8
51emb|AL596268.5| Human DNA sequence from clone RP11-504E21 on chr... 40 8.8
52emb|AL359545.12| Human DNA sequence from clone RP13-42E14 on chr... 40 8.8
53emb|AL035700.13|HS75K24 Human DNA sequence from clone RP1-75K24 ... 40 8.8
54emb|AL031885.3|HS510B21 Human DNA sequence from clone RP3-510B21... 40 8.8
55emb|AL939123.1|SCO939123 Streptomyces coelicolor A3(2) complete ... 40 8.8
56emb|CR538741.13| Zebrafish DNA sequence from clone DKEY-97J15 in... 40 8.8
57gb|AC116303.6| Homo sapiens 3 BAC RP11-276B15 (Roswell Park Canc... 40 8.8
58gb|AC117569.3| Homo sapiens chromosome 18, clone RP11-784B15, co... 40 8.8
59gb|AC080006.11| Homo sapiens 3 BAC RP11-789N15 (Roswell Park Can... 40 8.8
60gb|AC025018.6| Homo sapiens chromosome 18, clone RP11-320C19, co... 40 8.8
61gb|AC044810.7| Homo sapiens chromosome 11, clone RP11-494M8, com... 40 8.8
62gb|AC021427.10| Homo sapiens chromosome 11, clone RP11-399N15, c... 40 8.8
63gb|AC016178.9| Homo sapiens chromosome 8, clone RP11-259L23, com... 40 8.8
64gb|AC074349.6| Homo sapiens BAC clone RP11-703G6 from 4, complet... 40 8.8
65gb|AC079232.7| Homo sapiens BAC clone RP11-360H22 from 4, comple... 40 8.8
66gb|AC018709.9| Homo sapiens BAC clone RP11-215A19 from 4, comple... 40 8.8
67dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.8
68gb|AC003029.5| Homo sapiens 12 PAC RP3-462E2 (Roswell Park Cance... 40 8.8
69gb|AC013727.7| Homo sapiens BAC clone RP11-451G1 from 2, complet... 40 8.8
70gb|AC140060.3| Homo sapiens 12 BAC RP11-199A1 (Roswell Park Canc... 40 8.8
71gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome 40 8.8
72emb|BX640512.4| Zebrafish DNA sequence from clone DKEY-58F10 in ... 40 8.8
73dbj|AP005397.2| Oryza sativa (japonica cultivar-group) genomic D... 40 8.8
74gb|AE005127.1| Halobacterium sp. NRC-1 section 158 of 170 of the... 40 8.8
75dbj|AB034704.1| Rubrivivax gelatinosus photosynthetic gene clust... 40 8.8

>gb|AC130604.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07,
              complete sequence
          Length = 146712

 Score =  165 bits (83), Expect = 2e-37
 Identities = 218/263 (82%)
 Strand = Plus / Plus

                                                                          
Query: 381    caaccttctggccaatttccatcgggctcttctaatgtgacatcgtctttggaccttcca 440
              ||||||||||||| |||| |||| ||  | ||||||  | |||||||||||||||| |||
Sbjct: 117691 caaccttctggcccattttcatctggtccgtctaatccggcatcgtctttggacctccca 117750

                                                                          
Query: 441    cctatgccagcaaatccaccacaatcagcacaatcaaaaggataccctatccatcagatg 500
               ||||| |||||||||||| ||||||||||||| | ||||| || ||||||||||| |||
Sbjct: 117751 gctatgtcagcaaatccacaacaatcagcacaagcgaaaggttatcctatccatcaaatg 117810

                                                                          
Query: 501    cattccgcatcagcaccgcagtcatctcagtatccaaatgttaccatgcctcctcatgct 560
              | | || ||||| || | ||| |||| ||| ||| || || |||| | |||||||||| |
Sbjct: 117811 cctcccacatcaacaactcagacatcccagcatcaaagtgctaccctacctcctcatgtt 117870

