ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name basd2l05
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predic... 62 9e-08
2gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds 62 9e-08
3gb|AY100470.1| Oryza sativa (indica cultivar-group) putative sol... 62 9e-08
4dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 62 9e-08
5dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic D... 62 9e-08
6dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 9e-08
7dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 9e-08
8dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 9e-08
9dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clon... 62 9e-08
10gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protei... 62 9e-08
11gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 54 2e-05
12emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll ... 54 2e-05
13emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvestin... 54 2e-05
14emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding... 54 2e-05
15gb|AY109324.1| Zea mays CL187_1 mRNA sequence 54 2e-05
16gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding ... 50 3e-04
17gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein... 50 3e-04
18emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b bind... 50 3e-04
19emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding p... 48 0.001
20emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding p... 48 0.001
21emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding pr... 48 0.001
22emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/... 48 0.001
23emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/... 48 0.001
24gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab... 48 0.001
25dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for ... 48 0.001
26gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 46 0.005
27emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chl... 46 0.005
28emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chloro... 46 0.005
29dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 46 0.005
30dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.005
31dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic D... 46 0.005
32emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putativ... 46 0.005
33dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.005
34dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.005
35dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.005
36dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.005
37dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clon... 46 0.005
38emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putat... 46 0.005
39gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein g... 46 0.005
40gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene... 46 0.005
41gb|DQ455591.1| Phaseolus vulgaris chloroplast chlorophyll a/b bi... 44 0.021
42emb|X61915.1|PTCABP P.thunbergii cab gene 44 0.021
43gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding... 44 0.021
44dbj|AP006706.1| Lotus japonicus genomic DNA, chromosome 3, clone... 44 0.021
45dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRN... 44 0.021
46gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B b... 42 0.082
47emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b bindi... 42 0.082
48emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b bindin... 42 0.082
49gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding p... 42 0.082
50gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b bi... 42 0.082
51gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-... 42 0.082
52gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding ... 40 0.33
53emb|AJ843976.1| Plantago major partial mRNA for light harvesting... 40 0.33
54gb|AC118345.1| Homo sapiens BAC clone RP11-34K14 from 2, complet... 40 0.33
55gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (L... 40 0.33
56dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue... 40 0.33
57emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b bin... 40 0.33
58emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/... 40 0.33
59gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab... 40 0.33
60gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b... 40 0.33
61dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyl... 40 0.33
62dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harv... 40 0.33
63dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding p... 40 0.33
64gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B bin... 38 1.3
65gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 38 1.3
66gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B... 38 1.3
67gb|AF312227.1|AF312227 Citrus reticulata light-harvesting chloro... 38 1.3
68gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-bindi... 38 1.3
69emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b bin... 38 1.3
70emb|X79277.1|LTLHAB L.temulentum lhaB mRNA 38 1.3
71gb|AY106149.1| Zea mays PCO102434 mRNA sequence 38 1.3
72emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chrom... 36 5.1
73gb|AC124672.9| Mus musculus chromosome 1, clone RP23-328G14, com... 36 5.1
74gb|DQ018375.1| Pinus gerardiana chloroplast putative light harve... 36 5.1
75gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlor... 36 5.1
76gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlor... 36 5.1
77gb|AY617093.1| Pinus remota chloroplast light harvesting chlorop... 36 5.1
78gb|AY617092.1| Pinus monophylla chloroplast light harvesting chl... 36 5.1
79gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chl... 36 5.1
80gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlor... 36 5.1
81gb|AY617083.1| Pinus radiata chloroplast light harvesting chloro... 36 5.1
82gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlo... 36 5.1
83gb|AY617081.1| Pinus echinata chloroplast light harvesting chlor... 36 5.1
84gb|AC112236.3| Homo sapiens BAC clone RP11-308D13 from 4, comple... 36 5.1
85gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (L... 36 5.1
86gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll ... 36 5.1
87emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chloro... 36 5.1
88gb|AC132387.4| Mus musculus BAC clone RP23-440M14 from 1, comple... 36 5.1
89dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harv... 36 5.1 
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 798

