ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | basd3a09 |
|---|---|
| Clone Library Name | barley_pub |
>dbj|AB219969.1| Triticum aestivum WAP2 mRNA for aspartic proteinase, complete cds Length = 1560 Score = 922 bits (465), Expect = 0.0 Identities = 544/569 (95%), Gaps = 1/569 (0%) Strand = Plus / Plus Query: 20 gtgatattcgacaccgggnagctccaacctgtgggttccctcgtcgaaatgctatttctc 79 |||||||| ||||||||| ||||||||||| |||||||||||| ||||||||||||| || Sbjct: 302 gtgatatttgacaccggg-agctccaacctctgggttccctcggcgaaatgctatttttc 360 Query: 80 gatagcatgctacctccaccccaaatacaggtcgagcaggtcaaccacttacaaagcaga 139 |||||||||||||||||| |||||||||| |||||||| ||||| ||||||||||||||| Sbjct: 361 gatagcatgctacctccatcccaaatacaagtcgagcaagtcaagcacttacaaagcaga 420 Query: 140 tggtgagaattgcaaaatcacatatggttctggagcaatctctggatttttcagcaatga 199 |||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| Sbjct: 421 tggtgagacttgcaaaattacatatggttctggagcaatctctggatttttcagcaatga 480 Query: 200 taatgtgttggttggggaccttgttgtgaaaaatcagaaattcattgaggcaacacgtga 259 ||||||||||||||||||||||||||||||||||||||||||||| | | |||||||||| Sbjct: 481 taatgtgttggttggggaccttgttgtgaaaaatcagaaattcatcgggacaacacgtga 540 Query: 260 aacaagtgtcagttttatcctcgggaagtttgatggcatccttggccttggctaccctga 319 ||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 541 aacaagtgttagttttatcgtcgggaagtttgatggcatccttggccttggctaccctga 600 Query: 320 catctccgttgggaaagcccctccagtatggctgagcatgcaagagcagaagttgctcgc 379 |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 601 catctccgttggaaaagcccctccagtatggctgagcatgcaagagcagaagttgctcgc 660 Query: 380 tgacgacgtattctcattttggcttaaccgggattctgatgcactttctggtggtgagct 439 ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Sbjct: 661 tgacgacgtattctcattttggcttaaccgggattctgatgcactttctggcggtgagct 720 Query: 440 cgtcttcggtggcatggacccacatcactataagggaaaccacacctatgtccccgtgag 499 |||||||||||||||||||| ||||||||||||||||||||||||||||||| ||||| Sbjct: 721 tgtcttcggtggcatggacccggatcactataagggaaaccacacctatgtccctgtgag 780 Query: 500 ccgcaaaggttactggcagtttaacatgggtgatctcttgattgatggccactctactgg 559 ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 781 ccgcagaggttactggcagtttaacatgggtgatctcttgattgatggccactctactgg 840 Query: 560 tttctgtgccaaaggctgtgctgctattg 588 |||||||| ||||||||||||||||||| Sbjct: 841 cttctgtgcaaaaggctgtgctgctattg 869
>ref|XM_475576.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1491 Score = 414 bits (209), Expect = e-112 Identities = 482/572 (84%), Gaps = 1/572 (0%) Strand = Plus / Plus Query: 17 acggtgatattcgacaccgggnagctccaacctgtgggttccctcgtcgaaatgctattt 76 ||||||||||| ||||| || |||||||||||||||||||| || | ||||||||||| Sbjct: 271 acggtgatatttgacactgg-aagctccaacctgtgggttccttcagcaaaatgctattt 329 Query: 77 ctcgatagcatgctacctccaccccaaatacaggtcgagcaggtcaaccacttacaaagc 136 ||||||||||||||||||||| || ||||| |||| | ||| | | |||||||||| Sbjct: 330 ttcgatagcatgctacctccacagcagatacaactcgaaaaagtcgagctcttacaaagc 389 Query: 137 agatggtgagaattgcaaaatcacatatggttctggagcaatctctggatttttcagcaa 196 |||||| || | ||||||||| ||||| |||||||| ||||| |||||||| ||||| || Sbjct: 390 agatggagaaacttgcaaaattacatacggttctggggcaatttctggattcttcagtaa 449 Query: 197 tgataatgtgttggttggggaccttgttgtgaaaaatcagaaattcattgaggcaacacg 256 ||||||||||||||||| |||||||| |||||||| ||||| ||||||||||||||||| Sbjct: 450 ggataatgtgttggttggagaccttgtagtgaaaaaccagaagttcattgaggcaacacg 509 Query: 257 tgaaacaagtgtcagttttatcctcgggaagtttgatggcatccttggccttggctaccc 316 |||||||| || | |||||| |||| ||||||||||| || ||||| ||||||||||| Sbjct: 510 cgaaacaagcgttacctttatcatcggaaagtttgatggaattcttggtcttggctaccc 569 Query: 317 tgacatctccgttgggaaagcccctccagtatggctgagcatgcaagagcagaagttgct 376 ||| ||||| ||||||||||| ||||| | |||| ||||||||| |||||| | |||| Sbjct: 570 tgaaatctctgttgggaaagctcctccgatttggcagagcatgcaggagcaggaactgct 629 Query: 377 cgctgacgacgtattctcattttggcttaaccgggattctgatgcactttctggtggtga 436 || || || || ||||| |||||||| ||||| || | |||||| ||||||||||| Sbjct: 630 tgcagatgatgtcttctcgttttggctgaaccgagacccggatgcatcctctggtggtga 689 Query: 437 gctcgtcttcggtggcatggacccacatcactataagggaaaccacacctatgtccccgt 496 ||||||||| ||||||||||| || | || |||||||| | |||||||| ||||| || Sbjct: 690 gctcgtctttggtggcatggatccgaagcattataagggggatcacacctacgtccctgt 749 Query: 497 gagccgcaaaggttactggcagtttaacatgggtgatctcttgattgatggccactctac 556 ||||||||| |||||||||||||||||||| |||||| | |||||||||||||| || Sbjct: 750 ttcccgcaaaggctactggcagtttaacatgggggatctccttattgatggccactcaac 809 Query: 557 tggtttctgtgccaaaggctgtgctgctattg 588 ||| |||||||| ||||||||||||||||||| Sbjct: 810 tggcttctgtgcaaaaggctgtgctgctattg 841
>dbj|AK065206.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002F13, full insert sequence Length = 1900 Score = 414 bits (209), Expect = e-112 Identities = 482/572 (84%), Gaps = 1/572 (0%) Strand = Plus / Plus Query: 17 acggtgatattcgacaccgggnagctccaacctgtgggttccctcgtcgaaatgctattt 76 ||||||||||| ||||| || |||||||||||||||||||| || | ||||||||||| Sbjct: 423 acggtgatatttgacactgg-aagctccaacctgtgggttccttcagcaaaatgctattt 481 Query: 77 ctcgatagcatgctacctccaccccaaatacaggtcgagcaggtcaaccacttacaaagc 136 ||||||||||||||||||||| || ||||| |||| | ||| | | |||||||||| Sbjct: 482 ttcgatagcatgctacctccacagcagatacaactcgaaaaagtcgagctcttacaaagc 541 Query: 137 agatggtgagaattgcaaaatcacatatggttctggagcaatctctggatttttcagcaa 196 |||||| || | ||||||||| ||||| |||||||| ||||| |||||||| ||||| || Sbjct: 542 agatggagaaacttgcaaaattacatacggttctggggcaatttctggattcttcagtaa 601 Query: 197 tgataatgtgttggttggggaccttgttgtgaaaaatcagaaattcattgaggcaacacg 256 ||||||||||||||||| |||||||| |||||||| ||||| ||||||||||||||||| Sbjct: 602 ggataatgtgttggttggagaccttgtagtgaaaaaccagaagttcattgaggcaacacg 661 Query: 257 tgaaacaagtgtcagttttatcctcgggaagtttgatggcatccttggccttggctaccc 316 |||||||| || | |||||| |||| ||||||||||| || ||||| ||||||||||| Sbjct: 662 cgaaacaagcgttacctttatcatcggaaagtttgatggaattcttggtcttggctaccc 721 Query: 317 tgacatctccgttgggaaagcccctccagtatggctgagcatgcaagagcagaagttgct 376 ||| ||||| ||||||||||| ||||| | |||| ||||||||| |||||| | |||| Sbjct: 722 tgaaatctctgttgggaaagctcctccgatttggcagagcatgcaggagcaggaactgct 781 Query: 377 cgctgacgacgtattctcattttggcttaaccgggattctgatgcactttctggtggtga 436 || || || || ||||| |||||||| ||||| || | |||||| ||||||||||| Sbjct: 782 tgcagatgatgtcttctcgttttggctgaaccgagacccggatgcatcctctggtggtga 841 Query: 437 gctcgtcttcggtggcatggacccacatcactataagggaaaccacacctatgtccccgt 496 ||||||||| ||||||||||| || | || |||||||| | |||||||| ||||| || Sbjct: 842 gctcgtctttggtggcatggatccgaagcattataagggggatcacacctacgtccctgt 901 Query: 497 gagccgcaaaggttactggcagtttaacatgggtgatctcttgattgatggccactctac 556 ||||||||| |||||||||||||||||||| |||||| | |||||||||||||| || Sbjct: 902 ttcccgcaaaggctactggcagtttaacatgggggatctccttattgatggccactcaac 961 Query: 557 tggtttctgtgccaaaggctgtgctgctattg 588 ||| |||||||| ||||||||||||||||||| Sbjct: 962 tggcttctgtgcaaaaggctgtgctgctattg 993