                                                                          
Query: 561    cctccacagtattcaaatgttccatctcatatgccaacagtgaataatcaaccacagcaa 620
               |  |||||||||||||| ||||||| |||||||||| |||  ||| ||| |||||||||
Sbjct: 117871 tcatcacagtattcaaatattccatcacatatgccaatagttcatagtcagccacagcaa 117930

                                     
Query: 621    ccgttgcaaaatcctggaatgtt 643
              || |||||||||||||| |||||
Sbjct: 117931 cctttgcaaaatcctggtatgtt 117953



 Score =  143 bits (72), Expect = 8e-31
 Identities = 90/96 (93%)
 Strand = Plus / Plus

                                                                          
Query: 43     ccatgacggcgaatcagccggcgggcgaggccctcgcgacccacatctccggcatgtccc 102
              ||||| ||||||| |||||||||||||||||||||||| || ||||||||| ||||||||
Sbjct: 116336 ccatggcggcgaaccagccggcgggcgaggccctcgcggccaacatctccgccatgtccc 116395

                                                  
Query: 103    gcccggagatgcacgacctcatgtcccagatgaagg 138
              ||||||||||| ||||||||||||||||||||||||
Sbjct: 116396 gcccggagatgtacgacctcatgtcccagatgaagg 116431



 Score =  121 bits (61), Expect = 3e-24
 Identities = 73/77 (94%)
 Strand = Plus / Plus

                                                                          
Query: 140    catgatcgaccacgaccaggagagggtgcgccgaatgctcgtcgagaaccccgacgtcac 199
              ||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 116565 catgatcgaccacgaccaggagagggtgcgccggatgctcgtcgacaacccggacgtcac 116624

                               
Query: 200    ccgcgcgctcttccggg 216
              |||||| ||||||||||
Sbjct: 116625 ccgcgctctcttccggg 116641



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  165 bits (83), Expect = 2e-37
 Identities = 218/263 (82%)
 Strand = Plus / Plus

                                                                            
Query: 381      caaccttctggccaatttccatcgggctcttctaatgtgacatcgtctttggaccttcca 440
                ||||||||||||| |||| |||| ||  | ||||||  | |||||||||||||||| |||
Sbjct: 25254850 caaccttctggcccattttcatctggtccgtctaatccggcatcgtctttggacctccca 25254909

                                                                            
Query: 441      cctatgccagcaaatccaccacaatcagcacaatcaaaaggataccctatccatcagatg 500
                 ||||| |||||||||||| ||||||||||||| | ||||| || ||||||||||| |||
Sbjct: 25254910 gctatgtcagcaaatccacaacaatcagcacaagcgaaaggttatcctatccatcaaatg 25254969

                                                                            
Query: 501      cattccgcatcagcaccgcagtcatctcagtatccaaatgttaccatgcctcctcatgct 560
                | | || ||||| || | ||| |||| ||| ||| || || |||| | |||||||||| |
Sbjct: 25254970 cctcccacatcaacaactcagacatcccagcatcaaagtgctaccctacctcctcatgtt 25255029

                                                                            
Query: 561      cctccacagtattcaaatgttccatctcatatgccaacagtgaataatcaaccacagcaa 620
                 |  |||||||||||||| ||||||| |||||||||| |||  ||| ||| |||||||||
Sbjct: 25255030 tcatcacagtattcaaatattccatcacatatgccaatagttcatagtcagccacagcaa 25255089

                                       
Query: 621      ccgttgcaaaatcctggaatgtt 643
                || |||||||||||||| |||||
Sbjct: 25255090 cctttgcaaaatcctggtatgtt 25255112



 Score =  143 bits (72), Expect = 8e-31
 Identities = 90/96 (93%)
 Strand = Plus / Plus

                                                                            
Query: 43       ccatgacggcgaatcagccggcgggcgaggccctcgcgacccacatctccggcatgtccc 102
                ||||| ||||||| |||||||||||||||||||||||| || ||||||||| ||||||||
Sbjct: 25253495 ccatggcggcgaaccagccggcgggcgaggccctcgcggccaacatctccgccatgtccc 25253554