 Score = 61.9 bits (31), Expect = 9e-08
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||||| ||||||||||| || |||||||||||||
Sbjct: 295 gtgatccactgccggtgggccatgctgggcgcgctcggctgcg 337
to top
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds
          Length = 1044

 Score = 61.9 bits (31), Expect = 9e-08
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||||| ||||||||||| || |||||||||||||
Sbjct: 361 gtgatccactgccggtgggccatgctgggcgcgctcggctgcg 403
to top
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase
             IV-1 gene, complete cds
          Length = 15000

 Score = 61.9 bits (31), Expect = 9e-08
 Identities = 40/43 (93%)
 Strand = Plus / Minus

                                                        
Query: 1     gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
             |||||||||||||| ||||||||||| || |||||||||||||
Sbjct: 14379 gtgatccactgccggtgggccatgctgggcgcgctcggctgcg 14337
to top
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 61.9 bits (31), Expect = 9e-08
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                           
Query: 1        gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
                |||||||||||||| ||||||||||| || |||||||||||||
Sbjct: 30024632 gtgatccactgccggtgggccatgctgggcgcgctcggctgcg 30024674
to top
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0690B02
          Length = 153116

 Score = 61.9 bits (31), Expect = 9e-08
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                        
Query: 1     gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
             |||||||||||||| ||||||||||| || |||||||||||||
Sbjct: 20622 gtgatccactgccggtgggccatgctgggcgcgctcggctgcg 20664
to top
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full
           insert sequence
          Length = 1055

 Score = 61.9 bits (31), Expect = 9e-08
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||||| ||||||||||| || |||||||||||||
Sbjct: 376 gtgatccactgccggtgggccatgctgggcgcgctcggctgcg 418
to top
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full
           insert sequence
          Length = 1055

 Score = 61.9 bits (31), Expect = 9e-08
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||||| ||||||||||| || |||||||||||||
Sbjct: 376 gtgatccactgccggtgggccatgctgggcgcgctcggctgcg 418
to top
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full
           insert sequence
          Length = 1057

 Score = 61.9 bits (31), Expect = 9e-08
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||||| ||||||||||| || |||||||||||||
Sbjct: 378 gtgatccactgccggtgggccatgctgggcgcgctcggctgcg 420
to top
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full
           insert sequence
          Length = 1057

 Score = 61.9 bits (31), Expect = 9e-08
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||||| ||||||||||| || |||||||||||||
Sbjct: 378 gtgatccactgccggtgggccatgctgggcgcgctcggctgcg 420
to top
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA,
           complete cds
          Length = 1022

 Score = 61.9 bits (31), Expect = 9e-08
 Identities = 40/43 (93%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||||| ||||||||||| || |||||||||||||
Sbjct: 337 gtgatccactgccggtgggccatgctgggcgcgctcggctgcg 379
to top
>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 mRNA, complete cds
          Length = 859

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||||| ||||||||||| || || ||||||||||
Sbjct: 352 gtgatccactgccggtgggccatgctgggtgctctcggctgcg 394
to top
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein
           LHCP
          Length = 967

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||||| ||||||||||| || |||||||| ||||
Sbjct: 359 gtgatccactgccgctgggccatgctgggcgcgctcggttgcg 401
to top
>emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvesting chlorophyll a/b
           binding protein
          Length = 978

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||| | ||||||||| | ||||||||||||||||
Sbjct: 347 gtgatccactgcagatgggccatgttgggagcgctcggctgcg 389
to top
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein
          Length = 2100

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                       
Query: 1    gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
            |||||||||| ||| ||||||||||| || |||||||||||||
Sbjct: 1177 gtgatccactcccgctgggccatgctcggcgcgctcggctgcg 1219
to top
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence
          Length = 2262

 Score = 54.0 bits (27), Expect = 2e-05
 Identities = 39/43 (90%)
 Strand = Plus / Plus

                                                       
Query: 1    gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
            |||||||||| ||| ||||||||||| || |||||||||||||
Sbjct: 1307 gtgatccactcccgctgggccatgctgggcgcgctcggctgcg 1349
to top
>gb|AF417304.1| Castanea sativa putative chlorophyll-A-B-binding protein mRNA,
           partial cds
          Length = 446