>dbj|D12777.1|RICASPPRO Oryza sativa (japonica cultivar-group) mRNA for aspartic proteinase, complete cds Length = 1774 Score = 398 bits (201), Expect = e-108 Identities = 480/572 (83%), Gaps = 1/572 (0%) Strand = Plus / Plus Query: 17 acggtgatattcgacaccgggnagctccaacctgtgggttccctcgtcgaaatgctattt 76 ||||||||||| ||||| || |||||||||||||||||||| || | ||||||||||| Sbjct: 352 acggtgatatttgacactgg-aagctccaacctgtgggttccttcagcaaaatgctattt 410 Query: 77 ctcgatagcatgctacctccaccccaaatacaggtcgagcaggtcaaccacttacaaagc 136 ||||||||||||||||||||| || ||||| |||| | ||| | | |||||||||| Sbjct: 411 ttcgatagcatgctacctccacagcagatacaactcgaaaaagtcgagctcttacaaagc 470 Query: 137 agatggtgagaattgcaaaatcacatatggttctggagcaatctctggatttttcagcaa 196 |||||| || | ||||||||| ||||| |||||||| ||||| |||||||| ||||| || Sbjct: 471 agatggagaaacttgcaaaattacatacggttctggggcaatttctggattcttcagtaa 530 Query: 197 tgataatgtgttggttggggaccttgttgtgaaaaatcagaaattcattgaggcaacacg 256 ||||||||||||||||| |||| || |||||||| ||||| ||||||||||||||||| Sbjct: 531 ggataatgtgttggttggagaccaagtagtgaaaaaccagaagttcattgaggcaacacg 590 Query: 257 tgaaacaagtgtcagttttatcctcgggaagtttgatggcatccttggccttggctaccc 316 |||||||| || | |||||| |||| ||||||||||| || ||||| ||||||||||| Sbjct: 591 cgaaacaagcgttacctttatcatcggaaagtttgatggaattcttggtcttggctaccc 650 Query: 317 tgacatctccgttgggaaagcccctccagtatggctgagcatgcaagagcagaagttgct 376 ||| ||||| ||||||||||| ||||| | |||| ||||||||| |||||| | |||| Sbjct: 651 tgaaatctctgttgggaaagctcctccgatttggcagagcatgcaggagcaggaactgct 710 Query: 377 cgctgacgacgtattctcattttggcttaaccgggattctgatgcactttctggtggtga 436 || || || || ||||| |||||||| ||||| || | |||||| ||||||||||| Sbjct: 711 tgcagatgatgtcttctcgttttggctgaaccgagacccggatgcatcctctggtggtga 770 Query: 437 gctcgtcttcggtggcatggacccacatcactataagggaaaccacacctatgtccccgt 496 ||||||||| ||||||||||| || | || |||||||| | |||||||| ||||| || Sbjct: 771 gctcgtctttggtggcatggatccgaagcattataagggggatcacacctacgtccctgt 830 Query: 497 gagccgcaaaggttactggcagtttaacatgggtgatctcttgattgatggccactctac 556 ||||||||| |||||||||||||||||||| |||||| | |||||||||||||| || Sbjct: 831 ttcccgcaaaggctactggcagtttaacatgggggatctccttattgatggccactcaac 890 Query: 557 tggtttctgtgccaaaggctgtgctgctattg 588 ||| |||||||| ||||||||||||||||||| Sbjct: 891 tggcttctgtgcaaaaggctgtgctgctattg 922
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 159 bits (80), Expect = 1e-35 Identities = 197/236 (83%) Strand = Plus / Plus Query: 353 gagcatgcaagagcagaagttgctcgctgacgacgtattctcattttggcttaaccggga 412 ||||||||| |||||| | |||| || || || || ||||| |||||||| ||||| || Sbjct: 2116281 gagcatgcaggagcaggaactgcttgcagatgatgtcttctcgttttggctgaaccgaga 2116340 Query: 413 ttctgatgcactttctggtggtgagctcgtcttcggtggcatggacccacatcactataa 472 | |||||| |||||||||||||||||||| ||||||||||| || | || ||||| Sbjct: 2116341 cccggatgcatcctctggtggtgagctcgtctttggtggcatggatccgaagcattataa 2116400 Query: 473 gggaaaccacacctatgtccccgtgagccgcaaaggttactggcagtttaacatgggtga 532 ||| | |||||||| ||||| || ||||||||| |||||||||||||||||||| || Sbjct: 2116401 gggggatcacacctacgtccctgtttcccgcaaaggctactggcagtttaacatggggga 2116460 Query: 533 tctcttgattgatggccactctactggtttctgtgccaaaggctgtgctgctattg 588 |||| | |||||||||||||| ||||| |||||||| ||||||||||||||||||| Sbjct: 2116461 tctccttattgatggccactcaactggcttctgtgcaaaaggctgtgctgctattg 2116516 Score = 109 bits (55), Expect = 1e-20 Identities = 97/111 (87%) Strand = Plus / Plus Query: 233 tcagaaattcattgaggcaacacgtgaaacaagtgtcagttttatcctcgggaagtttga 292 |||||| ||||||||||||||||| |||||||| || | |||||| |||| |||||||| Sbjct: 2116068 tcagaagttcattgaggcaacacgcgaaacaagcgttacctttatcatcggaaagtttga 2116127 Query: 293 tggcatccttggccttggctaccctgacatctccgttgggaaagcccctcc 343 ||| || ||||| |||||||||||||| ||||| ||||||||||| ||||| Sbjct: 2116128 tggaattcttggtcttggctaccctgaaatctctgttgggaaagctcctcc 2116178 Score = 95.6 bits (48), Expect = 2e-16 Identities = 75/84 (89%) Strand = Plus / Plus Query: 149 ttgcaaaatcacatatggttctggagcaatctctggatttttcagcaatgataatgtgtt 208 ||||||||| ||||| |||||||| ||||| |||||||| ||||| || ||||||||||| Sbjct: 2115883 ttgcaaaattacatacggttctggggcaatttctggattcttcagtaaggataatgtgtt 2115942 Query: 209 ggttggggaccttgttgtgaaaaa 232 |||||| |||||||| |||||||| Sbjct: 2115943 ggttggagaccttgtagtgaaaaa 2115966 Score = 71.9 bits (36), Expect = 2e-09 Identities = 72/84 (85%) Strand = Plus / Plus Query: 505 aaggttactggcagtttaacatgggtgatctcttgattgatggccactctactggtttct 564 |||| |||| |||||| |||| ||| |||||| | |||||||||||||| ||||| |||| Sbjct: 28696276 aaggctactagcagttaaacacgggggatctccttattgatggccactcaactggcttct 28696335 Query: 565 gtgccaaaggctgtgctgctattg 588 ||| |||||||| |||||||||| Sbjct: 28696336 atgcaaaaggctgcgctgctattg 28696359 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/60 (86%), Gaps = 1/60 (1%) Strand = Plus / Plus Query: 17 acggtgatattcgacaccgggnagctccaacctgtgggttccctcgtcgaaatgctattt 76 ||||||||||| ||||| || |||||||||||||||||||| || | ||||||||||| Sbjct: 2115527 acggtgatatttgacactgg-aagctccaacctgtgggttccttcagcaaaatgctattt 2115585