                                                    
Query: 103      gcccggagatgcacgacctcatgtcccagatgaagg 138
                ||||||||||| ||||||||||||||||||||||||
Sbjct: 25253555 gcccggagatgtacgacctcatgtcccagatgaagg 25253590



 Score =  121 bits (61), Expect = 3e-24
 Identities = 73/77 (94%)
 Strand = Plus / Plus

                                                                            
Query: 140      catgatcgaccacgaccaggagagggtgcgccgaatgctcgtcgagaaccccgacgtcac 199
                ||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||||||||
Sbjct: 25253724 catgatcgaccacgaccaggagagggtgcgccggatgctcgtcgacaacccggacgtcac 25253783

                                 
Query: 200      ccgcgcgctcttccggg 216
                |||||| ||||||||||
Sbjct: 25253784 ccgcgctctcttccggg 25253800



to top

>gb|AC102603.11| Mus musculus chromosome 14, clone RP23-385I17, complete sequence
          Length = 204565

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 377    tttgcaaccttctggccaatttccat 402
              |||||||||||||||||| |||||||
Sbjct: 167419 tttgcaaccttctggccagtttccat 167394



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                         
Query: 182     cgagaaccccgacgtcacccgcgcgc 207
               |||||||||||||| |||||||||||
Sbjct: 3212667 cgagaaccccgacgacacccgcgcgc 3212692



to top

>gb|BT010229.1| Drosophila melanogaster RE64695 full insert cDNA
          Length = 1242

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 366 aatcaacagaatttgcaaccttctgg 391
           ||||||||||||| ||||||||||||
Sbjct: 554 aatcaacagaattggcaaccttctgg 579



to top

>gb|AC091221.3| Drosophila melanogaster 3L BAC RP98-9I19 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 185790

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 366   aatcaacagaatttgcaaccttctgg 391
             ||||||||||||| ||||||||||||
Sbjct: 20173 aatcaacagaattggcaaccttctgg 20148



to top

>gb|AC104609.10| Drosophila melanogaster X BAC RP98-39F18 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 165014

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 122   catgtcccagatgaaggccatg 143
             ||||||||||||||||||||||
Sbjct: 41162 catgtcccagatgaaggccatg 41183



to top

>gb|AC010037.7| Drosophila melanogaster 3L BAC RP98-6E4 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 187555

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                       
Query: 366   aatcaacagaatttgcaaccttctgg 391
             ||||||||||||| ||||||||||||
Sbjct: 74778 aatcaacagaattggcaaccttctgg 74753



to top

>ref|NM_139931.2| Drosophila melanogaster CG8005-RA (CG8005), mRNA
          Length = 1225

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 366 aatcaacagaatttgcaaccttctgg 391
           ||||||||||||| ||||||||||||
Sbjct: 554 aatcaacagaattggcaaccttctgg 579



to top

>ref|NM_132224.1| Drosophila melanogaster G5 CG10763-RA (Gbeta5), mRNA
          Length = 1561

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 122 catgtcccagatgaaggccatg 143
           ||||||||||||||||||||||
Sbjct: 828 catgtcccagatgaaggccatg 807



to top

>gb|CP000248.1| Novosphingobium aromaticivorans DSM 12444, complete genome
          Length = 3561584

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 140     catgatcgaccacgaccaggag 161
               ||||||||||||||||||||||
Sbjct: 1697918 catgatcgaccacgaccaggag 1697897



to top

>gb|AC084374.21| Homo sapiens 12q BAC RP11-134O3 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 122602

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 589    atatgccaacagtgaataatca 610
              ||||||||||||||||||||||
Sbjct: 120086 atatgccaacagtgaataatca 120107



to top

>gb|BT004841.1| Drosophila melanogaster RH17413 full insert cDNA
          Length = 1564

