ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd27k08
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|U43493.1|HVU43493 Hordeum vulgare ribulose-1,5-bisphosphate c... 113 1e-22
2emb|X00235.1|TARUB2 Wheat mRNA fragment for small subunit precur... 98 6e-18
3emb|AJ131738.1|SCE131738 Secale cereale mRNA for hypothetical pr... 98 6e-18
4emb|X00234.1|TARUB1 Wheat mRNA fragment for small subunit precur... 82 4e-13
5emb|X83095.1|ASRBCSSS A.squarrosa mRNA for ribulose-1,5-bisphosp... 82 4e-13
6dbj|AB042066.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 82 4e-13
7gb|K02324.1|WHTRBCC Wheat (T. aestivum) chloroplast ribulosebisp... 76 2e-11
8dbj|AB042064.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 74 9e-11
9dbj|AB020945.1| Avena sativa DNA for ribulose-1,5-bisphosphate c... 70 1e-09
10emb|AJ131737.1|SCE131737 Secale cereale mRNA for hypothetical pr... 62 3e-07
11gb|AF202646.1|AF202646 Avena clauda clone ClG4 ribulose-1,5-bisp... 62 3e-07
12gb|AF202645.1|AF202645 Avena clauda clone ClG2 ribulose-1,5-bisp... 62 3e-07
13gb|AF200303.1|AF200303 Avena clauda ribulose-1,5-bisphosphate ca... 62 3e-07
14gb|AF192780.1|AF192780 Avena maroccana clone Ma7 ribulose-1,5-bi... 62 3e-07
15gb|AF192776.1|AF192776 Avena clauda clone Cl5 ribulose-1,5-bisph... 62 3e-07
16gb|AF192773.1|AF192773 Avena agadiriana ribulose-1,5-bisphosphat... 62 3e-07
17gb|AF104250.1|AF104250 Avena maroccana ribulose-1,5-bisphosphate... 62 3e-07
18gb|AF096617.1|AF096617 Avena sterilis subsp. ludoviciana ribulos... 62 3e-07
19gb|AF192779.1|AF192779 Avena maroccana clone Ma4 ribulose-1,5-bi... 60 1e-06
20gb|AF192775.1|AF192775 Avena strigosa clone Str5 ribulose-1,5-bi... 58 5e-06
21gb|AF192774.1|AF192774 Avena strigosa clone Str3 ribulose-1,5-bi... 58 5e-06
22gb|AF097360.1|AF097360 Avena strigosa ribulose-1,5-bisphosphate ... 58 5e-06
23dbj|AB042067.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 58 5e-06
24gb|AF202648.1|AF202648 Avena maroccana ribulose-1,5-bisphosphate... 54 8e-05
25gb|AF202647.1|AF202647 Avena agadiriana ribulose-1,5-bisphosphat... 54 8e-05
26gb|AF192777.1|AF192777 Avena clauda clone Cl9 ribulose-1,5-bisph... 54 8e-05
27gb|AF104249.1|AF104249 Avena vaviloviana ribulose-1,5-bisphospha... 54 8e-05
28gb|M37328.1|WHTRUBIAA T.aestivum ribulose-1,5-bisphosphate carbo... 54 8e-05
29dbj|AB042069.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 54 8e-05
30dbj|AB020960.1| Bromus catharticus DNA for ribulose-1,5-bisphosp... 52 3e-04
31emb|AJ635206.1| Triticum durum ssp. durum partial mRNA for putat... 50 0.001
32gb|M37477.1|WHTRUBIAB T.aestivum ribulose-1,5-bisphosphate carbo... 50 0.001
33dbj|AB020937.1| Aegilops searsii DNA for ribulose-1,5-bisphospha... 50 0.001
34dbj|AB042065.1| Triticum aestivum rbcS gene for ribulose-1,5-bis... 50 0.001
35gb|AF192778.1|AF192778 Avena sterilis subsp. ludoviciana ribulos... 46 0.020
36dbj|AB020948.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 46 0.020
37dbj|AB020941.1| Triticum aestivum DNA for ribulose-1,5-bisphosph... 46 0.020
38dbj|AB020940.1| Triticum turgidum subsp. dicoccoides DNA for rib... 46 0.020
39dbj|AB020930.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 46 0.020
40dbj|AB020929.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 46 0.020
41dbj|AB020959.1| Secale cereale DNA for ribulose-1,5-bisphosphate... 44 0.080
42dbj|AB020958.1| Triticum aestivum DNA for ribulose-1,5-bisphosph... 44 0.080
43dbj|AB020955.1| Triticum timopheevii subsp. armeniacum DNA for r... 44 0.080
44dbj|AB020954.1| Triticum urartu DNA for ribulose-1,5-bisphosphat... 44 0.080
45dbj|AB020953.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosp... 44 0.080
46dbj|AB020952.1| Aegilops searsii DNA for ribulose-1,5-bisphospha... 44 0.080
47dbj|AB020951.1| Aegilops bicornis DNA for ribulose-1,5-bisphosph... 44 0.080
48dbj|AB020950.1| Aegilops sharonensis DNA for ribulose-1,5-bispho... 44 0.080
49dbj|AB020949.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 44 0.080
50dbj|AB020946.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 44 0.080
51dbj|AB020944.1| Agropyron intermedium DNA for ribulose-1,5-bisph... 44 0.080
52dbj|AB020943.1| Hordeum vulgare DNA for ribulose-1,5-bisphosphat... 44 0.080
53dbj|AB020939.1| Triticum timopheevii subsp. armeniacum DNA for r... 44 0.080
54dbj|AB020936.1| Aegilops bicornis DNA for ribulose-1,5-bisphosph... 44 0.080
55dbj|AB020935.1| Aegilops sharonensis DNA for ribulose-1,5-bispho... 44 0.080
56dbj|AB020934.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 44 0.080
57dbj|AB020933.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 44 0.080
58dbj|AB020932.1| Aegilops longissima DNA for ribulose-1,5-bisphos... 44 0.080
59dbj|AB020931.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 44 0.080
60dbj|AB020928.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 44 0.080
61dbj|AB020957.1| Triticum aestivum DNA for ribulose-1,5-bisphosph... 42 0.32
62dbj|AB020956.1| Triticum turgidum subsp. dicoccoides DNA for rib... 42 0.32
63dbj|AB020942.1| Secale cereale DNA for ribulose-1,5-bisphosphate... 42 0.32
64dbj|AB020938.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosp... 42 0.32
65gb|AC125604.5| Homo sapiens 3 BAC RP11-473P24 (Roswell Park Canc... 38 4.9
66dbj|AB020927.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 38 4.9
67dbj|AB020926.1| Aegilops speltoides DNA for ribulose-1,5-bisphos... 38 4.9 
>gb|U43493.1|HVU43493 Hordeum vulgare ribulose-1,5-bisphosphate carboxylase small subunit
           mRNA, complete cds
          Length = 816