>gb|AC093490.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1127_B08, complete sequence Length = 112268 Score = 159 bits (80), Expect = 1e-35 Identities = 197/236 (83%) Strand = Plus / Plus Query: 353 gagcatgcaagagcagaagttgctcgctgacgacgtattctcattttggcttaaccggga 412 ||||||||| |||||| | |||| || || || || ||||| |||||||| ||||| || Sbjct: 83122 gagcatgcaggagcaggaactgcttgcagatgatgtcttctcgttttggctgaaccgaga 83181 Query: 413 ttctgatgcactttctggtggtgagctcgtcttcggtggcatggacccacatcactataa 472 | |||||| |||||||||||||||||||| ||||||||||| || | || ||||| Sbjct: 83182 cccggatgcatcctctggtggtgagctcgtctttggtggcatggatccgaagcattataa 83241 Query: 473 gggaaaccacacctatgtccccgtgagccgcaaaggttactggcagtttaacatgggtga 532 ||| | |||||||| ||||| || ||||||||| |||||||||||||||||||| || Sbjct: 83242 gggggatcacacctacgtccctgtttcccgcaaaggctactggcagtttaacatggggga 83301 Query: 533 tctcttgattgatggccactctactggtttctgtgccaaaggctgtgctgctattg 588 |||| | |||||||||||||| ||||| |||||||| ||||||||||||||||||| Sbjct: 83302 tctccttattgatggccactcaactggcttctgtgcaaaaggctgtgctgctattg 83357 Score = 109 bits (55), Expect = 1e-20 Identities = 97/111 (87%) Strand = Plus / Plus Query: 233 tcagaaattcattgaggcaacacgtgaaacaagtgtcagttttatcctcgggaagtttga 292 |||||| ||||||||||||||||| |||||||| || | |||||| |||| |||||||| Sbjct: 82909 tcagaagttcattgaggcaacacgcgaaacaagcgttacctttatcatcggaaagtttga 82968 Query: 293 tggcatccttggccttggctaccctgacatctccgttgggaaagcccctcc 343 ||| || ||||| |||||||||||||| ||||| ||||||||||| ||||| Sbjct: 82969 tggaattcttggtcttggctaccctgaaatctctgttgggaaagctcctcc 83019 Score = 95.6 bits (48), Expect = 2e-16 Identities = 75/84 (89%) Strand = Plus / Plus Query: 149 ttgcaaaatcacatatggttctggagcaatctctggatttttcagcaatgataatgtgtt 208 ||||||||| ||||| |||||||| ||||| |||||||| ||||| || ||||||||||| Sbjct: 82724 ttgcaaaattacatacggttctggggcaatttctggattcttcagtaaggataatgtgtt 82783 Query: 209 ggttggggaccttgttgtgaaaaa 232 |||||| |||||||| |||||||| Sbjct: 82784 ggttggagaccttgtagtgaaaaa 82807 Score = 50.1 bits (25), Expect = 0.008 Identities = 52/60 (86%), Gaps = 1/60 (1%) Strand = Plus / Plus Query: 17 acggtgatattcgacaccgggnagctccaacctgtgggttccctcgtcgaaatgctattt 76 ||||||||||| ||||| || |||||||||||||||||||| || | ||||||||||| Sbjct: 82368 acggtgatatttgacactgg-aagctccaacctgtgggttccttcagcaaaatgctattt 82426
>gb|AY103982.1| Zea mays PCO140262 mRNA sequence Length = 1929 Score = 101 bits (51), Expect = 3e-18 Identities = 338/433 (78%), Gaps = 3/433 (0%) Strand = Plus / Plus Query: 159 acatatggttctggagcaatctctggatttttcagcaatgataatgtgttggttggggac 218 |||||||||||||| |||| |||| || ||||| | || |||||||||||||| || Sbjct: 573 acatatggttctgggcaaatcgctggcttcttcagtgaggacaatgtgttggttggcaac 632 Query: 219 cttgttgtgaaaaatcagaaattcattgaggcaacacgtgaaacaagtgtcagttttatc 278 ||||||||| ||||||||||||| |||||| |||| || ||||| || | ||| ||| Sbjct: 633 cttgttgtgcaaaatcagaaatttattgagacaactcgagaaaccagccctactttcatc 692 Query: 279 ctcgggaagtttgatggcatccttggccttggctaccctgacatctccgttgggaaagcc 338 | |||||||||||||| || ||||| || || | ||||| || || || || |||| Sbjct: 693 attgggaagtttgatggaattcttggtctcggatttcctgaaatttctgtaggaggagcc 752 Query: 339 cctccagtatggctgagcatgcaagagcagaagttgctcgctgacgacgtattctcattt 398 |||||| | |||| ||||||| || ||||||| || |||| | || || ||||| || Sbjct: 753 cctccaatttggcagagcatgaaacagcagaaactggtcgcaaaggatgtcttctctttc 812 Query: 399 tggcttaaccgggattctgatgcactttctggtggtg---agctcgtcttcggtggcatg 455 |||||||| || || |||||||| |||||| || | |||| ||||| ||||| | Sbjct: 813 tggcttaatcgtgaccctgatgcatcttctggaggaggcgagcttgtctttggtggtgtt 872 Query: 456 gacccacatcactataagggaaaccacacctatgtccccgtgagccgcaaaggttactgg 515 |||||| | ||||| || || |||| || ||||| ||||| | |||||||| |||||| Sbjct: 873 gacccaaaacactacaaaggggaccatacatatgttcccgttacacgcaaaggctactgg 932 Query: 516 cagtttaacatgggtgatctcttgattgatggccactctactggtttctgtgccaaaggc 575 |||||| ||||||| ||||| | |||| ||||||||| |||||||||||||| ||| Sbjct: 933 cagtttgacatgggagatcttattattggtggccactcaactggtttctgtgctggtggc 992 Query: 576 tgtgctgctattg 588 ||||||||||||| Sbjct: 993 tgtgctgctattg 1005 Score = 67.9 bits (34), Expect = 4e-08 Identities = 64/73 (87%), Gaps = 1/73 (1%) Strand = Plus / Plus Query: 20 gtgatattcgacaccgggnagctccaacctgtgggttccctcgtcgaaatgctatttctc 79 |||||||||||||| || ||||||||| ||||||||||||| || || ||||| || || Sbjct: 435 gtgatattcgacactgg-aagctccaacttgtgggttccctcatccaagtgctacttttc 493 Query: 80 gatagcatgctac 92 ||||||||||||| Sbjct: 494 gatagcatgctac 506
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 87.7 bits (44), Expect = 4e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 501 cgcaaaggttactggcagtttaacatgggtgatctcttgattgatggccactctactggt 560 |||||||| |||||||||||||||| | | |||||| | | |||||||||||| ||||| Sbjct: 216236 cgcaaaggctactggcagtttaacacgcgggatctccttactgatggccactcaactggc 216177 Query: 561 ttctgtgccaaaggctgtgctgctattg 588 |||| ||| ||||||||||||||||||| Sbjct: 216176 ttctatgcaaaaggctgtgctgctattg 216149
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 87.7 bits (44), Expect = 4e-14 Identities = 77/88 (87%) Strand = Plus / Minus Query: 501 cgcaaaggttactggcagtttaacatgggtgatctcttgattgatggccactctactggt 560 |||||||| |||||||||||||||| | | |||||| | | |||||||||||| ||||| Sbjct: 216236 cgcaaaggctactggcagtttaacacgcgggatctccttactgatggccactcaactggc 216177 Query: 561 ttctgtgccaaaggctgtgctgctattg 588 |||| ||| ||||||||||||||||||| Sbjct: 216176 ttctatgcaaaaggctgtgctgctattg 216149
>emb|BX000501.4|CNS08CDR Oryza sativa chromosome 11, . BAC OSJNBa0032J07 of library OSJNBa from chromosome 11 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 160673 Score = 87.7 bits (44), Expect = 4e-14 Identities = 77/88 (87%) Strand = Plus / Plus Query: 501 cgcaaaggttactggcagtttaacatgggtgatctcttgattgatggccactctactggt 560 |||||||| |||||||||||||||| | | |||||| | | |||||||||||| ||||| Sbjct: 88757 cgcaaaggctactggcagtttaacacgcgggatctccttactgatggccactcaactggc 88816 Query: 561 ttctgtgccaaaggctgtgctgctattg 588 |||| ||| ||||||||||||||||||| Sbjct: 88817 ttctatgcaaaaggctgtgctgctattg 88844
>gb|AC120988.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0017N18, complete sequence Length = 156643 Score = 71.9 bits (36), Expect = 2e-09 Identities = 72/84 (85%) Strand = Plus / Plus Query: 505 aaggttactggcagtttaacatgggtgatctcttgattgatggccactctactggtttct 564 |||| |||| |||||| |||| ||| |||||| | |||||||||||||| ||||| |||| Sbjct: 124068 aaggctactagcagttaaacacgggggatctccttattgatggccactcaactggcttct 124127 Query: 565 gtgccaaaggctgtgctgctattg 588 ||| |||||||| |||||||||| Sbjct: 124128 atgcaaaaggctgcgctgctattg 124151