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 122 catgtcccagatgaaggccatg 143
           ||||||||||||||||||||||
Sbjct: 829 catgtcccagatgaaggccatg 808



to top

>gb|AE003556.3| Drosophila melanogaster chromosome 3L, section 29 of 83 of the complete
              sequence
          Length = 281917

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 366    aatcaacagaatttgcaaccttctgg 391
              ||||||||||||| ||||||||||||
Sbjct: 147289 aatcaacagaattggcaaccttctgg 147314



to top

>gb|AE003443.2| Drosophila melanogaster chromosome X, section 27 of 74 of the complete
             sequence
          Length = 299153

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 122   catgtcccagatgaaggccatg 143
             ||||||||||||||||||||||
Sbjct: 35267 catgtcccagatgaaggccatg 35288



to top

>gb|AE000513.1| Deinococcus radiodurans R1 chromosome 1, complete sequence
          Length = 2648638

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                     
Query: 175     tgctcgtcgagaaccccgacgt 196
               ||||||||||||||||||||||
Sbjct: 1662314 tgctcgtcgagaaccccgacgt 1662335



to top

>gb|AC170600.2| Mus musculus BAC clone RP23-300L16 from chromosome 14, complete sequence
          Length = 216861

 Score = 44.1 bits (22), Expect = 0.56
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 377    tttgcaaccttctggccaatttccat 402
              |||||||||||||||||| |||||||
Sbjct: 208563 tttgcaaccttctggccagtttccat 208588



to top

>gb|AC167421.2| Mus musculus BAC clone RP23-143K19 from chromosome 3, complete sequence
          Length = 194311

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 314   taaagctacaacacaagatca 334
             |||||||||||||||||||||
Sbjct: 10929 taaagctacaacacaagatca 10909



to top

>gb|AC137124.17| Mus musculus chromosome 3, clone RP24-229P11, complete sequence
          Length = 172081

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 314   taaagctacaacacaagatca 334
             |||||||||||||||||||||
Sbjct: 54114 taaagctacaacacaagatca 54134



to top

>gb|AC185523.2| Pan troglodytes chromosome X clone PTB-124O20 map human ortholog p11.3,
              complete sequence
          Length = 209530

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 589    atatgccaacagtgaataatc 609
              |||||||||||||||||||||
Sbjct: 175888 atatgccaacagtgaataatc 175908



to top

>ref|XM_988518.1| PREDICTED: Mus musculus hypothetical protein LOC671688 (LOC671688),
           mRNA
          Length = 896

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 16  ccggccgctcccctgctcccgcgcg 40
           |||||||||||||| ||||||||||
Sbjct: 286 ccggccgctcccctcctcccgcgcg 310



to top

>ref|XM_988194.1| PREDICTED: Mus musculus hypothetical protein LOC676214 (LOC676214),
           mRNA
          Length = 1073

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 16  ccggccgctcccctgctcccgcgcg 40
           |||||||||||||| ||||||||||
Sbjct: 463 ccggccgctcccctcctcccgcgcg 487



to top

>ref|XM_898427.2| PREDICTED: Mus musculus hypothetical LOC624685 (LOC624685), mRNA
          Length = 4789

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                     
Query: 16   ccggccgctcccctgctcccgcgcg 40
            |||||||||||||| ||||||||||
Sbjct: 3313 ccggccgctcccctcctcccgcgcg 3337



to top

>emb|Z82200.1|HS333E23 Human DNA sequence from clone RP3-333E23 on chromosome Xq21.1 Contains
              the P2RY10 gene for purinergic receptor P2Y G-protein
              coupled 10, complete sequence
          Length = 128011

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 589    atatgccaacagtgaataatc 609
              |||||||||||||||||||||
Sbjct: 113766 atatgccaacagtgaataatc 113746



to top

>emb|AL731768.3| Human DNA sequence from clone RP13-324D24 on chromosome X, complete
             sequence
          Length = 68444