 Score = 50.1 bits (25), Expect = 3e-04
 Identities = 31/33 (93%)
 Strand = Plus / Plus

                                            
Query: 1   gtgatccactgccgttgggccatgcttggagcg 33
           ||||||||| |||| ||||||||||||||||||
Sbjct: 381 gtgatccacagccgatgggccatgcttggagcg 413
to top
>gb|AY219853.1| Nicotiana tabacum chlorophyll a/b binding protein mRNA, complete
           cds
          Length = 946

 Score = 50.1 bits (25), Expect = 3e-04
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                        
Query: 1   gtgatccactgccgttgggccatgcttgg 29
           |||||||| ||||||||||||||||||||
Sbjct: 354 gtgatccattgccgttgggccatgcttgg 382
to top
>emb|X58230.1|NTCAB36 Tobacco CAB36 gene for chlorophyll a/b binding protein
          Length = 1986

 Score = 50.1 bits (25), Expect = 3e-04
 Identities = 28/29 (96%)
 Strand = Plus / Plus

                                         
Query: 1    gtgatccactgccgttgggccatgcttgg 29
            |||||||| ||||||||||||||||||||
Sbjct: 1029 gtgatccattgccgttgggccatgcttgg 1057
to top
>emb|X02359.1|PECAB22L Petunia gene for chlorophyll a/b binding protein cab 22L
          Length = 1187

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 1   gtgatccactgccgttgggccatgcttggagc 32
           |||||||||||| | |||||||||||||||||
Sbjct: 531 gtgatccactgcagatgggccatgcttggagc 562
to top
>emb|X02356.1|PECAB91R Petunia gene for chlorophyll a/b binding protein cab 91R
          Length = 1173

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 1   gtgatccactgccgttgggccatgcttggagc 32
           |||||||||||| | |||||||||||||||||
Sbjct: 531 gtgatccactgcagatgggccatgcttggagc 562
to top
>emb|X02358.1|PECAB25 Petunia gene for chlorophyll a/b binding protein cab 25
          Length = 1184

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 1   gtgatccactgccgttgggccatgcttggagc 32
           |||||||||||| | |||||||||||||||||
Sbjct: 528 gtgatccactgcagatgggccatgcttggagc 559
to top
>emb|X52744.1|NTCAB40 Tabacco Cab40 mRNA for major chlorophyll a/b binding protein
          Length = 1080

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 1   gtgatccactgccgttgggccatgcttggagc 32
           |||||||||||| | |||||||||||||||||
Sbjct: 364 gtgatccactgcagatgggccatgcttggagc 395
to top
>emb|X52741.1|NTCAB16 Tabacco Cab16 mRNA for major chlorophyll a/b binding protein
          Length = 1025

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                           
Query: 1   gtgatccactgccgttgggccatgcttggagc 32
           |||||||||||| | |||||||||||||||||
Sbjct: 356 gtgatccactgcagatgggccatgcttggagc 387
to top
>gb|M21398.1|TOBCABB Tobacco chlorophyll a/b-binding protein (Cab-E) gene, complete cds
          Length = 1815

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 30/32 (93%)
 Strand = Plus / Plus

                                            
Query: 1    gtgatccactgccgttgggccatgcttggagc 32
            |||||||||||| | |||||||||||||||||
Sbjct: 1276 gtgatccactgcagatgggccatgcttggagc 1307
to top
>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting
            chlorophyll a/b-binding protein, complete cds
          Length = 7299

 Score = 48.1 bits (24), Expect = 0.001
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                            
Query: 1    gtgatccactgccgttgggccatgcttggagc 32
            |||||||||||| | |||||||||||||||||
Sbjct: 2373 gtgatccactgcagatgggccatgcttggagc 2342



 Score = 40.1 bits (20), Expect = 0.33
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 1    gtgatccactgccgttgggccatgcttggagc 32
            |||||||||||| | ||||| |||||||||||
Sbjct: 4660 gtgatccactgcagatgggcaatgcttggagc 4691
to top
>gb|AY389573.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           40 (LHCP) mRNA, partial cds
          Length = 712