>gb|AC098573.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1651_G11, complete sequence Length = 112796 Score = 71.9 bits (36), Expect = 2e-09 Identities = 72/84 (85%) Strand = Plus / Plus Query: 505 aaggttactggcagtttaacatgggtgatctcttgattgatggccactctactggtttct 564 |||| |||| |||||| |||| ||| |||||| | |||||||||||||| ||||| |||| Sbjct: 14989 aaggctactagcagttaaacacgggggatctccttattgatggccactcaactggcttct 15048 Query: 565 gtgccaaaggctgtgctgctattg 588 ||| |||||||| |||||||||| Sbjct: 15049 atgcaaaaggctgcgctgctattg 15072
>gb|BT013775.1| Lycopersicon esculentum clone 132663F, mRNA sequence Length = 1929 Score = 65.9 bits (33), Expect = 1e-07 Identities = 72/85 (84%) Strand = Plus / Plus Query: 169 ctggagcaatctctggatttttcagcaatgataatgtgttggttggggaccttgttgtga 228 |||||||||| |||||||| ||||| | ||||| || ||||| ||||||||||||| Sbjct: 655 ctggagcaatatctggattcttcagtcaagataacgtcaaagttggtgaccttgttgtga 714 Query: 229 aaaatcagaaattcattgaggcaac 253 |||||||| | |||||||||||||| Sbjct: 715 aaaatcaggagttcattgaggcaac 739
>ref|NM_183594.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1488 Score = 60.0 bits (30), Expect = 9e-06 Identities = 63/73 (86%), Gaps = 1/73 (1%) Strand = Plus / Plus Query: 20 gtgatattcgacaccgggnagctccaacctgtgggttccctcgtcgaaatgctatttctc 79 |||||||||||||| || ||||||||| |||||||||| || |||||| ||||| || Sbjct: 271 gtgatattcgacactgg-aagctccaacttgtgggttccatcagtgaaatgttatttttc 329 Query: 80 gatagcatgctac 92 ||||||||||||| Sbjct: 330 gatagcatgctac 342 Score = 50.1 bits (25), Expect = 0.008 Identities = 274/357 (76%) Strand = Plus / Plus Query: 210 gttggggaccttgttgtgaaaaatcagaaattcattgaggcaacacgtgaaacaagtgtc 269 |||||||| |||| |||||||||||||| ||||||||| |||| | ||| | || | Sbjct: 460 gttggggatcttgctgtgaaaaatcagatgttcattgagacaaccagggaaccgagcctt 519 Query: 270 agttttatcctcgggaagtttgatggcatccttggccttggctaccctgacatctccgtt 329 | ||| ||| |||||||||||||||| || ||||| ||||| | || || ||||| || Sbjct: 520 actttcatcatcgggaagtttgatggaattcttggacttggatttccggagatctctgtg 579 Query: 330 gggaaagcccctccagtatggctgagcatgcaagagcagaagttgctcgctgacgacgta 389 || |||||||||| | |||| | | ||| |||||||| | || ||| | || ||| Sbjct: 580 ggaggagcccctccaatttggcagggaatgaaagagcagcaactgatcgagaaggatgta 639 Query: 390 ttctcattttggcttaaccgggattctgatgcactttctggtggtgagctcgtcttcggt 449 ||||| || ||||| ||||| ||| ||||||||| | || |||||| | |||| ||| Sbjct: 640 ttctccttctggctcaaccgcgatcctgatgcaccgacagggggtgagttaatctttggt 699 Query: 450 ggcatggacccacatcactataagggaaaccacacctatgtccccgtgagccgcaaaggt 509 || | |||||| |||| || ||||| | ||| || ||||| || || | ||||||||| Sbjct: 700 ggtgtagacccaaatcattacaaggggagccatacatatgttcctgttacccgcaaaggc 759 Query: 510 tactggcagtttaacatgggtgatctcttgattgatggccactctactggtttctgt 566 |||||||||||| | ||||| ||||| | ||||||| | |||| ||||| |||||| Sbjct: 760 tactggcagtttgagatgggggatcttcttattgatgactactcaactgggttctgt 816
>gb|AY826351.2| Fagopyrum esculentum aspartic proteinase 9 mRNA, complete cds Length = 1900 Score = 60.0 bits (30), Expect = 9e-06 Identities = 39/42 (92%) Strand = Plus / Plus Query: 213 ggggaccttgttgtgaaaaatcagaaattcattgaggcaaca 254 |||||||||||||| |||||||| ||||||||||||||||| Sbjct: 618 ggggaccttgttgttgaaaatcaggaattcattgaggcaaca 659
>dbj|AK100420.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023088B02, full insert sequence Length = 1853 Score = 60.0 bits (30), Expect = 9e-06 Identities = 63/73 (86%), Gaps = 1/73 (1%) Strand = Plus / Plus Query: 20 gtgatattcgacaccgggnagctccaacctgtgggttccctcgtcgaaatgctatttctc 79 |||||||||||||| || ||||||||| |||||||||| || |||||| ||||| || Sbjct: 382 gtgatattcgacactgg-aagctccaacttgtgggttccatcagtgaaatgttatttttc 440 Query: 80 gatagcatgctac 92 ||||||||||||| Sbjct: 441 gatagcatgctac 453 Score = 50.1 bits (25), Expect = 0.008 Identities = 82/101 (81%) Strand = Plus / Plus Query: 210 gttggggaccttgttgtgaaaaatcagaaattcattgaggcaacacgtgaaacaagtgtc 269 |||||||| |||| |||||||||||||| ||||||||| |||| | ||| | || | Sbjct: 571 gttggggatcttgctgtgaaaaatcagatgttcattgagacaaccagggaaccgagcctt 630 Query: 270 agttttatcctcgggaagtttgatggcatccttggccttgg 310 | ||| ||| |||||||||||||||| || ||||| ||||| Sbjct: 631 actttcatcatcgggaagtttgatggaattcttggacttgg 671 Score = 48.1 bits (24), Expect = 0.033 Identities = 141/180 (78%) Strand = Plus / Plus Query: 387 gtattctcattttggcttaaccgggattctgatgcactttctggtggtgagctcgtcttc 446 |||||||| || ||||| ||||| ||| ||||||||| | || |||||| | |||| Sbjct: 748 gtattctccttctggctcaaccgcgatcctgatgcaccgacagggggtgagttaatcttt 807 Query: 447 ggtggcatggacccacatcactataagggaaaccacacctatgtccccgtgagccgcaaa 506 ||||| | |||||| |||| || ||||| | ||| || ||||| || || | ||||||| Sbjct: 808 ggtggtgtagacccaaatcattacaaggggagccatacatatgttcctgttacccgcaaa 867 Query: 507 ggttactggcagtttaacatgggtgatctcttgattgatggccactctactggtttctgt 566 || |||||||||||| | ||||| ||||| | ||||||| | |||| ||||| |||||| Sbjct: 868 ggctactggcagtttgagatgggggatcttcttattgatgactactcaactgggttctgt 927
>dbj|AK072264.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023005B17, full insert sequence Length = 1778 Score = 60.0 bits (30), Expect = 9e-06 Identities = 63/73 (86%), Gaps = 1/73 (1%) Strand = Plus / Plus Query: 20 gtgatattcgacaccgggnagctccaacctgtgggttccctcgtcgaaatgctatttctc 79 |||||||||||||| || ||||||||| |||||||||| || |||||| ||||| || Sbjct: 355 gtgatattcgacactgg-aagctccaacttgtgggttccatcagtgaaatgttatttttc 413 Query: 80 gatagcatgctac 92 ||||||||||||| Sbjct: 414 gatagcatgctac 426 Score = 50.1 bits (25), Expect = 0.008 Identities = 274/357 (76%) Strand = Plus / Plus Query: 210 gttggggaccttgttgtgaaaaatcagaaattcattgaggcaacacgtgaaacaagtgtc 269 |||||||| |||| |||||||||||||| ||||||||| |||| | ||| | || | Sbjct: 544 gttggggatcttgctgtgaaaaatcagatgttcattgagacaaccagggaaccgagcctt 603 Query: 270 agttttatcctcgggaagtttgatggcatccttggccttggctaccctgacatctccgtt 329 | ||| ||| |||||||||||||||| || ||||| ||||| | || || ||||| || Sbjct: 604 actttcatcatcgggaagtttgatggaattcttggacttggatttccggagatctctgtg 663 Query: 330 gggaaagcccctccagtatggctgagcatgcaagagcagaagttgctcgctgacgacgta 389 || |||||||||| | |||| | | ||| |||||||| | || ||| | || ||| Sbjct: 664 ggaggagcccctccaatttggcagggaatgaaagagcagcaactgatcgagaaggatgta 723 Query: 390 ttctcattttggcttaaccgggattctgatgcactttctggtggtgagctcgtcttcggt 449 ||||| || ||||| ||||| ||| ||||||||| | || |||||| | |||| ||| Sbjct: 724 ttctccttctggctcaaccgcgatcctgatgcaccgacagggggtgagttaatctttggt 783 Query: 450 ggcatggacccacatcactataagggaaaccacacctatgtccccgtgagccgcaaaggt 509 || | |||||| |||| || ||||| | ||| || ||||| || || | ||||||||| Sbjct: 784 ggtgtagacccaaatcattacaaggggagccatacatatgttcctgttacccgcaaaggc 843 Query: 510 tactggcagtttaacatgggtgatctcttgattgatggccactctactggtttctgt 566 |||||||||||| | ||||| ||||| | ||||||| | |||| ||||| |||||| Sbjct: 844 tactggcagtttgagatgggggatcttcttattgatgactactcaactgggttctgt 900
