ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd27n21
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 44 0.43
2dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome 44 0.43
3gb|AC150414.2| Branchiostoma floridae clone CH302-62C22, complet... 42 1.7
4ref|XM_413899.1| PREDICTED: Gallus gallus similar to RAS-like, f... 42 1.7
5gb|AY340382.1| Arenicola marina 28S ribosomal RNA gene, partial ... 42 1.7
6gb|AY612629.1| Arenicola marina 28S ribosomal RNA gene, partial ... 42 1.7
7gb|BC103771.1| Mus musculus RIKEN cDNA 7420416P09 gene, mRNA (cD... 40 6.7
8ref|NM_001033776.1| Mus musculus RIKEN cDNA 7420416P09 gene (742... 40 6.7
9gb|AC159641.2| Mus musculus BAC clone RP23-465F1 from chromosome... 40 6.7
10emb|CR394546.9| Zebrafish DNA sequence from clone CH211-212I14 i... 40 6.7
11emb|AL359693.11| Human DNA sequence from clone RP11-244G12 on ch... 40 6.7
12emb|AL133396.2| Human DNA sequence from clone RP5-1068H6 on chro... 40 6.7
13emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete ... 40 6.7
14gb|AC155716.7| Mus musculus 10 BAC RP24-177O15 (Roswell Park Can... 40 6.7
15emb|CR550302.15| Zebrafish DNA sequence from clone DKEY-145I3 in... 40 6.7
16emb|BX957333.8| Zebrafish DNA sequence from clone CH211-10M5 in ... 40 6.7
17gb|AC055845.15| Homo sapiens chromosome 11, clone RP11-682B13, c... 40 6.7
18dbj|AK126547.1| Homo sapiens cDNA FLJ44583 fis, clone AHMSC1000138 40 6.7
19gb|AC124829.10| Mus musculus chromosome 1, clone RP24-131G15, co... 40 6.7
20ref|XM_319312.2| Anopheles gambiae str. PEST ENSANGP00000025304 ... 40 6.7
21ref|XM_319314.2| Anopheles gambiae str. PEST ENSANGP00000022367 ... 40 6.7
22ref|XM_319308.2| Anopheles gambiae str. PEST ENSANGP00000012555 ... 40 6.7
23ref|XM_319313.2| Anopheles gambiae str. PEST ENSANGP00000023782 ... 40 6.7
24emb|AL732598.10| Zebrafish DNA sequence from clone CH211-10E8 in... 40 6.7
25gb|AC153891.6| Mus musculus 10 BAC RP23-415J15 (Roswell Park Can... 40 6.7
26gb|U74621.1|RNU74621 Rattus norvegicus vesicle-associated membra... 40 6.7
27gb|AC159462.6| Mus musculus BAC clone RP23-177D16 from chromosom... 40 6.7
28emb|AL808102.8| Mouse DNA sequence from clone RP23-192O6 on chro... 40 6.7
29gb|AC168272.8| Mus musculus 10 BAC RP24-261C21 (Roswell Park Can... 40 6.7

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 383     tgcccgtacagctgctgcggcg 404
               ||||||||||||||||||||||
Sbjct: 1185824 tgcccgtacagctgctgcggcg 1185803



to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 44.1 bits (22), Expect = 0.43
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                     
Query: 333     gctgtggcgggtacggctgctg 354
               ||||||||||||||||||||||
Sbjct: 5241716 gctgtggcgggtacggctgctg 5241695



to top

>gb|AC150414.2| Branchiostoma floridae clone CH302-62C22, complete sequence
          Length = 210179

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 276    gcgcaggtggataaggggactgtgc 300
              ||||| |||||||||||||||||||
Sbjct: 123969 gcgcaagtggataaggggactgtgc 123945



to top

>ref|XM_413899.1| PREDICTED: Gallus gallus similar to RAS-like, family 12 protein;
           Ras family member Ris (LOC415530), mRNA
          Length = 1956

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 295 ctgtgctgctgaaggtggtggatac 319
           ||||||||||||||||| |||||||
Sbjct: 602 ctgtgctgctgaaggtgatggatac 626



to top

>gb|AY340382.1| Arenicola marina 28S ribosomal RNA gene, partial sequence
          Length = 331

