ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd27g16
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC007066.4|AC007066 Homo sapiens chromosome 9, clone hRPK.355... 46 0.16
2gb|AC161597.7| Mus musculus BAC clone RP23-387P23 from chromosom... 44 0.63
3gb|AY446355.1| Cicer arietinum microsatellite G2 25902 sequence 44 0.63
4gb|AY446344.1| Cicer arietinum microsatellite E10 18902 sequence 44 0.63
5gb|AC121565.4| Mus musculus BAC clone RP23-223J11 from chromosom... 44 0.63
6emb|AL928737.8| Mouse DNA sequence from clone RP23-382O14 on chr... 44 0.63
7emb|CT010162.2| Pan troglodytes chromosome X BAC RP43-009H04, co... 42 2.5
8gb|AC122423.2| Mus musculus BAC clone RP24-171N18 from 7, comple... 42 2.5
9gb|AC164158.3| Mus musculus BAC clone RP24-263G24 from chromosom... 42 2.5
10emb|AL135798.5| Human DNA sequence from clone RP4-655N15 on chro... 42 2.5
11emb|AL009174.1|HS417G15 Human DNA sequence from clone RP3-417G15... 42 2.5
12gb|AC093026.3| Homo sapiens 12 BAC RP11-307E8 (Roswell Park Canc... 42 2.5
13dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023 42 2.5
14gb|AC103794.2| Homo sapiens chromosome 11, clone CTD-3096P4, com... 42 2.5
15gb|AC078957.16| Homo sapiens Xp BAC RP11-339E16 (Roswell Park Ca... 42 2.5
16dbj|AP003082.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 42 2.5
17emb|CT010408.3| Pan troglodytes chromosome X BAC RP43-014H14, co... 42 2.5
18emb|CT025556.12| Mouse DNA sequence from clone RP24-91G8 on chro... 42 2.5
19gb|AC166316.2| Mus musculus chromosome 19, clone RP23-466L5, com... 40 9.8
20gb|AY587911.1| Cercophora areolata strain UAMH7495 18S ribosomal... 40 9.8
21gb|AF136642.1| Nuphar lutea GA/GT dinucleotide repeat microsatel... 40 9.8
22gb|AC134605.5| Mus musculus BAC clone RP23-42E17 from chromosome... 40 9.8
23gb|AC148004.3| Mus musculus BAC clone RP23-352J18 from chromosom... 40 9.8
24ref|XM_598374.2| PREDICTED: Bos taurus similar to contactin asso... 40 9.8
25gb|AY394667.1| Uncultured ascomycete clone K11-5 internal transc... 40 9.8
26gb|AY268204.1| Epacris microphylla root associated fungus 20 18S... 40 9.8
27gb|AY230786.1| Woollsia root associated fungus XVI 18S ribosomal... 40 9.8
28gb|AC139334.3| Mus musculus BAC clone RP23-449C21 from chromosom... 40 9.8
29gb|AC126277.3| Mus musculus BAC clone RP23-161L22 from 12, compl... 40 9.8
30gb|AC117194.3| Mus musculus BAC clone RP23-92K11 from 12, comple... 40 9.8
31gb|AC113204.7| Mus musculus chromosome 12, clone RP23-312J1, com... 40 9.8
32gb|AY138486.1| Acremonium strictum genogroup IV internal transcr... 40 9.8
33emb|AL590031.6| Human DNA sequence from clone RP11-285F11 on chr... 40 9.8
34emb|AL353707.14| Human DNA sequence from clone RP11-553J6 on chr... 40 9.8
35emb|AL136112.10| Human DNA sequence from clone RP5-1126E12 on ch... 40 9.8
36gb|AC115088.6| Homo sapiens chromosome 11, clone RP11-792G9, com... 40 9.8
37emb|AJ608986.1| Fungal sp. GFI 3 5.8S rRNA gene, 28S rRNA gene (... 40 9.8
38gb|AC114322.2| Homo sapiens chromosome 5 clone RP11-74D3, comple... 40 9.8
39gb|DQ420780.1| Uncultured soil fungus clone 174-2 18S ribosomal ... 40 9.8
40gb|AC074274.15| Homo sapiens 3 BAC RP11-325B23 (Roswell Park Can... 40 9.8
41gb|AC108694.2| Homo sapiens 3q BAC RP11-764C7 (Roswell Park Canc... 40 9.8
42gb|AC117424.6| Homo sapiens 3 BAC RP11-172I10 (Roswell Park Canc... 40 9.8
43gb|AF486637.1| Podospora curvicolla 18S ribosomal RNA gene, part... 40 9.8
44gb|AF443852.1|AF443852 Podospora setosa 18S ribosomal RNA gene, ... 40 9.8
45gb|AF443849.1|AF443849 Podospora comata 18S ribosomal RNA gene, ... 40 9.8