>dbj|AK066523.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013071P15, full insert sequence Length = 2061 Score = 60.0 bits (30), Expect = 9e-06 Identities = 63/73 (86%), Gaps = 1/73 (1%) Strand = Plus / Plus Query: 20 gtgatattcgacaccgggnagctccaacctgtgggttccctcgtcgaaatgctatttctc 79 |||||||||||||| || ||||||||| |||||||||| || |||||| ||||| || Sbjct: 436 gtgatattcgacactgg-aagctccaacttgtgggttccatcagtgaaatgttatttttc 494 Query: 80 gatagcatgctac 92 ||||||||||||| Sbjct: 495 gatagcatgctac 507 Score = 50.1 bits (25), Expect = 0.008 Identities = 274/357 (76%) Strand = Plus / Plus Query: 210 gttggggaccttgttgtgaaaaatcagaaattcattgaggcaacacgtgaaacaagtgtc 269 |||||||| |||| |||||||||||||| ||||||||| |||| | ||| | || | Sbjct: 625 gttggggatcttgctgtgaaaaatcagatgttcattgagacaaccagggaaccgagcctt 684 Query: 270 agttttatcctcgggaagtttgatggcatccttggccttggctaccctgacatctccgtt 329 | ||| ||| |||||||||||||||| || ||||| ||||| | || || ||||| || Sbjct: 685 actttcatcatcgggaagtttgatggaattcttggacttggatttccggagatctctgtg 744 Query: 330 gggaaagcccctccagtatggctgagcatgcaagagcagaagttgctcgctgacgacgta 389 || |||||||||| | |||| | | ||| |||||||| | || ||| | || ||| Sbjct: 745 ggaggagcccctccaatttggcagggaatgaaagagcagcaactgatcgagaaggatgta 804 Query: 390 ttctcattttggcttaaccgggattctgatgcactttctggtggtgagctcgtcttcggt 449 ||||| || ||||| ||||| ||| ||||||||| | || |||||| | |||| ||| Sbjct: 805 ttctccttctggctcaaccgcgatcctgatgcaccgacagggggtgagttaatctttggt 864 Query: 450 ggcatggacccacatcactataagggaaaccacacctatgtccccgtgagccgcaaaggt 509 || | |||||| |||| || ||||| | ||| || ||||| || || | ||||||||| Sbjct: 865 ggtgtagacccaaatcattacaaggggagccatacatatgttcctgttacccgcaaaggc 924 Query: 510 tactggcagtttaacatgggtgatctcttgattgatggccactctactggtttctgt 566 |||||||||||| | ||||| ||||| | ||||||| | |||| ||||| |||||| Sbjct: 925 tactggcagtttgagatgggggatcttcttattgatgactactcaactgggttctgt 981
>ref|NM_116684.3| Arabidopsis thaliana aspartic-type endopeptidase/ pepsin A AT4G04460 mRNA, complete cds Length = 1712 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 504 aaaggttactggcagtttaacatgggtgatctc 536 |||||||||||||||||| |||||||||||||| Sbjct: 844 aaaggttactggcagtttgacatgggtgatctc 876
>emb|AL161500.2|ATCHRIV12 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 12 Length = 199759 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 504 aaaggttactggcagtttaacatgggtgatctc 536 |||||||||||||||||| |||||||||||||| Sbjct: 148210 aaaggttactggcagtttgacatgggtgatctc 148242
>gb|AF372974.1|AF372974 Arabidopsis thaliana AT4g04460/T26N6_7 mRNA, complete cds Length = 1677 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 504 aaaggttactggcagtttaacatgggtgatctc 536 |||||||||||||||||| |||||||||||||| Sbjct: 828 aaaggttactggcagtttgacatgggtgatctc 860
>emb|BX827174.1|CNS0A2UE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS1ZB10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1688 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 504 aaaggttactggcagtttaacatgggtgatctc 536 |||||||||||||||||| |||||||||||||| Sbjct: 844 aaaggttactggcagtttgacatgggtgatctc 876
>emb|BX829292.1|CNS0A2OQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL89ZE03 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1593 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 504 aaaggttactggcagtttaacatgggtgatctc 536 |||||||||||||||||| |||||||||||||| Sbjct: 793 aaaggttactggcagtttgacatgggtgatctc 825
>gb|AF076243.1|AF076243 Arabidopsis thaliana BAC T26N6 from chromosome IV at 19.3 cM, complete sequence Length = 99384 Score = 58.0 bits (29), Expect = 3e-05 Identities = 32/33 (96%) Strand = Plus / Plus Query: 504 aaaggttactggcagtttaacatgggtgatctc 536 |||||||||||||||||| |||||||||||||| Sbjct: 47864 aaaggttactggcagtttgacatgggtgatctc 47896
>emb|X80067.1|BOASPPR B.oleracea mRNA for aspartic protease Length = 780 Score = 52.0 bits (26), Expect = 0.002 Identities = 44/50 (88%) Strand = Plus / Plus Query: 39 agctccaacctgtgggttccctcgtcgaaatgctatttctcgatagcatg 88 ||||| ||||| ||||| || || |||||||||||||||||||| ||||| Sbjct: 321 agctctaacctctgggtgccttcatcgaaatgctatttctcgattgcatg 370
>emb|X56136.1|HVASPROT Barley mRNA for aspartic proteinase Length = 1800 Score = 52.0 bits (26), Expect = 0.002 Identities = 62/73 (84%), Gaps = 1/73 (1%) Strand = Plus / Plus Query: 26 ttcgacaccgggnagctccaacctgtgggttccctcgtcgaaatgctatttctcgatagc 85 ||||||||||| ||||||||||| ||||| ||||| | || ||||| |||||||| || Sbjct: 336 ttcgacaccgg-cagctccaacctctgggtgccctccgccaagtgctacttctcgattgc 394 Query: 86 atgctacctccac 98 |||||||||||| Sbjct: 395 gtgctacctccac 407
>dbj|AB219968.1| Triticum aestivum WAP1 mRNA for aspartic proteinase, complete cds Length = 1527 Score = 52.0 bits (26), Expect = 0.002 Identities = 62/73 (84%), Gaps = 1/73 (1%) Strand = Plus / Plus Query: 26 ttcgacaccgggnagctccaacctgtgggttccctcgtcgaaatgctatttctcgatagc 85 ||||||||||| ||||||||||| ||||| ||||| | || ||||| |||||||| || Sbjct: 298 ttcgacaccgg-cagctccaacctctgggtgccctccgccaagtgctacttctcgattgc 356 Query: 86 atgctacctccac 98 |||||||||||| Sbjct: 357 gtgctacctccac 369