 Score =  113 bits (57), Expect = 1e-22
 Identities = 77/86 (89%)
 Strand = Plus / Minus

                                                                       
Query: 21  tgagctgtttatgccttgccnnactcctagcagcctngtgncttgaangcgntcaagctn 80
           ||||||||||||||||||||  |||||| ||||||| ||| |||||| ||| | ||||| 
Sbjct: 556 tgagctgtttatgccttgcccgactcctggcagcctggtggcttgaaagcgatgaagctg 497

                                     
Query: 81  acgcactgcacctgacgcatgttgtc 106
           ||||||||||||||||||||||||||
Sbjct: 496 acgcactgcacctgacgcatgttgtc 471
to top
>emb|X00235.1|TARUB2 Wheat mRNA fragment for small subunit precursor of RuBPCase (EC
           4.1.1.39 ribulosebisphosphate carboxylase) clones 234
           and 406
          Length = 743

 Score = 97.6 bits (49), Expect = 6e-18
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                       
Query: 21  tgagctgtttatgccttgccnnactcctagcagcctngtgncttgaangcgntcaagctn 80
           ||||||||||| ||||||||  |||||| ||||||  ||| |||||| ||| | ||||| 
Sbjct: 501 tgagctgtttaggccttgccggactcctcgcagcccggtggcttgaaggcgatgaagctg 442

                                     
Query: 81  acgcactgcacctgacgcatgttgtc 106
           ||||||||||||||||||||||||||
Sbjct: 441 acgcactgcacctgacgcatgttgtc 416
to top
>emb|AJ131738.1|SCE131738 Secale cereale mRNA for hypothetical protein, clone 9
          Length = 875

 Score = 97.6 bits (49), Expect = 6e-18
 Identities = 75/86 (87%)
 Strand = Plus / Minus