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||||| ||||| ||||| || || ||||||||||
Sbjct: 256 gtgatccactgccggtgggcaatgctgggtgctctcggctgcg 298
to top
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding
            protein
          Length = 2261

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                       
Query: 1    gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
            |||||||||| ||| ||||||||||| || |||||||| ||||
Sbjct: 1307 gtgatccactcccgctgggccatgctgggcgcgctcggttgcg 1349
to top
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding
           protein
          Length = 1664

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||| ||| ||||| ||||| || |||||||||||||
Sbjct: 744 gtgatccactcccggtgggcgatgctgggcgcgctcggctgcg 786
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete
                sequence
          Length = 22696651

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                           
Query: 1        gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
                |||||||||| ||| ||||| ||||| || |||||||||||||
Sbjct: 10793279 gtgatccactcccggtgggcgatgctgggcgcgctcggctgcg 10793321
to top
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC
             clone:P0512H04
          Length = 151049

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                        
Query: 1     gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
             |||||||||| ||| ||||| ||||| || |||||||||||||
Sbjct: 17002 gtgatccactcccggtgggcgatgctgggcgcgctcggctgcg 17044
to top
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBb0085I16
          Length = 141701

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                         
Query: 1      gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
              |||||||||| ||| ||||| ||||| || |||||||||||||
Sbjct: 129897 gtgatccactcccggtgggcgatgctgggcgcgctcggctgcg 129939
to top
>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding
           protein type I
          Length = 684

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||| | ||||||||| | || |||||||||||||
Sbjct: 87  gtgatccactgcagatgggccatgttgggggcgctcggctgcg 129
to top
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full
           insert sequence
          Length = 1013

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||| ||| ||||| ||||| || |||||||||||||
Sbjct: 347 gtgatccactcccggtgggcgatgctgggcgcgctcggctgcg 389
to top
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full
           insert sequence
          Length = 1021

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||| ||| ||||| ||||| || |||||||||||||
Sbjct: 352 gtgatccactcccggtgggcgatgctgggcgcgctcggctgcg 394
to top
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full
           insert sequence
          Length = 1056

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||| ||| ||||| ||||| || |||||||||||||
Sbjct: 354 gtgatccactcccggtgggcgatgctgggcgcgctcggctgcg 396
to top
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full
           insert sequence
          Length = 1235

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||| ||| ||||| ||||| || |||||||||||||
Sbjct: 352 gtgatccactcccggtgggcgatgctgggcgcgctcggctgcg 394
to top
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full
           insert sequence
          Length = 1045

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 38/43 (88%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||| ||| ||||| ||||| || |||||||||||||
Sbjct: 352 gtgatccactcccggtgggcgatgctgggcgcgctcggctgcg 394
to top
>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b
           binding protein (cab gene)
          Length = 760

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 1   gtgatccactgccgttgggccatgcttggagcgct 35
           |||||||||||||| ||||||||||| || |||||
Sbjct: 293 gtgatccactgccgatgggccatgctcggtgcgct 327
to top
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds
          Length = 1191

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 32/35 (91%)
 Strand = Plus / Plus

                                              
Query: 1   gtgatccactgccgttgggccatgcttggagcgct 35
           |||||||||||||| ||||||||||| || |||||
Sbjct: 498 gtgatccactgccgatgggccatgctcggtgcgct 532
to top
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds
          Length = 1913

 Score = 46.1 bits (23), Expect = 0.005
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                   
Query: 4    atccactgccgttgggccatgcttggagcgctcggctgc 42
            |||||| |||| ||||||||||| || ||||||||||||
Sbjct: 1034 atccacagccggtgggccatgctcggcgcgctcggctgc 1072
to top
>gb|DQ455591.1| Phaseolus vulgaris chloroplast chlorophyll a/b binding protein
           mRNA, partial cds; nuclear gene for chloroplast product
          Length = 404

 Score = 44.1 bits (22), Expect = 0.021
 Identities = 28/30 (93%)
 Strand = Plus / Plus

                                         
Query: 13  cgttgggccatgcttggagcgctcggctgc 42
           |||||||||||||||||||| || ||||||
Sbjct: 130 cgttgggccatgcttggagcactgggctgc 159
to top
>emb|X61915.1|PTCABP P.thunbergii cab gene
          Length = 5419