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 324 gcccatatggctgtggcgggt 344
           |||||||||||||||||||||
Sbjct: 188 gcccatatggctgtggcgggt 208



to top

>gb|AY612629.1| Arenicola marina 28S ribosomal RNA gene, partial sequence
          Length = 821

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                
Query: 324 gcccatatggctgtggcgggt 344
           |||||||||||||||||||||
Sbjct: 207 gcccatatggctgtggcgggt 227



to top

>gb|BC103771.1| Mus musculus RIKEN cDNA 7420416P09 gene, mRNA (cDNA clone MGC:117755
            IMAGE:30935479), complete cds
          Length = 3054

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 468  ggctgctgaggaggtggggt 487
            ||||||||||||||||||||
Sbjct: 1205 ggctgctgaggaggtggggt 1224



to top

>ref|NM_001033776.1| Mus musculus RIKEN cDNA 7420416P09 gene (7420416P09Rik), mRNA
          Length = 3054

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 468  ggctgctgaggaggtggggt 487
            ||||||||||||||||||||
Sbjct: 1205 ggctgctgaggaggtggggt 1224



to top

>gb|AC159641.2| Mus musculus BAC clone RP23-465F1 from chromosome 12, complete sequence
          Length = 176949

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 468   ggctgctgaggaggtggggt 487
             ||||||||||||||||||||
Sbjct: 97048 ggctgctgaggaggtggggt 97029



to top

>emb|CR394546.9| Zebrafish DNA sequence from clone CH211-212I14 in linkage group 16,
             complete sequence
          Length = 174132

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 162   tgtgatccatttgaaacaac 181
             ||||||||||||||||||||
Sbjct: 18809 tgtgatccatttgaaacaac 18828



to top

>emb|AL359693.11| Human DNA sequence from clone RP11-244G12 on chromosome 6, complete
             sequence
          Length = 149696

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 433   tttgacttgtaggaggacat 452
             ||||||||||||||||||||
Sbjct: 76288 tttgacttgtaggaggacat 76269



to top

>emb|AL133396.2| Human DNA sequence from clone RP5-1068H6 on chromosome 20p12.1-13
             Contains part of a ribosomal protein S4 pseudogene, the
             PRNP gene for prion protein (p27-30) (Creutzfeld-Jakob
             disease, Gerstmann-Strausler-Scheinker syndrome, fatal
             familial insomnia), the PRND gene for prion protein 2
             (dublet), a novel gene, an isopentenyl-diphosphate delta
             isomerase 1 (IDI1) pseudogene and two CpG islands,
             complete sequence
          Length = 148497

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 56    gagagaataaacgtttctga 75
             ||||||||||||||||||||
Sbjct: 79167 gagagaataaacgtttctga 79148



to top

>emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete genome; segment 14/29
          Length = 309050

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 459    tgcgggtacggctgctgagg 478
              ||||||||||||||||||||
Sbjct: 141682 tgcgggtacggctgctgagg 141663



to top

>gb|AC155716.7| Mus musculus 10 BAC RP24-177O15 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 154016

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 418   ataaggctgtggtggtttga 437
             ||||||||||||||||||||
Sbjct: 74210 ataaggctgtggtggtttga 74229



to top

>emb|CR550302.15| Zebrafish DNA sequence from clone DKEY-145I3 in linkage group 11,
             complete sequence
          Length = 202610

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 162   tgtgatccatttgaaacaac 181
             ||||||||||||||||||||
Sbjct: 31230 tgtgatccatttgaaacaac 31249



to top

>emb|BX957333.8| Zebrafish DNA sequence from clone CH211-10M5 in linkage group 25,
             complete sequence
          Length = 170161

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 162   tgtgatccatttgaaacaac 181
             ||||||||||||||||||||
Sbjct: 61582 tgtgatccatttgaaacaac 61601



to top

>gb|AC055845.15| Homo sapiens chromosome 11, clone RP11-682B13, complete sequence
          Length = 155304

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 232   ctgggtatatcaatatggcc 251
             ||||||||||||||||||||
Sbjct: 54490 ctgggtatatcaatatggcc 54471



to top

>dbj|AK126547.1| Homo sapiens cDNA FLJ44583 fis, clone AHMSC1000138
          Length = 2547