46gb|AF443848.1|AF443848 Podospora bicolor 18S ribosomal RNA gene,... 40 9.8
47gb|AF399011.1| Pseudomonas phage phiKZ, complete genome 40 9.8
48gb|AC099514.2| Homo sapiens chromosome 5 clone RP11-454E7, compl... 40 9.8
49gb|AY681200.1| Apodus oryzae 18S ribosomal RNA gene, partial seq... 40 9.8
50gb|AC121223.5| Rattus norvegicus BAC CH230-70M4 (Children's Hos... 40 9.8
51gb|AC159982.4| Mus musculus chromosome 19, clone RP24-383P9, com... 40 9.8
52gb|AY999131.1| Zopfiella longicaudata strain IFO 30296 18S ribos... 40 9.8
53gb|AY999130.1| Zopfiella tetraspora strain IFO 32904 18S ribosom... 40 9.8
54gb|AY999129.1| Zopfiella latipes strain IFO 9826 18S ribosomal R... 40 9.8
55gb|AY999123.1| Podospora cochleariformis strain CBS 249.71 18S r... 40 9.8
56gb|AF393809.1|AF393809 Apium graveolens sucrose synthase-like pr... 40 9.8
57gb|AY627829.1| Epacris pulchella root associated fungus EP26 18S... 40 9.8
58gb|AC016661.7|AC016661 Arabidopsis thaliana chromosome 3 BAC F11... 40 9.8
59gb|AC073218.6| Homo sapiens BAC clone RP11-529E15 from 2, comple... 40 9.8
60gb|AC074097.6| Homo sapiens BAC clone RP11-333M19 from 2, comple... 40 9.8
61gb|AC092967.5| Homo sapiens 3 BAC RP11-521A24 (Roswell Park Canc... 40 9.8
62gb|AC127286.3| Mus musculus BAC clone RP23-340I4 from chromosome... 40 9.8
63gb|AC068914.7| Homo sapiens BAC clone CTD-2026C7 from 2, complet... 40 9.8
64emb|AL935305.13| Zebrafish DNA sequence from clone CH211-226I4 i... 40 9.8
65gb|DQ163920.1| Bacteriophage SD1-M, complete genome 40 9.8
66emb|BX649280.4| Mouse DNA sequence from clone RP23-302H19 on chr... 40 9.8
67gb|AY916068.1| Uncultured sordariaceous ectomycorrhiza isolate P... 40 9.8
68gb|AY428788.1| Cephalosporium maydis strain CM2A1 18S ribosomal ... 40 9.8
69gb|AY428787.1| Cephalosporium maydis strain CM3B 18S ribosomal R... 40 9.8
70gb|AY428786.1| Cephalosporium maydis strain CM884 18S ribosomal ... 40 9.8
71gb|AY428785.1| Cephalosporium maydis strain CM1A 18S ribosomal R... 40 9.8
72emb|AL359951.4|CNS05TF3 Human chromosome 14 DNA sequence BAC R-1... 40 9.8
73emb|BX539328.4| Mouse DNA sequence from clone RP23-108I21 on chr... 40 9.8
74emb|Z82261.1|CEC35D6 Caenorhabditis elegans Cosmid C35D6, comple... 40 9.8
75emb|BX640480.22| Zebrafish DNA sequence from clone DKEYP-86F2 in... 40 9.8
76gb|AC007632.4|AC007632 Homo sapiens clone R529C19B from chromoso... 40 9.8
77emb|AJ012300.1|PDI012300 Phialemonium dimorphosporum 5.8S rRNA g... 40 9.8
78emb|AJ012299.1|PDI012299 Phialemonium dimorphosporum 5.8S rRNA g... 40 9.8
79emb|AJ012298.1|PDI012298 Phialemonium dimorphosporum 5.8S rRNA g... 40 9.8
80dbj|AP003079.3| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 9.8
81gb|AY706336.1| Trichocladium asperum strain DAOM 232342 18S ribo... 40 9.8
82gb|AY706334.1| Humicola grisea var. grisea strain DAOM 232586 18... 40 9.8
83gb|AC110118.8| Rattus norvegicus BAC CH230-310N6 (Children's Ho... 40 9.8
84emb|AJ875376.1| Uncultured fungus 18S rRNA gene (partial), 5.8S ... 40 9.8
85emb|AL954813.14| Mouse DNA sequence from clone RP24-541E15 on ch... 40 9.8
86gb|AC172751.1| Mus musculus BAC clone RP23-341F9 from chromosome... 40 9.8
87gb|AC122119.11| Mus musculus chromosome 19, clone RP24-252F4, co... 40 9.8
88emb|AL627403.13| Mouse DNA sequence from clone RP23-29F4 on chro... 40 9.8
89emb|AL806517.9| Mouse DNA sequence from clone RP23-20K17 on chro... 40 9.8
90gb|U17215.1|U17215 Gaeumannomyces incrustans I3 18S, 5.8S and 26... 40 9.8
91gb|U17214.1|U17214 Gaeumannomyces incrustans I1 18S and 5.8S rRN... 40 9.8
92emb|AJ010027.1|CMA10027 Cephalosporium maydis 5.8S gene, ITS1, I... 40 9.8