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 589   atatgccaacagtgaataatc 609
             |||||||||||||||||||||
Sbjct: 42089 atatgccaacagtgaataatc 42069



to top

>emb|AL591409.3| Human DNA sequence from clone RP11-161K18 on chromosome X, complete
             sequence
          Length = 133516

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 589   atatgccaacagtgaataatc 609
             |||||||||||||||||||||
Sbjct: 45406 atatgccaacagtgaataatc 45426



to top

>emb|AL590364.5| Human DNA sequence from clone RP11-342D14 on chromosome X Contains the
             3' end of a novel gene, complete sequence
          Length = 65644

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 589   atatgccaacagtgaataatc 609
             |||||||||||||||||||||
Sbjct: 25972 atatgccaacagtgaataatc 25992



to top

>emb|AL445986.14| Human DNA sequence from clone RP11-310F24 on chromosome 9 Contains a CpG
              island, complete sequence
          Length = 120873

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 589    atatgccaacagtgaataatc 609
              |||||||||||||||||||||
Sbjct: 114908 atatgccaacagtgaataatc 114928



to top

>emb|AL355587.14| Human DNA sequence from clone RP11-561H23 on chromosome 10 Contains the
             3' end of a novel gene (KIAA1136) (FLJ37801) and a CpG
             island, complete sequence
          Length = 130039

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 589   atatgccaacagtgaataatc 609
             |||||||||||||||||||||
Sbjct: 98409 atatgccaacagtgaataatc 98389



to top

>emb|AL354737.12| Human DNA sequence from clone RP11-569H20 on chromosome X, complete
             sequence
          Length = 172991

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 589   atatgccaacagtgaataatc 609
             |||||||||||||||||||||
Sbjct: 30253 atatgccaacagtgaataatc 30273



to top

>gb|AC124153.2| Homo sapiens chromosome 3 clone RP11-21D1, complete sequence
          Length = 165693

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 589    atatgccaacagtgaataatc 609
              |||||||||||||||||||||
Sbjct: 112390 atatgccaacagtgaataatc 112370



to top

>emb|AL022718.1|HS1052M9 Human DNA sequence from clone RP5-1052M9 on chromosome Xq25 Contains a
             testis expressed sequence 13 (TEX13) pseudogene, the
             SH2D1A gene for Duncan's disease (lymphoproliferative
             syndrome) SH2 domain protein 1A and the 3' end of the ODZ1
             gene for odz odd Oz/ten-m homolog 1 (Drosophila), complete
             sequence
          Length = 134245

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 589   atatgccaacagtgaataatc 609
             |||||||||||||||||||||
Sbjct: 10508 atatgccaacagtgaataatc 10528



to top

>gb|AC087238.25| Homo sapiens 12 BAC RP11-174M10 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 175998

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 589   atatgccaacagtgaataatc 609
             |||||||||||||||||||||
Sbjct: 99458 atatgccaacagtgaataatc 99438



to top

>gb|AC114978.2| Homo sapiens chromosome 5 clone RP11-512I16, complete sequence
          Length = 40890

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 589   atatgccaacagtgaataatc 609
             |||||||||||||||||||||
Sbjct: 39216 atatgccaacagtgaataatc 39196



to top

>gb|AC087315.21| Homo sapiens 12p BAC RP11-626A3 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 154443

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 589   atatgccaacagtgaataatc 609
             |||||||||||||||||||||
Sbjct: 49009 atatgccaacagtgaataatc 49029



to top

>gb|AC089985.14| Homo sapiens 12q BAC RP11-798P24 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 146779

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 589   atatgccaacagtgaataatc 609
             |||||||||||||||||||||
Sbjct: 97645 atatgccaacagtgaataatc 97665



to top

>dbj|AK154950.1| Mus musculus NOD-derived CD11c +ve dendritic cells cDNA, RIKEN
           full-length enriched library, clone:F630112K10
           product:hypothetical protein, full insert sequence
          Length = 3719