>dbj|AB069959.1| Glycine max soyAP1 mRNA for aspartic proteinase 1, complete cds Length = 1719 Score = 52.0 bits (26), Expect = 0.002 Identities = 50/58 (86%) Strand = Plus / Plus Query: 464 tcactataagggaaaccacacctatgtccccgtgagccgcaaaggttactggcagttt 521 ||||||||||||||| ||||| ||||| ||||||| | | ||||| || ||||||||| Sbjct: 756 tcactataagggaaagcacacttatgtgcccgtgaccagaaaaggatattggcagttt 813
>gb|L46681.1|TOMAPP Lycopersicon esculentum aspartic protease precursor mRNA, complete cds Length = 1740 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 45 aacctgtgggttccctcgtcgaaatgctatttctcgatagcatgct 90 ||||| |||||||| || ||||||||||||||||| || ||||||| Sbjct: 334 aacctctgggttccatcatcgaaatgctatttctctattgcatgct 379
>gb|AY672651.1| Solanum tuberosum Asp mRNA, complete cds Length = 1680 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 45 aacctgtgggttccctcgtcgaaatgctatttctcgatagcatgct 90 ||||| |||||||| || ||||||||||||||||| || ||||||| Sbjct: 323 aacctctgggttccatcatcgaaatgctatttctctattgcatgct 368
>gb|DQ241852.1| Solanum tuberosum clone 188C11 aspartic protease precursor-like mRNA, complete cds Length = 1764 Score = 52.0 bits (26), Expect = 0.002 Identities = 41/46 (89%) Strand = Plus / Plus Query: 45 aacctgtgggttccctcgtcgaaatgctatttctcgatagcatgct 90 ||||| |||||||| || ||||||||||||||||| || ||||||| Sbjct: 340 aacctctgggttccatcatcgaaatgctatttctctattgcatgct 385
>ref|XM_847357.1| PREDICTED: Canis familiaris similar to SP140 nuclear body protein isoform 1 (LOC609988), mRNA Length = 2344 Score = 48.1 bits (24), Expect = 0.033 Identities = 27/28 (96%) Strand = Plus / Minus Query: 413 ttctgatgcactttctggtggtgagctc 440 ||||||| |||||||||||||||||||| Sbjct: 1063 ttctgatccactttctggtggtgagctc 1036
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 48.1 bits (24), Expect = 0.033 Identities = 141/180 (78%) Strand = Plus / Minus Query: 387 gtattctcattttggcttaaccgggattctgatgcactttctggtggtgagctcgtcttc 446 |||||||| || ||||| ||||| ||| ||||||||| | || |||||| | |||| Sbjct: 10492082 gtattctccttctggctcaaccgcgatcctgatgcaccgacagggggtgagttaatcttt 10492023 Query: 447 ggtggcatggacccacatcactataagggaaaccacacctatgtccccgtgagccgcaaa 506 ||||| | |||||| |||| || ||||| | ||| || ||||| || || | ||||||| Sbjct: 10492022 ggtggtgtagacccaaatcattacaaggggagccatacatatgttcctgttacccgcaaa 10491963 Query: 507 ggttactggcagtttaacatgggtgatctcttgattgatggccactctactggtttctgt 566 || |||||||||||| | ||||| ||||| | ||||||| | |||| ||||| |||||| Sbjct: 10491962 ggctactggcagtttgagatgggggatcttcttattgatgactactcaactgggttctgt 10491903 Score = 40.1 bits (20), Expect = 8.0 Identities = 35/39 (89%), Gaps = 1/39 (2%) Strand = Plus / Minus Query: 20 gtgatattcgacaccgggnagctccaacctgtgggttcc 58 ||||||||||||| | || ||||||||| |||||||||| Sbjct: 10492833 gtgatattcgaca-ctggaagctccaacttgtgggttcc 10492796
>dbj|AP002480.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, clone:P0469E05 Length = 160769 Score = 48.1 bits (24), Expect = 0.033 Identities = 141/180 (78%) Strand = Plus / Minus Query: 387 gtattctcattttggcttaaccgggattctgatgcactttctggtggtgagctcgtcttc 446 |||||||| || ||||| ||||| ||| ||||||||| | || |||||| | |||| Sbjct: 137042 gtattctccttctggctcaaccgcgatcctgatgcaccgacagggggtgagttaatcttt 136983 Query: 447 ggtggcatggacccacatcactataagggaaaccacacctatgtccccgtgagccgcaaa 506 ||||| | |||||| |||| || ||||| | ||| || ||||| || || | ||||||| Sbjct: 136982 ggtggtgtagacccaaatcattacaaggggagccatacatatgttcctgttacccgcaaa 136923 Query: 507 ggttactggcagtttaacatgggtgatctcttgattgatggccactctactggtttctgt 566 || |||||||||||| | ||||| ||||| | ||||||| | |||| ||||| |||||| Sbjct: 136922 ggctactggcagtttgagatgggggatcttcttattgatgactactcaactgggttctgt 136863 Score = 40.1 bits (20), Expect = 8.0 Identities = 35/39 (89%), Gaps = 1/39 (2%) Strand = Plus / Minus Query: 20 gtgatattcgacaccgggnagctccaacctgtgggttcc 58 ||||||||||||| | || ||||||||| |||||||||| Sbjct: 137793 gtgatattcgaca-ctggaagctccaacttgtgggttcc 137756
>gb|AF082029.1|AF082029 Hemerocallis hybrid cultivar senescence-associated protein 4 (SA4) mRNA, complete cds Length = 1970 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Plus Query: 486 tatgtccccgtgagccgcaaaggttactggcagtttaacatggg 529 |||||||| |||| || |||||||||||||||||| ||||||| Sbjct: 849 tatgtccctgtgacccagaaaggttactggcagtttgacatggg 892
>dbj|AB021787.1| Pyrus pyrifolia PPFRU11 mRNA for aspartic endopeptidase, partial cds Length = 1028 Score = 48.1 bits (24), Expect = 0.033 Identities = 39/44 (88%) Strand = Plus / Plus Query: 504 aaaggttactggcagtttaacatgggtgatctcttgattgatgg 547 ||||| |||||||||||| | ||||||||| |||| |||||||| Sbjct: 73 aaaggctactggcagtttgatatgggtgatgtcttaattgatgg 116
>gb|AY338258.1| Pyrus pyrifolia clone 2 aspartic protease (ap2) mRNA, partial cds Length = 601 Score = 46.1 bits (23), Expect = 0.13 Identities = 92/115 (80%) Strand = Plus / Plus Query: 454 tggacccacatcactataagggaaaccacacctatgtccccgtgagccgcaaaggttact 513 ||||||| ||||||| |||||||| ||||| ||||| || || | | ||||| || | Sbjct: 340 tggaccccaatcactacaagggaaagcacacatatgttcctgttacacagaaaggctatt 399 Query: 514 ggcagtttaacatgggtgatctcttgattgatggccactctactggtttctgtgc 568 |||||||| ||||||||||| | |||||||||| || ||||||| || ||||| Sbjct: 400 ggcagtttgacatgggtgatgttatgattgatggtcaaactactggattttgtgc 454
>gb|AY338257.1| Pyrus pyrifolia clone 1 aspartic protease (ap1) mRNA, partial cds Length = 601 Score = 46.1 bits (23), Expect = 0.13 Identities = 92/115 (80%) Strand = Plus / Plus Query: 454 tggacccacatcactataagggaaaccacacctatgtccccgtgagccgcaaaggttact 513 ||||||| ||||||| |||||||| ||||| ||||| || || | | ||||| || | Sbjct: 340 tggaccccaatcactacaagggaaagcacacatatgttcctgttacacagaaaggctatt 399 Query: 514 ggcagtttaacatgggtgatctcttgattgatggccactctactggtttctgtgc 568 |||||||| ||||||||||| | |||||||||| || ||||||| || ||||| Sbjct: 400 ggcagtttgacatgggtgatgttatgattgatggtcaaactactggattttgtgc 454
>emb|AJ009838.1|PSI9838 Podarcis sicula mRNA for ovarian Cathepsin D Length = 1442 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 285 aagtttgatggcatccttggcct 307 ||||||||||||||||||||||| Sbjct: 679 aagtttgatggcatccttggcct 701