 Score = 44.1 bits (22), Expect = 0.021
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                      
Query: 1    gtgatccactgccgttgggccatgcttggagcgctcggctgc 42
            |||||||||||| | ||||||||| | ||||| |||||||||
Sbjct: 2566 gtgatccactgcagatgggccatgttgggagccctcggctgc 2607
to top
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA,
           complete cds
          Length = 980

 Score = 44.1 bits (22), Expect = 0.021
 Identities = 34/38 (89%)
 Strand = Plus / Plus

                                                 
Query: 4   atccactgccgttgggccatgcttggagcgctcggctg 41
           ||||||||| | ||||||||||||||||| || |||||
Sbjct: 340 atccactgcagatgggccatgcttggagccctaggctg 377
to top
>dbj|AP006706.1| Lotus japonicus genomic DNA, chromosome 3, clone:LjT09I23, TM0590a,
             complete sequence
          Length = 16141

 Score = 44.1 bits (22), Expect = 0.021
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                           
Query: 13    cgttgggccatgcttggagcgctcggctgc 42
             |||||||||||||||||||| || ||||||
Sbjct: 11665 cgttgggccatgcttggagcactaggctgc 11636
to top
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I
           light-harvesting chlorophyll a/b binding protein of
           photosystem II (LHCPII), complete cds
          Length = 1022

 Score = 44.1 bits (22), Expect = 0.021
 Identities = 37/42 (88%)
 Strand = Plus / Plus

                                                     
Query: 2   tgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           ||||||||| ||| ||||| ||||| || |||||||||||||
Sbjct: 334 tgatccactcccgatgggcgatgctgggcgcgctcggctgcg 375
to top
>gb|AF039598.1| Prunus persica light harvesting chlorophyll A/B binding protein
           (Lhcb-Pp2) mRNA, complete cds
          Length = 955

 Score = 42.1 bits (21), Expect = 0.082
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 1   gtgatccactgccgttgggccatgcttgg 29
           ||||||||| |||| ||||||||||||||
Sbjct: 295 gtgatccacagccgatgggccatgcttgg 323
to top
>emb|Z35160.1|STCHLABP S.tuberosum gene for chlorophyll a/b binding protein type I
          Length = 3529

 Score = 42.1 bits (21), Expect = 0.082
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                         
Query: 1    gtgatccactgccgttgggccatgcttgg 29
            |||||||| || |||||||||||||||||
Sbjct: 2406 gtgatccattgtcgttgggccatgcttgg 2434
to top
>emb|X04966.1|PHCAB37 Petunia Cab gene for chlorophyll a/b binding protein
          Length = 1470

 Score = 42.1 bits (21), Expect = 0.082
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 1   gtgatccactgccgttgggccatgcttgg 29
           |||||||| ||||||||||| ||||||||
Sbjct: 643 gtgatccattgccgttgggcaatgcttgg 671
to top
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor
           (Wcab) mRNA, complete cds
          Length = 918

 Score = 42.1 bits (21), Expect = 0.082
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 1   gtgatccactgccgttgggccatgcttgg 29
           ||||||||||| || ||||||||||||||
Sbjct: 307 gtgatccactgtcgctgggccatgcttgg 335
to top
>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein
           3C-like mRNA, complete cds
          Length = 1055

 Score = 42.1 bits (21), Expect = 0.082
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 1   gtgatccactgccgttgggccatgcttgg 29
           |||||||||||| | ||||||||||||||
Sbjct: 336 gtgatccactgcagatgggccatgcttgg 364
to top
>gb|M17558.1|TOMCAB4A Tomato Cab-4 gene encoding chlorophyll a/b-binding protein,
           complete cds
          Length = 895

 Score = 42.1 bits (21), Expect = 0.082
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                        
Query: 1   gtgatccactgccgttgggccatgcttgg 29
           ||||| || ||||||||||||||||||||
Sbjct: 353 gtgattcattgccgttgggccatgcttgg 381
to top
>gb|DQ124219.1| Fagus sylvatica putative chlorophyll a/b-binding protein mRNA,
           partial cds
          Length = 780