>gb|AC007066.4|AC007066 Homo sapiens chromosome 9, clone hRPK.355_O_1, complete sequence
          Length = 190815

 Score = 46.1 bits (23), Expect = 0.16
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 578   tcttatttcaaatggataataat 600
             |||||||||||||||||||||||
Sbjct: 91952 tcttatttcaaatggataataat 91930



to top

>gb|AC161597.7| Mus musculus BAC clone RP23-387P23 from chromosome 6, complete sequence
          Length = 218586

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 337    ggtagcaaaatacagttgggtt 358
              ||||||||||||||||||||||
Sbjct: 173926 ggtagcaaaatacagttgggtt 173905



to top

>gb|AY446355.1| Cicer arietinum microsatellite G2 25902 sequence
          Length = 392

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 580 ttatttcaaatggataataatt 601
           ||||||||||||||||||||||
Sbjct: 164 ttatttcaaatggataataatt 143



to top

>gb|AY446344.1| Cicer arietinum microsatellite E10 18902 sequence
          Length = 390

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                 
Query: 580 ttatttcaaatggataataatt 601
           ||||||||||||||||||||||
Sbjct: 178 ttatttcaaatggataataatt 157



to top

>gb|AC121565.4| Mus musculus BAC clone RP23-223J11 from chromosome 6, complete sequence
          Length = 170000

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 337    ggtagcaaaatacagttgggtt 358
              ||||||||||||||||||||||
Sbjct: 148593 ggtagcaaaatacagttgggtt 148614



to top

>emb|AL928737.8| Mouse DNA sequence from clone RP23-382O14 on chromosome 2, complete
              sequence
          Length = 237175

 Score = 44.1 bits (22), Expect = 0.63
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 8      tattctttgataaatgtctatt 29
              ||||||||||||||||||||||
Sbjct: 154483 tattctttgataaatgtctatt 154462



to top

>emb|CT010162.2| Pan troglodytes chromosome X BAC RP43-009H04, complete sequence
          Length = 195301

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 446    cttcaaataaacagccattca 466
              |||||||||||||||||||||
Sbjct: 192097 cttcaaataaacagccattca 192077



to top

>gb|AC122423.2| Mus musculus BAC clone RP24-171N18 from 7, complete sequence
          Length = 141166

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 132   aaaacaaaatacccagatgtc 152
             |||||||||||||||||||||
Sbjct: 48689 aaaacaaaatacccagatgtc 48669



to top

>gb|AC164158.3| Mus musculus BAC clone RP24-263G24 from chromosome 7, complete sequence
          Length = 200983