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 433 tttgacttgtaggaggacat 452
           ||||||||||||||||||||
Sbjct: 620 tttgacttgtaggaggacat 601



to top

>gb|AC124829.10| Mus musculus chromosome 1, clone RP24-131G15, complete sequence
          Length = 189923

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 156   gcttggtgtgatccatttgaaaca 179
             |||||||||||| |||||||||||
Sbjct: 51816 gcttggtgtgatgcatttgaaaca 51793



to top

>ref|XM_319312.2| Anopheles gambiae str. PEST ENSANGP00000025304 (ENSANGG00000010066),
            mRNA
          Length = 7746

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 295  ctgtgctgctgaaggtggtg 314
            ||||||||||||||||||||
Sbjct: 6194 ctgtgctgctgaaggtggtg 6175



to top

>ref|XM_319314.2| Anopheles gambiae str. PEST ENSANGP00000022367 (ENSANGG00000010066),
            mRNA
          Length = 7746

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 295  ctgtgctgctgaaggtggtg 314
            ||||||||||||||||||||
Sbjct: 6194 ctgtgctgctgaaggtggtg 6175



to top

>ref|XM_319308.2| Anopheles gambiae str. PEST ENSANGP00000012555 (ENSANGG00000010066),
            mRNA
          Length = 8115

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 295  ctgtgctgctgaaggtggtg 314
            ||||||||||||||||||||
Sbjct: 6563 ctgtgctgctgaaggtggtg 6544



to top

>ref|XM_319313.2| Anopheles gambiae str. PEST ENSANGP00000023782 (ENSANGG00000010066),
            mRNA
          Length = 8115

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 295  ctgtgctgctgaaggtggtg 314
            ||||||||||||||||||||
Sbjct: 6563 ctgtgctgctgaaggtggtg 6544



to top

>emb|AL732598.10| Zebrafish DNA sequence from clone CH211-10E8 in linkage group 6,
             complete sequence
          Length = 88982

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 162   tgtgatccatttgaaacaac 181
             ||||||||||||||||||||
Sbjct: 77530 tgtgatccatttgaaacaac 77511



to top

>gb|AC153891.6| Mus musculus 10 BAC RP23-415J15 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 198332

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 468   ggctgctgaggaggtggggt 487
             ||||||||||||||||||||
Sbjct: 22952 ggctgctgaggaggtggggt 22933



to top

>gb|U74621.1|RNU74621 Rattus norvegicus vesicle-associated membrane protein-1b (VAMP-1b)
           mRNA, complete cds
          Length = 1206

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 470 ctgctgaggaggtggggttg 489
           ||||||||||||||||||||
Sbjct: 610 ctgctgaggaggtggggttg 629



to top

>gb|AC159462.6| Mus musculus BAC clone RP23-177D16 from chromosome 10, complete sequence
          Length = 200663

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 418    ataaggctgtggtggtttga 437
              ||||||||||||||||||||
Sbjct: 100423 ataaggctgtggtggtttga 100442



to top

>emb|AL808102.8| Mouse DNA sequence from clone RP23-192O6 on chromosome 2, complete
              sequence
          Length = 178743

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 109    ggagacgatttacatgttgt 128
              ||||||||||||||||||||
Sbjct: 146904 ggagacgatttacatgttgt 146885



to top

>gb|AC168272.8| Mus musculus 10 BAC RP24-261C21 (Roswell Park Cancer Institute (C57BL/6J
              Male) Mouse BAC Library) complete sequence
          Length = 189395

 Score = 40.1 bits (20), Expect = 6.7
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 468    ggctgctgaggaggtggggt 487
              ||||||||||||||||||||
Sbjct: 130398 ggctgctgaggaggtggggt 130417


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,437,445
Number of Sequences: 3902068
Number of extensions: 3437445
Number of successful extensions: 62390
Number of sequences better than 10.0: 29
Number of HSP's better than 10.0 without gapping: 29
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 62337
Number of HSP's gapped (non-prelim): 53
length of query: 497
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 475
effective length of database: 17,147,199,772
effective search space: 8144919891700
effective search space used: 8144919891700
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top