 Score = 40.1 bits (20), Expect = 0.33
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 1   gtgatccactgccgttgggccatgcttggagc 32
           |||||||||| | | |||||||||||||||||
Sbjct: 283 gtgatccactccagatgggccatgcttggagc 314
to top
>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1
           gene)
          Length = 688

 Score = 40.1 bits (20), Expect = 0.33
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 16  tgggccatgcttggagcgctcggctgcg 43
           ||||||||||||||||| ||||| ||||
Sbjct: 202 tgggccatgcttggagcactcggatgcg 229
to top
>gb|AC118345.1| Homo sapiens BAC clone RP11-34K14 from 2, complete sequence
          Length = 43708

 Score = 40.1 bits (20), Expect = 0.33
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 6    ccactgccgttgggccatgc 25
            ||||||||||||||||||||
Sbjct: 6024 ccactgccgttgggccatgc 6043
to top
>gb|DQ355993.1| Brassica napus chlorophyll a/b binding protein (LHB1B2) mRNA,
           partial cds
          Length = 226

 Score = 40.1 bits (20), Expect = 0.33
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 4   atccactgccgttgggccatgcttggagcgctcggctgcg 43
           ||||||||| | ||||||||||| ||||| || |||||||
Sbjct: 115 atccactgcagatgggccatgctcggagccctaggctgcg 154
to top
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds
          Length = 695

 Score = 40.1 bits (20), Expect = 0.33
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 16  tgggccatgcttggagcgctcggctgcg 43
           ||||||||||| || |||||||||||||
Sbjct: 221 tgggccatgctcggcgcgctcggctgcg 248
to top
>emb|Z75663.1|AGCHLABBP A.graveolens mRNA for chlorophyll a/b binding protein
          Length = 963

 Score = 40.1 bits (20), Expect = 0.33
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 1   gtgatccactgccgttgggccatgcttggagc 32
           |||||||||| | | |||||||||||||||||
Sbjct: 334 gtgatccactccagatgggccatgcttggagc 365
to top
>emb|X52742.1|NTCAB50 Tabacco Cab50 mRNA for major chlorophyll a/b binding protein
          Length = 964

 Score = 40.1 bits (20), Expect = 0.33
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 1   gtgatccactgccgttgggccatgcttggagc 32
           |||||||||||| | ||||| |||||||||||
Sbjct: 368 gtgatccactgcagatgggctatgcttggagc 399
to top
>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds
          Length = 1240

 Score = 40.1 bits (20), Expect = 0.33
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 1   gtgatccactgccgttgggccatgcttggagc 32
           |||||||||||  | |||||||||||||||||
Sbjct: 737 gtgatccactgtagatgggccatgcttggagc 768
to top
>gb|M16057.1|CUSLHCPA Cucumber LHCP mRNA encoding chlorophyll a/b-binding protein,
           partial cds
          Length = 878

 Score = 40.1 bits (20), Expect = 0.33
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 1   gtgatccactgccgttgggccatgcttggagc 32
           |||||||||| | | |||||||||||||||||
Sbjct: 265 gtgatccactccagatgggccatgcttggagc 296
to top
>dbj|D14002.1|LAUCAB Lettuce mRNA for light-harvesting chlorophyll a/b-binding protein
           (LHCP), complete cds
          Length = 905

 Score = 40.1 bits (20), Expect = 0.33
 Identities = 35/40 (87%)
 Strand = Plus / Plus

                                                   
Query: 4   atccactgccgttgggccatgcttggagcgctcggctgcg 43
           ||||||||| | ||||| ||||||||||| || |||||||
Sbjct: 345 atccactgcagatgggcaatgcttggagctcttggctgcg 384
to top
>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3386

 Score = 40.1 bits (20), Expect = 0.33
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                            
Query: 1    gtgatccactgccgttgggccatgcttggagc 32
            |||||||| ||| | |||||||||||||||||
Sbjct: 1751 gtgatccattgcagatgggccatgcttggagc 1782
to top
>dbj|AB006081.1| Fagus crenata mRNA for chlorophyll a/b-binding protein, complete
           cds
          Length = 1010