                                                                       
Query: 21  tgagctgtttatgccttgccnnactcctagcagcctngtgncttgaangcgntcaagctn 80
           ||||||||||||||||||||  |||||| ||||||  ||| |||||| ||| | ||||| 
Sbjct: 622 tgagctgtttatgccttgccggactcctcgcagcccggtggcttgaaggcgatgaagctg 563

                                     
Query: 81  acgcactgcacctgacgcatgttgtc 106
           |||||||||||||| |||||||||||
Sbjct: 562 acgcactgcacctggcgcatgttgtc 537
to top
>emb|X00234.1|TARUB1 Wheat mRNA fragment for small subunit precursor of RuBPCase (EC
           4.1.1.39) (ribulosebisphosphate carboxylase, clone 512)
          Length = 611

 Score = 81.8 bits (41), Expect = 4e-13
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 21  tgagctgtttatgccttgccnnactcctagcagcctngtgncttgaangcgntcaagctn 80
           ||||||||||| ||||||||  |||||| ||||||  ||| |||||| ||  | ||||| 
Sbjct: 350 tgagctgtttaggccttgccggactcctcgcagcccggtggcttgaaggcaatgaagctg 291

                                     
Query: 81  acgcactgcacctgacgcatgttgtc 106
           |||||||||||||| |||||||||||
Sbjct: 290 acgcactgcacctggcgcatgttgtc 265
to top
>emb|X83095.1|ASRBCSSS A.squarrosa mRNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase, small subunit
          Length = 837

 Score = 81.8 bits (41), Expect = 4e-13
 Identities = 73/86 (84%)
 Strand = Plus / Minus

                                                                       
Query: 21  tgagctgtttatgccttgccnnactcctagcagcctngtgncttgaangcgntcaagctn 80
           ||||||||||| ||||||||  |||||| ||||||  ||| |||| | ||| | ||||| 
Sbjct: 582 tgagctgtttaggccttgccggactcctcgcagcccggtggcttggaggcgatgaagctg 523

                                     
Query: 81  acgcactgcacctgacgcatgttgtc 106
           ||| ||||||||||||||||||||||
Sbjct: 522 acggactgcacctgacgcatgttgtc 497
to top
>dbj|AB042066.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p9-1
          Length = 739

 Score = 81.8 bits (41), Expect = 4e-13
 Identities = 64/74 (86%)
 Strand = Plus / Minus

                                                                       
Query: 33  gccttgccnnactcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacc 92
           ||||||||  |||||| ||||||  ||| |||||| ||| | ||||| ||||||||||||
Sbjct: 735 gccttgccggactcctcgcagcccggtggcttgaaggcgatgaagctgacgcactgcacc 676

                         
Query: 93  tgacgcatgttgtc 106
           ||||||||||||||
Sbjct: 675 tgacgcatgttgtc 662
to top
>gb|K02324.1|WHTRBCC Wheat (T. aestivum) chloroplast ribulosebisphosphate carboxylase
          small subunit mRNA, clone pTS406, 3' end
          Length = 317

 Score = 75.8 bits (38), Expect = 2e-11
 Identities = 64/75 (85%)
 Strand = Plus / Minus

                                                                      
Query: 21 tgagctgtttatgccttgccnnactcctagcagcctngtgncttgaangcgntcaagctn 80
          ||||||||||| ||||||||  |||||| ||||||  ||| |||||| ||| | ||||| 
Sbjct: 75 tgagctgtttaggccttgccggactcctcgcagcccggtggcttgaaggcgatgaagctg 16

                         
Query: 81 acgcactgcacctga 95
          |||||||||||||||
Sbjct: 15 acgcactgcacctga 1
to top
>dbj|AB042064.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p2-1
          Length = 653

 Score = 73.8 bits (37), Expect = 9e-11
 Identities = 63/74 (85%)
 Strand = Plus / Minus

                                                                       
Query: 33  gccttgccnnactcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacc 92
           ||||||||  |||||| ||||||  ||| |||||| ||| | ||||| ||||||||||||
Sbjct: 649 gccttgccggactcctcgcagcccggtggcttgaaggcgatgaagctgacgcactgcacc 590

                         
Query: 93  tgacgcatgttgtc 106
           || |||||||||||
Sbjct: 589 tggcgcatgttgtc 576
to top
>dbj|AB020945.1| Avena sativa DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Ave-A
          Length = 590

 Score = 69.9 bits (35), Expect = 1e-09
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||| ||| |||||| ||| | ||||| ||||||||||||||||| ||||||
Sbjct: 590 tcctcgcagcctggtggcttgaaggcgatgaagctgacgcactgcacctgacggatgttg 531