>dbj|AK104371.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-E08, full insert sequence Length = 1155 Score = 46.1 bits (23), Expect = 0.13 Identities = 56/67 (83%) Strand = Plus / Plus Query: 500 ccgcaaaggttactggcagtttaacatgggtgatctcttgattgatggccactctactgg 559 ||||||||| |||||||||||| | ||||| ||||| | ||||||| | |||| ||||| Sbjct: 33 ccgcaaaggctactggcagtttgagatgggggatcttcttattgatgactactcaactgg 92 Query: 560 tttctgt 566 |||||| Sbjct: 93 gttctgt 99
>gb|AY103665.1| Zea mays PCO108960 mRNA sequence Length = 1413 Score = 46.1 bits (23), Expect = 0.13 Identities = 77/95 (81%) Strand = Plus / Plus Query: 477 aaccacacctatgtccccgtgagccgcaaaggttactggcagtttaacatgggtgatctc 536 ||||||||||| |||||||| |||||| || ||||||||||| ||||||| || || Sbjct: 362 aaccacacctacgtccccgtctcccgcaagggatactggcagttcgacatgggggacctt 421 Query: 537 ttgattgatggccactctactggtttctgtgccaa 571 | || || |||||||| || |||||||| ||||| Sbjct: 422 ctcatcgacggccactccaccggtttctgcgccaa 456
>gb|U55032.1|BNU55032 Brassica napus aspartic protease gene, complete cds Length = 5381 Score = 46.1 bits (23), Expect = 0.13 Identities = 35/39 (89%) Strand = Plus / Plus Query: 42 tccaacctgtgggttccctcgtcgaaatgctatttctcg 80 |||||||| ||||| || || |||||||||||||||||| Sbjct: 2382 tccaacctctgggtgccatcatcgaaatgctatttctcg 2420
>gb|BT017963.1| Zea mays clone EL01N0523D02.c mRNA sequence Length = 1169 Score = 44.1 bits (22), Expect = 0.51 Identities = 34/38 (89%) Strand = Plus / Plus Query: 510 tactggcagtttaacatgggtgatctcttgattgatgg 547 ||||||||||| |||||||||||| || || ||||||| Sbjct: 129 tactggcagttcaacatgggtgatgtcctggttgatgg 166
>emb|X69193.1|VCCYNA V.cardunculus mRNA for cynarase Length = 1603 Score = 44.1 bits (22), Expect = 0.51 Identities = 25/26 (96%) Strand = Plus / Plus Query: 285 aagtttgatggcatccttggccttgg 310 ||||||||||| |||||||||||||| Sbjct: 462 aagtttgatggtatccttggccttgg 487
>emb|AJ313385.1|TCA313385 Theobroma cacao mRNA for aspartic proteinase (ap2 gene) Length = 1828 Score = 44.1 bits (22), Expect = 0.51 Identities = 28/30 (93%) Strand = Plus / Plus Query: 504 aaaggttactggcagtttaacatgggtgat 533 ||||| |||||||||||| ||||||||||| Sbjct: 857 aaaggctactggcagtttgacatgggtgat 886
>ref|XM_946728.1| Theileria annulata strain Ankara hypothetical protein (TA15705) partial mRNA Length = 1008 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 80 gatagcatgctacctccaccccaaa 104 ||||||||||||||||||| ||||| Sbjct: 97 gatagcatgctacctccacaccaaa 121
>emb|AL441943.6| Human DNA sequence from clone RP11-69C17 on chromosome 10 Contains four novel genes (FLJ40155) (FLJ31539), complete sequence Length = 203234 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 173 agcaatctctggatttttcag 193 ||||||||||||||||||||| Sbjct: 76176 agcaatctctggatttttcag 76196
>emb|AJ313384.1|TCA313384 Theobroma cacao mRNA for aspartic proteinase (ap1 gene) Length = 1784 Score = 42.1 bits (21), Expect = 2.0 Identities = 27/29 (93%) Strand = Plus / Plus Query: 69 tgctatttctcgatagcatgctacctcca 97 ||||||||||||||||| ||||| ||||| Sbjct: 423 tgctatttctcgatagcttgctatctcca 451 Score = 40.1 bits (20), Expect = 8.0 Identities = 35/40 (87%) Strand = Plus / Plus Query: 504 aaaggttactggcagtttaacatgggtgatctcttgattg 543 ||||| |||||||||||| | ||||||||| || |||||| Sbjct: 858 aaaggatactggcagtttgatatgggtgatgtcctgattg 897
>gb|DQ073803.1| Gobius niger cathepsin D-like mRNA, partial sequence Length = 370 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 41 ctccaacctgtgggttccctc 61 ||||||||||||||||||||| Sbjct: 6 ctccaacctgtgggttccctc 26
>dbj|AK120819.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023015E20, full insert sequence Length = 2975 Score = 42.1 bits (21), Expect = 2.0 Identities = 24/25 (96%) Strand = Plus / Plus Query: 222 gttgtgaaaaatcagaaattcattg 246 ||||||||| ||||||||||||||| Sbjct: 1196 gttgtgaaagatcagaaattcattg 1220
>gb|AC102672.13| Mus musculus chromosome 14, clone RP23-181E7, complete sequence Length = 208396 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 256 gtgaaacaagtgtcagtttt 275 |||||||||||||||||||| Sbjct: 129173 gtgaaacaagtgtcagtttt 129154
>ref|NM_101062.2| Arabidopsis thaliana aspartic-type endopeptidase/ pepsin A AT1G11910 mRNA, complete cds Length = 1898 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 510 tactggcagtttaacatgggtgat 533 |||||||||||| ||||||||||| Sbjct: 827 tactggcagtttgacatgggtgat 850
>gb|AC159408.1| Trypanosoma brucei chromosome 7 clone RPCI93-13M20, complete sequence Length = 162223 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 486 tatgtccccgtgagccgcaaaggt 509 |||||||||| ||||||||||||| Sbjct: 98354 tatgtccccgagagccgcaaaggt 98331
>gb|CP000070.1| Trypanosoma brucei chromosome 7, complete sequence Length = 2205233 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 486 tatgtccccgtgagccgcaaaggt 509 |||||||||| ||||||||||||| Sbjct: 745283 tatgtccccgagagccgcaaaggt 745306
>gb|AC122228.4| Mus musculus BAC clone RP23-131N12 from chromosome 12, complete sequence Length = 202970 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 520 ttaacatgggtgatctcttg 539 |||||||||||||||||||| Sbjct: 84386 ttaacatgggtgatctcttg 84367
>gb|AC147101.2| Mus musculus BAC clone RP23-455H16 from chromosome 12, complete sequence Length = 168258 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 468 tataagggaaaccacaccta 487 |||||||||||||||||||| Sbjct: 99985 tataagggaaaccacaccta 99966
>gb|AC132582.3| Mus musculus BAC clone RP24-319N10 from chromosome 12, complete sequence Length = 159310 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 468 tataagggaaaccacaccta 487 |||||||||||||||||||| Sbjct: 131517 tataagggaaaccacaccta 131498
>ref|XM_755980.1| Ustilago maydis 521 hypothetical protein (UM04926.1) partial mRNA Length = 1257 Score = 40.1 bits (20), Expect = 8.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 280 tcgggaagtttgatggcatccttggcct 307 |||| ||||||||||||||||| ||||| Sbjct: 620 tcggcaagtttgatggcatcctgggcct 647
>ref|XM_818563.1| Trypanosoma brucei TREU927 clone RPCI93-13M20 hypothetical protein (Tb927.7.2970) partial mRNA Length = 2475 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 486 tatgtccccgtgagccgcaaaggt 509 |||||||||| ||||||||||||| Sbjct: 491 tatgtccccgagagccgcaaaggt 514