 Score = 40.1 bits (20), Expect = 0.33
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 1   gtgatccactgccgttgggccatgcttggagc 32
           |||||||||| | | |||||||||||||||||
Sbjct: 339 gtgatccactccagatgggccatgcttggagc 370
to top
>gb|AY818400.1| Manihot esculenta chloroplast chlorophyll A/B binding protein mRNA,
           partial cds; nuclear gene for chloroplast product
          Length = 732

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 37/43 (86%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||| | ||||| |||||||| || || |||||||
Sbjct: 229 gtgatccactgcagatgggctatgcttggtgcacttggctgcg 271
to top
>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           (CAB) mRNA, partial cds
          Length = 720

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 37/43 (86%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||| | ||||| ||||| || || ||||||||||
Sbjct: 336 gtgatccactgcaggtgggcaatgctgggcgctctcggctgcg 378
to top
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein
           3C (LHCP) mRNA, partial cds
          Length = 661

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 37/43 (86%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           |||||||||||| | ||||| ||||| || || ||||||||||
Sbjct: 171 gtgatccactgcaggtgggcaatgctgggcgctctcggctgcg 213
to top
>gb|AF312227.1|AF312227 Citrus reticulata light-harvesting chlorophyll-binding protein
           mRNA, partial cds, nuclear gene for chloroplast product
          Length = 470

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 37/43 (86%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           ||||||||| || | ||||| ||||||||||| || |||||||
Sbjct: 85  gtgatccacagcagatgggcaatgcttggagctcttggctgcg 127
to top
>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete
           cds; nuclear gene for chloroplast product
          Length = 1096

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 37/43 (86%)
 Strand = Plus / Plus

                                                      
Query: 1   gtgatccactgccgttgggccatgcttggagcgctcggctgcg 43
           ||||||||| || | ||||||||| | || |||||||||||||
Sbjct: 372 gtgatccacagcagatgggccatgttgggggcgctcggctgcg 414
to top
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor
          Length = 2780

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                   
Query: 1    gtgatccactgccgttgggccat 23
            |||||||||||||| ||||||||
Sbjct: 2218 gtgatccactgccgctgggccat 2240
to top
>emb|X79277.1|LTLHAB L.temulentum lhaB mRNA
          Length = 1026

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 25/27 (92%)
 Strand = Plus / Plus

                                      
Query: 7   cactgccgttgggccatgcttggagcg 33
           |||||||| ||||| ||||||||||||
Sbjct: 319 cactgccggtgggcgatgcttggagcg 345
to top
>gb|AY106149.1| Zea mays PCO102434 mRNA sequence
          Length = 1081

 Score = 38.2 bits (19), Expect = 1.3
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                  
Query: 6   ccactgccgttgggccatgcttg 28
           ||||||||| |||||||||||||
Sbjct: 334 ccactgccgctgggccatgcttg 356
to top
>emb|CR954246.1| Pseudoalteromonas haloplanktis str. TAC125 chromosome I, complete sequence
          Length = 3214944

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 21/22 (95%)
 Strand = Plus / Plus

                                     
Query: 6       ccactgccgttgggccatgctt 27
               ||||||| ||||||||||||||
Sbjct: 1405635 ccactgctgttgggccatgctt 1405656
to top
>gb|AC124672.9| Mus musculus chromosome 1, clone RP23-328G14, complete sequence
          Length = 249008

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                               
Query: 1     gtgatccactgccgttgg 18
             ||||||||||||||||||
Sbjct: 13183 gtgatccactgccgttgg 13166
to top
>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll
           a/b binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 760

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 1   gtgatccactgccgttgggccatgct 26
           |||||||||||||| ||||| |||||
Sbjct: 315 gtgatccactgccggtgggcaatgct 340
to top
>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 1   gtgatccactgccgttgggccatgct 26
           |||||||||||||| ||||| |||||
Sbjct: 315 gtgatccactgccggtgggcaatgct 340
to top
>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 759