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 132   aaaacaaaatacccagatgtc 152
             |||||||||||||||||||||
Sbjct: 32724 aaaacaaaatacccagatgtc 32704



to top

>emb|AL135798.5| Human DNA sequence from clone RP4-655N15 on chromosome 1p13.1-13.3
             Contains a neurofilament, heavy polypeptide 200kDa (NEFH)
             pseudogene, the CD2 gene for CD2 antigen (p50) sheep red
             blood cell receptor and a ferritin heavy polypeptide 1
             (FTH1) pseudogene, complete sequence
          Length = 103209

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 86    aaagaaaacagcagactgctc 106
             |||||||||||||||||||||
Sbjct: 16816 aaagaaaacagcagactgctc 16796



to top

>emb|AL009174.1|HS417G15 Human DNA sequence from clone RP3-417G15 on chromosome Xq25-26 Contains
             a ribosomal protein S24 (RPS24) pseudogene, part of the
             GPC3 gene for glypican 3 and a laminin receptor 1
             (ribosomal protein SA, 67kDa) (LAMR1) pseudogene, complete
             sequence
          Length = 124321

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 153   ctaacctttaagaaagtatca 173
             |||||||||||||||||||||
Sbjct: 48051 ctaacctttaagaaagtatca 48071



to top

>gb|AC093026.3| Homo sapiens 12 BAC RP11-307E8 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 114468

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 54     tttttaaaagaatctccttag 74
              |||||||||||||||||||||
Sbjct: 108257 tttttaaaagaatctccttag 108237



to top

>dbj|AP007157.1| Aspergillus oryzae RIB40 genomic DNA, SC023
          Length = 2661830

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 5       tcctattctttgataaatgtc 25
               |||||||||||||||||||||
Sbjct: 1000911 tcctattctttgataaatgtc 1000891



to top

>gb|AC103794.2| Homo sapiens chromosome 11, clone CTD-3096P4, complete sequence
          Length = 211445

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 305   aaggcaaccaatttagtcagc 325
             |||||||||||||||||||||
Sbjct: 23795 aaggcaaccaatttagtcagc 23815



to top

>gb|AC078957.16| Homo sapiens Xp BAC RP11-339E16 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 198088

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 446   cttcaaataaacagccattca 466
             |||||||||||||||||||||
Sbjct: 76465 cttcaaataaacagccattca 76445



to top

>dbj|AP003082.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-746C14, complete
              sequence
          Length = 189635

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 10     ttctttgataaatgtctatta 30
              |||||||||||||||||||||
Sbjct: 139874 ttctttgataaatgtctatta 139894



to top

>emb|CT010408.3| Pan troglodytes chromosome X BAC RP43-014H14, complete sequence
          Length = 172332

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 446   cttcaaataaacagccattca 466
             |||||||||||||||||||||
Sbjct: 96765 cttcaaataaacagccattca 96785



to top

>emb|CT025556.12| Mouse DNA sequence from clone RP24-91G8 on chromosome 13, complete
             sequence
          Length = 225239

 Score = 42.1 bits (21), Expect = 2.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 273   tctcattagaagacctatcta 293
             |||||||||||||||||||||
Sbjct: 85819 tctcattagaagacctatcta 85799



to top

>gb|AC166316.2| Mus musculus chromosome 19, clone RP23-466L5, complete sequence
          Length = 185237

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 262   aagagagaaaatctcattag 281
             ||||||||||||||||||||
Sbjct: 18095 aagagagaaaatctcattag 18076



to top

>gb|AY587911.1| Cercophora areolata strain UAMH7495 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 593

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 45  gatcattaaagagttgcaaa 64



to top

>gb|AF136642.1| Nuphar lutea GA/GT dinucleotide repeat microsatellite sequence
          Length = 1044

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 401 aagaacaacgtaattagcagcacg 424
           |||||| |||||||||||||||||
Sbjct: 821 aagaaccacgtaattagcagcacg 798



to top

>gb|AC134605.5| Mus musculus BAC clone RP23-42E17 from chromosome 14, complete sequence
          Length = 216097

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 481    acccacataaaagtaaagttagaa 504
              |||||||||||| |||||||||||
Sbjct: 156055 acccacataaaaataaagttagaa 156078



to top

>gb|AC148004.3| Mus musculus BAC clone RP23-352J18 from chromosome 18, complete
             sequence
          Length = 206275