>gb|AF083701.1| Arabidopsis thaliana clone sps227 unknown mRNA Length = 506 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 510 tactggcagtttaacatgggtgat 533 |||||||||||| ||||||||||| Sbjct: 321 tactggcagtttgacatgggtgat 344
>emb|AL590229.3| Human DNA sequence from clone RP11-192B18 on chromosome Xq21.1-21.33, complete sequence Length = 171847 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 229 aaaatcagaaattcattgag 248 |||||||||||||||||||| Sbjct: 52586 aaaatcagaaattcattgag 52567
>gb|AY063974.1| Arabidopsis thaliana putative aspartic proteinase (At1g11910) mRNA, complete cds Length = 1830 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 510 tactggcagtttaacatgggtgat 533 |||||||||||| ||||||||||| Sbjct: 827 tactggcagtttgacatgggtgat 850
>ref|NM_204877.1| Gallus gallus progastricsin (pepsinogen C) (PGC), mRNA Length = 1339 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 429 ggtggtgagctcgtcttcgg 448 |||||||||||||||||||| Sbjct: 683 ggtggtgagctcgtcttcgg 702
>gb|AC104530.2| Homo sapiens chromosome 19 clone LLNL-FOS_25H9, complete sequence Length = 22752 Score = 40.1 bits (20), Expect = 8.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 316 ctgacatctccgttgggaaagcccctcc 343 ||||||||||| ||||||||| |||||| Sbjct: 20478 ctgacatctcccttgggaaaggccctcc 20505
>gb|AY056403.1| Arabidopsis thaliana At1g11910/F12F1_24 mRNA, complete cds Length = 1820 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 510 tactggcagtttaacatgggtgat 533 |||||||||||| ||||||||||| Sbjct: 827 tactggcagtttgacatgggtgat 850
>gb|AY056387.1| Arabidopsis thaliana At1g11910/F12F1_24 mRNA, complete cds Length = 1874 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 510 tactggcagtttaacatgggtgat 533 |||||||||||| ||||||||||| Sbjct: 827 tactggcagtttgacatgggtgat 850
>gb|AC005258.2|AC005258 Homo sapiens chromosome 19, cosmid R30783 (LLNLR-269E7) and 3' overlapping PCR product, complete sequence Length = 42559 Score = 40.1 bits (20), Expect = 8.0 Identities = 26/28 (92%) Strand = Plus / Plus Query: 316 ctgacatctccgttgggaaagcccctcc 343 ||||||||||| ||||||||| |||||| Sbjct: 8250 ctgacatctcccttgggaaaggccctcc 8277
>gb|AC121344.5| Homo sapiens X BAC RP11-408N23 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 111500 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 238 aattcattgaggcaacacgt 257 |||||||||||||||||||| Sbjct: 60402 aattcattgaggcaacacgt 60383
>gb|AY088657.1| Arabidopsis thaliana clone 8972 mRNA, complete sequence Length = 1814 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 510 tactggcagtttaacatgggtgat 533 |||||||||||| ||||||||||| Sbjct: 827 tactggcagtttgacatgggtgat 850
>dbj|AK100807.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023121L16, full insert sequence Length = 4867 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 412 attctgatgcactttctggtggtg 435 |||||||||||| ||||||||||| Sbjct: 4522 attctgatgcaccttctggtggtg 4499
>emb|Z71185.1|CEC35A5 Caenorhabditis elegans Cosmid C35A5, complete sequence Length = 42031 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 413 ttctgatgcactttctggtg 432 |||||||||||||||||||| Sbjct: 4240 ttctgatgcactttctggtg 4259
>gb|BT001980.1| Arabidopsis thaliana clone U11602 putative aspartic proteinase (At1g11910) mRNA, complete cds Length = 1552 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 510 tactggcagtttaacatgggtgat 533 |||||||||||| ||||||||||| Sbjct: 778 tactggcagtttgacatgggtgat 801
>emb|AL671891.12| Mouse DNA sequence from clone RP23-405E21 on chromosome X, complete sequence Length = 195749 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Minus Query: 358 tgcaagagcagaagttgctc 377 |||||||||||||||||||| Sbjct: 166907 tgcaagagcagaagttgctc 166888
>gb|AC164569.3| Gallus gallus BAC clone CH261-138K23 from chromosome unknown, complete sequence Length = 248284 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 429 ggtggtgagctcgtcttcgg 448 |||||||||||||||||||| Sbjct: 122093 ggtggtgagctcgtcttcgg 122112
>gb|U51036.1|ATU51036 Arabidopsis thaliana aspartic proteinase mRNA, partial cds Length = 1722 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Plus Query: 510 tactggcagtttaacatgggtgat 533 |||||||||||| ||||||||||| Sbjct: 719 tactggcagtttgacatgggtgat 742
>emb|AL845267.2| Mouse DNA sequence from clone RP23-426D2 on chromosome 2, complete sequence Length = 216597 Score = 40.1 bits (20), Expect = 8.0 Identities = 23/24 (95%) Strand = Plus / Minus Query: 301 ttggccttggctaccctgacatct 324 |||||||||||||| ||||||||| Sbjct: 55798 ttggccttggctactctgacatct 55775
>dbj|AP006121.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT16D13, TM0206a, complete sequence Length = 35623 Score = 40.1 bits (20), Expect = 8.0 Identities = 29/32 (90%) Strand = Plus / Plus Query: 162 tatggttctggagcaatctctggatttttcag 193 ||||| ||||||||||||||||| || ||||| Sbjct: 24961 tatggatctggagcaatctctggtttcttcag 24992
>dbj|AB025284.1| Gallus gallus cPgC gene for pepsinogen C, complete cds Length = 5076 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 429 ggtggtgagctcgtcttcgg 448 |||||||||||||||||||| Sbjct: 3749 ggtggtgagctcgtcttcgg 3768
>dbj|AB025282.1| Gallus gallus cPgC mRNA for pepsinogen C, complete cds Length = 1339 Score = 40.1 bits (20), Expect = 8.0 Identities = 20/20 (100%) Strand = Plus / Plus Query: 429 ggtggtgagctcgtcttcgg 448 |||||||||||||||||||| Sbjct: 683 ggtggtgagctcgtcttcgg 702 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,644,666 Number of Sequences: 3902068 Number of extensions: 4644666 Number of successful extensions: 85173 Number of sequences better than 10.0: 79 Number of HSP's better than 10.0 without gapping: 80 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 84866 Number of HSP's gapped (non-prelim): 297 length of query: 588 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 565 effective length of database: 17,143,297,704 effective search space: 9685963202760 effective search space used: 9685963202760 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