             
Query: 105 tc 106
           ||
Sbjct: 530 tc 529
to top
>emb|AJ131737.1|SCE131737 Secale cereale mRNA for hypothetical protein, clone 5
          Length = 845

 Score = 61.9 bits (31), Expect = 3e-07
 Identities = 65/79 (82%)
 Strand = Plus / Minus

                                                                       
Query: 28  tttatgccttgccnnactcctagcagcctngtgncttgaangcgntcaagctnacgcact 87
           |||||||||||||  | |||| ||||| | ||| | |||| ||  | ||||| |||||||
Sbjct: 596 tttatgccttgccggattcctcgcagcntggtggcctgaaggcaatgaagctgacgcact 537

                              
Query: 88  gcacctgacgcatgttgtc 106
           ||||||| |||||||||||
Sbjct: 536 gcacctggcgcatgttgtc 518
to top
>gb|AF202646.1|AF202646 Avena clauda clone ClG4 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) gene, partial cds
          Length = 586

 Score = 61.9 bits (31), Expect = 3e-07
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||| ||| |||||| ||| | ||||| ||||||||||| ||||| ||||||
Sbjct: 579 tcctcgcagcctggtggcttgaaggcgatgaagctgacgcactgcacttgacggatgttg 520

             
Query: 105 tc 106
           ||
Sbjct: 519 tc 518
to top
>gb|AF202645.1|AF202645 Avena clauda clone ClG2 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) gene, partial cds
          Length = 600

 Score = 61.9 bits (31), Expect = 3e-07
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||| ||| |||||| ||| | ||||| ||||||||||| ||||| ||||||
Sbjct: 593 tcctcgcagcctggtggcttgaaggcgatgaagctgacgcactgcacttgacggatgttg 534

             
Query: 105 tc 106
           ||
Sbjct: 533 tc 532
to top
>gb|AF200303.1|AF200303 Avena clauda ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) gene, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 594

 Score = 61.9 bits (31), Expect = 3e-07
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||| ||| |||||| ||| | ||||| ||||||||||| ||||| ||||||
Sbjct: 587 tcctcgcagcctggtggcttgaaggcgatgaagctgacgcactgcacttgacggatgttg 528

             
Query: 105 tc 106
           ||
Sbjct: 527 tc 526
to top
>gb|AF192780.1|AF192780 Avena maroccana clone Ma7 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score = 61.9 bits (31), Expect = 3e-07
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||| ||| |||||| ||| | ||||| ||||||||||| ||||| ||||||
Sbjct: 497 tcctcgcagcctggtggcttgaatgcgatgaagctgacgcactgcacttgacggatgttg 438

             
Query: 105 tc 106
           ||
Sbjct: 437 tc 436
to top
>gb|AF192776.1|AF192776 Avena clauda clone Cl5 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 61.9 bits (31), Expect = 3e-07
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||  ||| |||||| ||| | ||||| ||||||||||||||||| ||||||
Sbjct: 497 tcctcgcagcccggtggcttgaaggcgatgaagctgacgcactgcacctgacggatgttg 438

             
Query: 105 tc 106
           ||
Sbjct: 437 tc 436
to top
>gb|AF192773.1|AF192773 Avena agadiriana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 61.9 bits (31), Expect = 3e-07
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||| ||| |||||| ||| | ||||| || |||||||||||||| ||||||
Sbjct: 497 tcctcgcagcctggtggcttgaaggcgatgaagctgacacactgcacctgacggatgttg 438

             
Query: 105 tc 106
           ||
Sbjct: 437 tc 436
to top
>gb|AF104250.1|AF104250 Avena maroccana ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) mRNA, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 504

 Score = 61.9 bits (31), Expect = 3e-07
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||| ||| |||||| ||| | ||||| ||||||||||| ||||| ||||||
Sbjct: 497 tcctcgcagcctggtggcttgaatgcgatgaagctgacgcactgcacttgacggatgttg 438

             
Query: 105 tc 106
           ||
Sbjct: 437 tc 436
to top
>gb|AF096617.1|AF096617 Avena sterilis subsp. ludoviciana ribulose-1,5-bisphosphate
           carboxylase small subunit (rbcS) mRNA, partial cds
          Length = 504

 Score = 61.9 bits (31), Expect = 3e-07
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||  ||| |||||| ||| | ||||| ||||||||||||||||| ||||||
Sbjct: 497 tcctcgcagcccggtggcttgaaggcgatgaagctgacgcactgcacctgacggatgttg 438