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 16  ccggccgctcccctgctcccgcgcg 40
           |||||||||||||| ||||||||||
Sbjct: 450 ccggccgctcccctcctcccgcgcg 426



to top

>gb|AC008883.6| Homo sapiens chromosome 5 clone CTD-2215E18, complete sequence
          Length = 127144

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 589   atatgccaacagtgaataatc 609
             |||||||||||||||||||||
Sbjct: 99222 atatgccaacagtgaataatc 99242



to top

>gb|AC016555.6| Homo sapiens chromosome 5 clone CTC-358I24, complete sequence
          Length = 154848

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 589  atatgccaacagtgaataatc 609
            |||||||||||||||||||||
Sbjct: 4500 atatgccaacagtgaataatc 4480



to top

>gb|AC016612.6| Homo sapiens chromosome 5 clone CTD-2197M16, complete sequence
          Length = 179513

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 589   atatgccaacagtgaataatc 609
             |||||||||||||||||||||
Sbjct: 39384 atatgccaacagtgaataatc 39364



to top

>dbj|AK039704.1| Mus musculus adult male spinal cord cDNA, RIKEN full-length
           enriched library, clone:A330091H04
           product:unclassifiable, full insert sequence
          Length = 1933

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 16  ccggccgctcccctgctcccgcgcg 40
           |||||||||||||| ||||||||||
Sbjct: 457 ccggccgctcccctcctcccgcgcg 481



to top

>gb|AC008766.4|AC008766 Homo sapiens chromosome 5 clone CTD-2004A9, complete sequence
          Length = 147530

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 589   atatgccaacagtgaataatc 609
             |||||||||||||||||||||
Sbjct: 94795 atatgccaacagtgaataatc 94775



to top

>gb|AC010105.12| Homo sapiens BAC clone RP11-563E24 from 2, complete sequence
          Length = 193320

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 589    atatgccaacagtgaataatc 609
              |||||||||||||||||||||
Sbjct: 112031 atatgccaacagtgaataatc 112051



to top

>emb|AL049829.4|CNS0000B Human chromosome 14 DNA sequence BAC R-124D2 of library RPCI-11 from
            chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 196292

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 589  atatgccaacagtgaataatc 609
            |||||||||||||||||||||
Sbjct: 5993 atatgccaacagtgaataatc 6013



to top

>dbj|AP002795.3| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-715G18, complete
              sequence
          Length = 165240

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 589    atatgccaacagtgaataatc 609
              |||||||||||||||||||||
Sbjct: 136024 atatgccaacagtgaataatc 136004



to top

>emb|AL352979.4|CNS05TBZ Human chromosome 14 DNA sequence BAC R-368P15 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 155692

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 589    atatgccaacagtgaataatc 609
              |||||||||||||||||||||
Sbjct: 104031 atatgccaacagtgaataatc 104051



to top

>emb|AL772228.5| Mouse DNA sequence from clone RP23-236D1 on chromosome 4, complete
             sequence
          Length = 167555

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 16    ccggccgctcccctgctcccgcgcg 40
             |||||||||||||| ||||||||||
Sbjct: 75213 ccggccgctcccctcctcccgcgcg 75189



to top

>emb|AL117258.4|CNS01DRI Human chromosome 14 DNA sequence BAC R-244E17 of library RPCI-11 from
             chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 157827

 Score = 42.1 bits (21), Expect = 2.2
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 589   atatgccaacagtgaataatc 609
             |||||||||||||||||||||
Sbjct: 21153 atatgccaacagtgaataatc 21133



to top

>gb|AY234384.1|AY234384S1 Rubrivivax gelatinosus strain S1 5' region photosynthesis gene cluster,
             partial sequence
          Length = 24637

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 179   cgtcgagaaccccgacgtca 198
             ||||||||||||||||||||
Sbjct: 17819 cgtcgagaaccccgacgtca 17800



to top

>emb|BX601645.15| Zebrafish DNA sequence from clone CH211-207J7 in linkage group 6,
              complete sequence
          Length = 223513