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 1   gtgatccactgccgttgggccatgct 26
           |||||||||||||| ||||| |||||
Sbjct: 304 gtgatccactgccggtgggcaatgct 329
to top
>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 1   gtgatccactgccgttgggccatgct 26
           |||||||||||||| ||||| |||||
Sbjct: 315 gtgatccactgccggtgggcaatgct 340
to top
>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 1   gtgatccactgccgttgggccatgct 26
           |||||||||||||| ||||| |||||
Sbjct: 315 gtgatccactgccggtgggcaatgct 340
to top
>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 1   gtgatccactgccgttgggccatgct 26
           |||||||||||||| ||||| |||||
Sbjct: 315 gtgatccactgccggtgggcaatgct 340
to top
>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 1   gtgatccactgccgttgggccatgct 26
           |||||||||||||| ||||| |||||
Sbjct: 315 gtgatccactgccggtgggcaatgct 340
to top
>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 770

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 1   gtgatccactgccgttgggccatgct 26
           |||||||||||||| ||||| |||||
Sbjct: 315 gtgatccactgccggtgggcaatgct 340
to top
>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b
           binding protein (ifg1934) gene, partial cds; nuclear
           gene for chloroplast product
          Length = 770

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 1   gtgatccactgccgttgggccatgct 26
           |||||||||||||| ||||| |||||
Sbjct: 315 gtgatccactgccggtgggcaatgct 340
to top
>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding
           protein (ifg1934) gene, partial cds; nuclear gene for
           chloroplast product
          Length = 762

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 1   gtgatccactgccgttgggccatgct 26
           |||||||||||||| ||||| |||||
Sbjct: 315 gtgatccactgccggtgggcaatgct 340
to top
>gb|AC112236.3| Homo sapiens BAC clone RP11-308D13 from 4, complete sequence
          Length = 160615

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 21/22 (95%)
 Strand = Plus / Minus

                                    
Query: 21     catgcttggagcgctcggctgc 42
              |||||||||||| |||||||||
Sbjct: 113946 catgcttggagccctcggctgc 113925
to top
>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA,
           complete cds
          Length = 998

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 1   gtgatccactgccgttgggccatgct 26
           |||||||||||||| ||||| |||||
Sbjct: 361 gtgatccactgccggtgggcaatgct 386
to top
>gb|AF139465.2|AF139465 Vigna radiata LHCII type III chlorophyll a/b binding protein
           (CipLhcb3) mRNA, complete cds; nuclear gene for
           chloroplast product
          Length = 1047

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 27/30 (90%)
 Strand = Plus / Plus

                                         
Query: 13  cgttgggccatgcttggagcgctcggctgc 42
           |||||||||||||| ||||| || ||||||
Sbjct: 374 cgttgggccatgctcggagccctgggctgc 403
to top
>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein
          Length = 1006

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                     
Query: 1   gtgatccactgccgttgggccatgct 26
           |||||||||||||| ||||| |||||
Sbjct: 370 gtgatccactgccggtgggcaatgct 395
to top
>gb|AC132387.4| Mus musculus BAC clone RP23-440M14 from 1, complete sequence
          Length = 193449

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 18/18 (100%)
 Strand = Plus / Minus

                                
Query: 1      gtgatccactgccgttgg 18
              ||||||||||||||||||
Sbjct: 145724 gtgatccactgccgttgg 145707
to top
>dbj|AB012639.1| Nicotiana sylvestris Lhcb1*7 gene for light harvesting chlorophyll
            a/b-binding protein, complete cds
          Length = 3663

 Score = 36.2 bits (18), Expect = 5.1
 Identities = 24/26 (92%)
 Strand = Plus / Plus

                                      
Query: 7    cactgccgttgggccatgcttggagc 32
            |||||| | |||||||||||||||||
Sbjct: 2852 cactgcagatgggccatgcttggagc 2877


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 154,540
Number of Sequences: 3902068
Number of extensions: 154540
Number of successful extensions: 40452
Number of sequences better than 10.0: 89
Number of HSP's better than 10.0 without gapping: 89
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 40325
Number of HSP's gapped (non-prelim): 127
length of query: 43
length of database: 17,233,045,268
effective HSP length: 20
effective length of query: 23
effective length of database: 17,155,003,908
effective search space: 394565089884
effective search space used: 394565089884
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 18 (36.2 bits)
to top