             
Query: 105 tc 106
           ||
Sbjct: 437 tc 436
to top
>gb|AF192779.1|AF192779 Avena maroccana clone Ma4 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score = 60.0 bits (30), Expect = 1e-06
 Identities = 49/57 (85%)
 Strand = Plus / Minus

                                                                    
Query: 50  gcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           ||||||  ||| |||||| ||| | ||||| ||||||||||||||||| ||||||||
Sbjct: 492 gcagcccggtggcttgaaggcgatgaagctgacgcactgcacctgacggatgttgtc 436
to top
>gb|AF192775.1|AF192775 Avena strigosa clone Str5 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score = 58.0 bits (29), Expect = 5e-06
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||  ||| |||||| ||| | ||||| ||||||||||||||||| ||||||
Sbjct: 497 tcctcgcagcccggtggcttgaaggcgatgaagctgacgcactgcacctgacggatgttg 438
to top
>gb|AF192774.1|AF192774 Avena strigosa clone Str3 ribulose-1,5-bisphosphate carboxylase
           small subunit (rbcS) mRNA, nuclear gene encoding
           chloroplast protein, partial cds
          Length = 504

 Score = 58.0 bits (29), Expect = 5e-06
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||  ||| |||||| ||| | ||||| ||||||||||||||||| ||||||
Sbjct: 497 tcctcgcagcccggtggcttgaaggcgatgaagctgacgcactgcacctgacggatgttg 438
to top
>gb|AF097360.1|AF097360 Avena strigosa ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) mRNA, nuclear gene encoding chloroplast protein,
           partial cds
          Length = 504

 Score = 58.0 bits (29), Expect = 5e-06
 Identities = 51/60 (85%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||  ||| |||||| ||| | ||||| ||||||||||||||||| ||||||
Sbjct: 497 tcctcgcagcccggtggcttgaaggcgatgaagctgacgcactgcacctgacggatgttg 438
to top
>dbj|AB042067.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, complete cds,
           clone:p10-1
          Length = 629

 Score = 58.0 bits (29), Expect = 5e-06
 Identities = 61/74 (82%)
 Strand = Plus / Minus

                                                                       
Query: 33  gccttgccnnactcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacc 92
           ||||||||  |||||| ||| ||| ||| | |||| ||| | ||||| ||||||||||||
Sbjct: 625 gccttgccggactcctcgcaacctggtggcctgaaggcgatgaagctgacgcactgcacc 566

                         
Query: 93  tgacgcatgttgtc 106
           || |||| ||||||
Sbjct: 565 tggcgcaggttgtc 552
to top
>gb|AF202648.1|AF202648 Avena maroccana ribulose-1,5-bisphosphate carboxylase small subunit
           (rbcS) gene, partial cds
          Length = 620

 Score = 54.0 bits (27), Expect = 8e-05
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||  ||| |||||| ||| | ||||| ||||||||||| ||||| ||||||
Sbjct: 613 tcctcgcagcccggtggcttgaatgcgatgaagctgacgcactgcacttgacggatgttg 554

             
Query: 105 tc 106
           ||
Sbjct: 553 tc 552
to top
>gb|AF202647.1|AF202647 Avena agadiriana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) gene, partial cds
          Length = 593

 Score = 54.0 bits (27), Expect = 8e-05
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||| ||| |||||| ||| | ||||| ||||||||||| || || ||||||
Sbjct: 586 tcctcgcagcctggtggcttgaatgcgatgaagctgacgcactgcacttggcggatgttg 527

             
Query: 105 tc 106
           ||
Sbjct: 526 tc 525
to top
>gb|AF192777.1|AF192777 Avena clauda clone Cl9 ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 54.0 bits (27), Expect = 8e-05
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||  ||| |||||| ||| | ||||| ||||||||||| ||||| ||||||
Sbjct: 497 tcctcgcagcccggtggcttgaaggcgatgaagctgacgcactgcacttgacggatgttg 438

             
Query: 105 tc 106
           ||
Sbjct: 437 tc 436
to top
>gb|AF104249.1|AF104249 Avena vaviloviana ribulose-1,5-bisphosphate carboxylase small
           subunit (rbcS) mRNA, nuclear gene encoding chloroplast
           protein, partial cds
          Length = 504

 Score = 54.0 bits (27), Expect = 8e-05
 Identities = 52/62 (83%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||  ||| |||||| ||| | ||||| ||||||||||| ||||| ||||||
Sbjct: 497 tcctcgcagcccggtggcttgaaggcgatgaagctgacgcactgcacttgacggatgttg 438