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 460    cacaatcagcacaatcaaaa 479
              ||||||||||||||||||||
Sbjct: 134926 cacaatcagcacaatcaaaa 134945



to top

>emb|AL596268.5| Human DNA sequence from clone RP11-504E21 on chromosome X Contains a
             MAGE family pseudogene, complete sequence
          Length = 113335

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 589   atatgccaacagtgaataat 608
             ||||||||||||||||||||
Sbjct: 84748 atatgccaacagtgaataat 84729



to top

>emb|AL359545.12| Human DNA sequence from clone RP13-42E14 on chromosome Xq13.1-13.3
             Contains the 3' end of the ABCB7 gene for ATP-binding
             cassette sub-family B (MDR/TAP) member 7, complete
             sequence
          Length = 127243

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 590   tatgccaacagtgaataatc 609
             ||||||||||||||||||||
Sbjct: 64878 tatgccaacagtgaataatc 64859



to top

>emb|AL035700.13|HS75K24 Human DNA sequence from clone RP1-75K24 on chromosome 6q13-15, complete
             sequence
          Length = 80279

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 568   agtattcaaatgttccatct 587
             ||||||||||||||||||||
Sbjct: 61642 agtattcaaatgttccatct 61623



to top

>emb|AL031885.3|HS510B21 Human DNA sequence from clone RP3-510B21 on chromosome 6p11.2-12.3
              Contains a pseudogene similar to CLNS1B (chloride channel,
              nucleotide-sensitive, 1B), complete sequence
          Length = 108994

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 589    atatgccaacagtgaataat 608
              ||||||||||||||||||||
Sbjct: 104404 atatgccaacagtgaataat 104423



to top

>emb|AL939123.1|SCO939123 Streptomyces coelicolor A3(2) complete genome; segment 20/29
          Length = 300100

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 17     cggccgctcccctgctcccgcgcgcgcc 44
              |||||| |||||||||||||| ||||||
Sbjct: 102047 cggccgttcccctgctcccgcccgcgcc 102020



to top

>emb|CR538741.13| Zebrafish DNA sequence from clone DKEY-97J15 in linkage group 5,
             complete sequence
          Length = 122930

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 278   gtcagcagttgctcagataactcc 301
             ||||||||||| ||||||||||||
Sbjct: 93983 gtcagcagttgttcagataactcc 93960



to top

>gb|AC116303.6| Homo sapiens 3 BAC RP11-276B15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 51070

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 589   atatgccaacagtgaataat 608
             ||||||||||||||||||||
Sbjct: 20304 atatgccaacagtgaataat 20285



to top

>gb|AC117569.3| Homo sapiens chromosome 18, clone RP11-784B15, complete sequence
          Length = 176898

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 589    atatgccaacagtgaataat 608
              ||||||||||||||||||||
Sbjct: 117838 atatgccaacagtgaataat 117857



to top

>gb|AC080006.11| Homo sapiens 3 BAC RP11-789N15 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 110483

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 590   tatgccaacagtgaataatc 609
             ||||||||||||||||||||
Sbjct: 24838 tatgccaacagtgaataatc 24857



to top

>gb|AC025018.6| Homo sapiens chromosome 18, clone RP11-320C19, complete sequence
          Length = 159942

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 589   atatgccaacagtgaataat 608
             ||||||||||||||||||||
Sbjct: 18731 atatgccaacagtgaataat 18750



to top

>gb|AC044810.7| Homo sapiens chromosome 11, clone RP11-494M8, complete sequence
          Length = 194297

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 589   atatgccaacagtgaataat 608
             ||||||||||||||||||||
Sbjct: 38769 atatgccaacagtgaataat 38788



to top

>gb|AC021427.10| Homo sapiens chromosome 11, clone RP11-399N15, complete sequence
          Length = 174147

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 589    atatgccaacagtgaataat 608
              ||||||||||||||||||||
Sbjct: 100821 atatgccaacagtgaataat 100840



to top

>gb|AC016178.9| Homo sapiens chromosome 8, clone RP11-259L23, complete sequence
          Length = 171035