             
Query: 105 tc 106
           ||
Sbjct: 437 tc 436
to top
>gb|M37328.1|WHTRUBIAA T.aestivum ribulose-1,5-bisphosphate carboxylase/oxygenase (RUBISCO)
            gene, exons 1 and 2
          Length = 2205

 Score = 54.0 bits (27), Expect = 8e-05
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                        
Query: 27   gtttatgccttgccnnactcctagcagcctngtgncttgaangcgntcaagctnacgcac 86
            ||||| ||||||||  |||||| ||| ||  ||| | |||| ||| | ||||| ||||||
Sbjct: 1511 gtttaggccttgccggactcctcgcaacccggtggcctgaaggcgatgaagctgacgcac 1452

                                
Query: 87   tgcacctgacgcatgttgtc 106
            |||||||| |||| ||||||
Sbjct: 1451 tgcacctggcgcaggttgtc 1432
to top
>dbj|AB042069.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
            carboxylase/oxygenase small subunit, complete cds,
            clone:6, subclone:16
          Length = 5980

 Score = 54.0 bits (27), Expect = 8e-05
 Identities = 65/80 (81%)
 Strand = Plus / Minus

                                                                        
Query: 27   gtttatgccttgccnnactcctagcagcctngtgncttgaangcgntcaagctnacgcac 86
            ||||| ||||||||  |||||| ||| ||  ||| | |||| ||| | ||||| ||||||
Sbjct: 1265 gtttaggccttgccagactcctcgcaacccggtggcctgaatgcgatgaagctgacgcac 1206

                                
Query: 87   tgcacctgacgcatgttgtc 106
            |||||||| |||| ||||||
Sbjct: 1205 tgcacctggcgcaggttgtc 1186
to top
>dbj|AB020960.1| Bromus catharticus DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Bro-B
          Length = 784

 Score = 52.0 bits (26), Expect = 3e-04
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 58  gtgncttgaangcgntcaagctnacgcactgcacctgacgca 99
           ||| |||||| ||| | ||||| |||||||||||||||||||
Sbjct: 771 gtggcttgaaggcgatgaagctgacgcactgcacctgacgca 730
to top
>emb|AJ635206.1| Triticum durum ssp. durum partial mRNA for putative rubisco small
           subunit (rbcS gene)
          Length = 518

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 60/74 (81%)
 Strand = Plus / Minus

                                                                       
Query: 33  gccttgccnnactcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacc 92
           ||||||||  |||||| ||| ||  ||| | |||| ||| | ||||| ||||||||||||
Sbjct: 514 gccttgccggactcctcgcaacccggtggcctgaaggcgatgaagctgacgcactgcacc 455

                         
Query: 93  tgacgcatgttgtc 106
           || |||| ||||||
Sbjct: 454 tggcgcaggttgtc 441
to top
>gb|M37477.1|WHTRUBIAB T.aestivum ribulose-1,5-bisphosphate carboxylase/oxygenase
           (RUBISCO) gene, complete cds
          Length = 779

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 60/74 (81%)
 Strand = Plus / Minus

                                                                       
Query: 33  gccttgccnnactcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacc 92
           ||||||||  | |||| ||||||| ||| | |||| ||  | ||||| ||||| ||||||
Sbjct: 581 gccttgccggattcctcgcagcctggtggcctgaaggcaatgaagctgacgcattgcacc 522

                         
Query: 93  tgacgcatgttgtc 106
           || |||||||||||
Sbjct: 521 tggcgcatgttgtc 508
to top
>dbj|AB020937.1| Aegilops searsii DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sea-A
          Length = 611

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 75  aagctnacgcactgcacctgacgcatgttgtc 106
           ||||| ||||||||||||||||||| ||||||
Sbjct: 581 aagctgacgcactgcacctgacgcaggttgtc 550
to top
>dbj|AB042065.1| Triticum aestivum rbcS gene for ribulose-1,5-bisphosphate
           carboxylase/oxygenase Small subunit, complete cds,
           clone:p6-1
          Length = 638

 Score = 50.1 bits (25), Expect = 0.001
 Identities = 60/74 (81%)
 Strand = Plus / Minus

                                                                       
Query: 33  gccttgccnnactcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacc 92
           ||||||||  |||||| ||| ||  ||| | |||| ||| | ||||| ||||||||||||
Sbjct: 634 gccttgccggactcctcgcaacccggtggcctgaatgcgatgaagctgacgcactgcacc 575

                         
Query: 93  tgacgcatgttgtc 106
           || |||| ||||||
Sbjct: 574 tggcgcaggttgtc 561
to top
>gb|AF192778.1|AF192778 Avena sterilis subsp. ludoviciana ribulose-1,5-bisphosphate
           carboxylase small subunit (rbcS) mRNA, nuclear gene
           encoding chloroplast protein, partial cds
          Length = 504

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 51/62 (82%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||||||  ||| |||||| ||| | || || ||||||||||| ||||| ||||||
Sbjct: 497 tcctcgcagcccggtggcttgaaggcgatgaaactgacgcactgcacttgacggatgttg 438

             
Query: 105 tc 106
           ||
Sbjct: 437 tc 436
to top
>dbj|AB020948.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-B
          Length = 772

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 51/62 (82%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||| ||| ||| | |||| ||| | ||||| |||||||||||||| |||| ||||
Sbjct: 772 tcctcgcaacctggtggcctgaaggcgatgaagctgacgcactgcacctggcgcaggttg 713

             
Query: 105 tc 106
           ||
Sbjct: 712 tc 711
to top
>dbj|AB020941.1| Triticum aestivum DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           CS-A
          Length = 605

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 51/62 (82%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||| ||| ||| | |||| ||| | ||||| |||||||||||||| |||| ||||
Sbjct: 605 tcctcgcaacctggtggcctgaaggcgatgaagctgacgcactgcacctggcgcaggttg 546

             
Query: 105 tc 106
           ||
Sbjct: 545 tc 544
to top
>dbj|AB020940.1| Triticum turgidum subsp. dicoccoides DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Dic-A
          Length = 605

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 51/62 (82%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||| ||| ||| | |||| ||| | ||||| |||||||||||||| |||| ||||
Sbjct: 605 tcctcgcaacctggtggcctgaaggcgatgaagctgacgcactgcacctggcgcaggttg 546

             
Query: 105 tc 106
           ||
Sbjct: 545 tc 544
to top
>dbj|AB020930.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-A2
          Length = 604

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 51/62 (82%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||| ||| ||| | |||| ||| | ||||| |||||||||||||| |||| ||||
Sbjct: 604 tcctcgcaacctggtggcctgaaggcgatgaagctgacgcactgcacctggcgcaggttg 545

             
Query: 105 tc 106
           ||
Sbjct: 544 tc 543
to top
>dbj|AB020929.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-A1
          Length = 604

 Score = 46.1 bits (23), Expect = 0.020
 Identities = 51/62 (82%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||| ||| ||| | |||| ||| | ||||| |||||||||||||| |||| ||||
Sbjct: 604 tcctcgcaacctggtggcctgaaggcgatgaagctgacgcactgcacctggcgcaggttg 545

             
Query: 105 tc 106
           ||
Sbjct: 544 tc 543
to top
>dbj|AB020959.1| Secale cereale DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sec-B
          Length = 789

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 770 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 728
to top
>dbj|AB020958.1| Triticum aestivum DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           CS-B2
          Length = 781

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 762 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 720
to top
>dbj|AB020955.1| Triticum timopheevii subsp. armeniacum DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Ara-B
          Length = 787

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 768 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 726
to top
>dbj|AB020954.1| Triticum urartu DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Ura-B
          Length = 787

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 768 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 726
to top
>dbj|AB020953.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Squ-B
          Length = 781

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 762 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 720
to top
>dbj|AB020952.1| Aegilops searsii DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sea-B
          Length = 728

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 709 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 667
to top
>dbj|AB020951.1| Aegilops bicornis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Bic-B
          Length = 783

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 769 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 727
to top
>dbj|AB020950.1| Aegilops sharonensis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sha-B
          Length = 792

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 773 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 731
to top
>dbj|AB020949.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-B
          Length = 792

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 773 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 731
to top
>dbj|AB020946.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe1-B
          Length = 787

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 768 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 726
to top
>dbj|AB020944.1| Agropyron intermedium DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Agr-A
          Length = 604

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 585 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 543
to top
>dbj|AB020943.1| Hordeum vulgare DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Hor-A
          Length = 605

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 586 tgaaggcgatgaagctgacgcactgcacctgccgcaggttgtc 544
to top
>dbj|AB020939.1| Triticum timopheevii subsp. armeniacum DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Ara-A
          Length = 604