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 587   tcatatgccaacagtgaata 606
             ||||||||||||||||||||
Sbjct: 30239 tcatatgccaacagtgaata 30258



to top

>gb|AC074349.6| Homo sapiens BAC clone RP11-703G6 from 4, complete sequence
          Length = 176467

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 589   atatgccaacagtgaataat 608
             ||||||||||||||||||||
Sbjct: 74116 atatgccaacagtgaataat 74135



to top

>gb|AC079232.7| Homo sapiens BAC clone RP11-360H22 from 4, complete sequence
          Length = 169281

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 589    atatgccaacagtgaataat 608
              ||||||||||||||||||||
Sbjct: 161313 atatgccaacagtgaataat 161332



to top

>gb|AC018709.9| Homo sapiens BAC clone RP11-215A19 from 4, complete sequence
          Length = 161013

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 589   atatgccaacagtgaataat 608
             ||||||||||||||||||||
Sbjct: 97354 atatgccaacagtgaataat 97373



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 521      gtcatctcagtatccaaatg 540
                ||||||||||||||||||||
Sbjct: 14631198 gtcatctcagtatccaaatg 14631179



to top

>gb|AC003029.5| Homo sapiens 12 PAC RP3-462E2 (Roswell Park Cancer institute Human PAC
             Library) complete sequence
          Length = 137830

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 343   tgcctcagcctcacttgcctacca 366
             |||||| |||||||||||||||||
Sbjct: 69712 tgcctcggcctcacttgcctacca 69689



to top

>gb|AC013727.7| Homo sapiens BAC clone RP11-451G1 from 2, complete sequence
          Length = 167519

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 590    tatgccaacagtgaataatc 609
              ||||||||||||||||||||
Sbjct: 105697 tatgccaacagtgaataatc 105678



to top

>gb|AC140060.3| Homo sapiens 12 BAC RP11-199A1 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 51708

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 286   ttgctcagataactccttct 305
             ||||||||||||||||||||
Sbjct: 35811 ttgctcagataactccttct 35792



to top

>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome
          Length = 5013479

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 35      cgcgcgcgccatgacggcga 54
               ||||||||||||||||||||
Sbjct: 3417007 cgcgcgcgccatgacggcga 3416988



to top

>emb|BX640512.4| Zebrafish DNA sequence from clone DKEY-58F10 in linkage group 5,
             complete sequence
          Length = 191256

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 278   gtcagcagttgctcagataactcc 301
             ||||||||||| ||||||||||||
Sbjct: 34584 gtcagcagttgttcagataactcc 34607



to top

>dbj|AP005397.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0643D11
          Length = 137525

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 521   gtcatctcagtatccaaatg 540
             ||||||||||||||||||||
Sbjct: 52865 gtcatctcagtatccaaatg 52846



to top

>gb|AE005127.1| Halobacterium sp. NRC-1 section 158 of 170 of the complete genome
          Length = 10420

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 89   ctccggcatgtcccgcccggagatgcacgacc 120
            ||||||||| | |||||||||||||| |||||
Sbjct: 7352 ctccggcatcttccgcccggagatgctcgacc 7383



to top

>dbj|AB034704.1| Rubrivivax gelatinosus photosynthetic gene cluster, complete cds,
             stain:IL144
          Length = 58996

 Score = 40.1 bits (20), Expect = 8.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 179   cgtcgagaaccccgacgtca 198
             ||||||||||||||||||||
Sbjct: 27173 cgtcgagaaccccgacgtca 27154


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,425,317
Number of Sequences: 3902068
Number of extensions: 5425317
Number of successful extensions: 121119
Number of sequences better than 10.0: 75
Number of HSP's better than 10.0 without gapping: 75
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 120640
Number of HSP's gapped (non-prelim): 479
length of query: 643
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 620
effective length of database: 17,143,297,704
effective search space: 10628844576480
effective search space used: 10628844576480
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top