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 585 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 543
to top
>dbj|AB020936.1| Aegilops bicornis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Bic-A
          Length = 605

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 586 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 544
to top
>dbj|AB020935.1| Aegilops sharonensis DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sha-A
          Length = 605

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 586 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 544
to top
>dbj|AB020934.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A3
          Length = 605

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 586 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 544
to top
>dbj|AB020933.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A2
          Length = 605

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 586 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 544
to top
>dbj|AB020932.1| Aegilops longissima DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Lon-A1
          Length = 605

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 586 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 544
to top
>dbj|AB020931.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe3-A3
          Length = 604

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 585 tgaaggcgatgaagctgacgcactgcacctggcgcaggttgtc 543
to top
>dbj|AB020928.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe2-A
          Length = 604

 Score = 44.1 bits (22), Expect = 0.080
 Identities = 37/43 (86%)
 Strand = Plus / Minus

                                                      
Query: 64  tgaangcgntcaagctnacgcactgcacctgacgcatgttgtc 106
           |||| ||| | ||||| |||||||||||||| |||| ||||||
Sbjct: 585 tgaaggcgctgaagctgacgcactgcacctggcgcaggttgtc 543
to top
>dbj|AB020957.1| Triticum aestivum DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           CS-B1
          Length = 787

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 75  aagctnacgcactgcacctgacgcatgttgtc 106
           ||||| |||||||||||||| |||| ||||||
Sbjct: 757 aagctgacgcactgcacctggcgcaggttgtc 726
to top
>dbj|AB020956.1| Triticum turgidum subsp. dicoccoides DNA for
           ribulose-1,5-bisphosphate carboxylase/oxygenase small
           subunit, partial cds, clone Dic-B
          Length = 787

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 75  aagctnacgcactgcacctgacgcatgttgtc 106
           ||||| |||||||||||||| |||| ||||||
Sbjct: 757 aagctgacgcactgcacctggcgcaggttgtc 726
to top
>dbj|AB020942.1| Secale cereale DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Sec-A
          Length = 591

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 75  aagctnacgcactgcacctgacgcatgttgtc 106
           ||||| |||||||||||||| |||| ||||||
Sbjct: 561 aagctgacgcactgcacctggcgcaggttgtc 530
to top
>dbj|AB020938.1| Aegilops squarrosa DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Squ-A
          Length = 607

 Score = 42.1 bits (21), Expect = 0.32
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 75  aagctnacgcactgcacctgacgcatgttgtc 106
           ||||| |||||||||||||| |||| ||||||
Sbjct: 577 aagctgacgcactgcacctggcgcaggttgtc 546
to top
>gb|AC125604.5| Homo sapiens 3 BAC RP11-473P24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 61826

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 22    gagctgtttatgccttgcc 40
             |||||||||||||||||||
Sbjct: 17057 gagctgtttatgccttgcc 17075
to top
>dbj|AB020927.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds, clone
           Spe1-A1
          Length = 604

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 50/62 (80%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||| ||| ||| | |||| ||| | || || |||||||||||||| |||| ||||
Sbjct: 604 tcctcgcaacctggtggcctgaaggcgatgaaactgacgcactgcacctggcgcaggttg 545

             
Query: 105 tc 106
           ||
Sbjct: 544 tc 543
to top
>dbj|AB020926.1| Aegilops speltoides DNA for ribulose-1,5-bisphosphate
           carboxylase/oxygenase small subunit, partial cds
          Length = 604

 Score = 38.2 bits (19), Expect = 4.9
 Identities = 50/62 (80%)
 Strand = Plus / Minus

                                                                       
Query: 45  tcctagcagcctngtgncttgaangcgntcaagctnacgcactgcacctgacgcatgttg 104
           |||| ||| ||| ||| | |||| ||| | || || |||||||||||||| |||| ||||
Sbjct: 604 tcctcgcaacctggtggcctgaaggcgatgaaactgacgcactgcacctggcgcaggttg 545

             
Query: 105 tc 106
           ||
Sbjct: 544 tc 543


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 231,674
Number of Sequences: 3902068
Number of extensions: 231674
Number of successful extensions: 11896
Number of sequences better than 10.0: 67
Number of HSP's better than 10.0 without gapping: 67
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 11829
Number of HSP's gapped (non-prelim): 67
length of query: 109
length of database: 17,233,045,268
effective HSP length: 21
effective length of query: 88
effective length of database: 17,151,101,840
effective search space: 1509296961920
effective search space used: 1509296961920
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top