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 153   ctaacctttaagaaagtatc 172
             ||||||||||||||||||||
Sbjct: 67783 ctaacctttaagaaagtatc 67764



to top

>ref|XM_598374.2| PREDICTED: Bos taurus similar to contactin associated protein-like
           5 isoform 1 (LOC520139), partial mRNA
          Length = 2342

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 76  agccctatccaaagaaaaca 95
           ||||||||||||||||||||
Sbjct: 566 agccctatccaaagaaaaca 585



to top

>gb|AY394667.1| Uncultured ascomycete clone K11-5 internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene and internal
           transcribed spacer 2, complete sequence; and 28S
           ribosomal RNA gene, partial sequence
          Length = 588

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 61  gatcattaaagagttgcaaa 80



to top

>gb|AY268204.1| Epacris microphylla root associated fungus 20 18S ribosomal RNA
           gene, partial sequence; and internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence
          Length = 517

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 4   gatcattaaagagttgcaaa 23



to top

>gb|AY230786.1| Woollsia root associated fungus XVI 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 518

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 5   gatcattaaagagttgcaaa 24



to top

>gb|AC139334.3| Mus musculus BAC clone RP23-449C21 from chromosome 18, complete
            sequence
          Length = 194665

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 153  ctaacctttaagaaagtatc 172
            ||||||||||||||||||||
Sbjct: 1029 ctaacctttaagaaagtatc 1048



to top

>gb|AC126277.3| Mus musculus BAC clone RP23-161L22 from 12, complete sequence
          Length = 191231

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 629    taaagagttgcaaatggcat 648
              ||||||||||||||||||||
Sbjct: 161786 taaagagttgcaaatggcat 161805



to top

>gb|AC117194.3| Mus musculus BAC clone RP23-92K11 from 12, complete sequence
          Length = 204913

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 252   tcctaatcttaagagagaaa 271
             ||||||||||||||||||||
Sbjct: 66779 tcctaatcttaagagagaaa 66760



to top

>gb|AC113204.7| Mus musculus chromosome 12, clone RP23-312J1, complete sequence
          Length = 207293

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 123   tctcatcagaaaacaaaata 142
             ||||||||||||||||||||
Sbjct: 97771 tctcatcagaaaacaaaata 97790



to top

>gb|AY138486.1| Acremonium strictum genogroup IV internal transcribed spacer 1,
           partial sequence; 5.8S ribosomal RNA gene, complete
           sequence; and internal transcribed spacer 2, partial
           sequence
          Length = 555

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 23  gatcattaaagagttgcaaa 42



to top

>emb|AL590031.6| Human DNA sequence from clone RP11-285F11 on chromosome X Contains the 5'
              end of the gene for a novel WD repeat domain protein,
              complete sequence
          Length = 145153

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     ttctttgataaatgtctatt 29
              ||||||||||||||||||||
Sbjct: 111558 ttctttgataaatgtctatt 111577



to top

>emb|AL353707.14| Human DNA sequence from clone RP11-553J6 on chromosome 9 Contains a
             ribosomal protein S19 (RPS19) pseudogene, complete
             sequence
          Length = 125373

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 183   ttttctaaatgaaatagttg 202
             ||||||||||||||||||||
Sbjct: 95227 ttttctaaatgaaatagttg 95208



to top

>emb|AL136112.10| Human DNA sequence from clone RP5-1126E12 on chromosome Xq22.1-22.3
             Contains a novel gene (MGC35261), the 5' end of gene
             FLJ20130 and a CpG island, complete sequence
          Length = 59847

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 183   ttttctaaatgaaatagttg 202
             ||||||||||||||||||||
Sbjct: 45940 ttttctaaatgaaatagttg 45959



to top

>gb|AC115088.6| Homo sapiens chromosome 11, clone RP11-792G9, complete sequence
          Length = 200274

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 146    agatgtcctaacctttaagaaagtatca 173
              ||||||| | ||||||||||||||||||
Sbjct: 129031 agatgtctttacctttaagaaagtatca 129004



to top

>emb|AJ608986.1| Fungal sp. GFI 3 5.8S rRNA gene, 28S rRNA gene (partial), ITS1 and
           ITS2, isolate GFI 3
          Length = 561

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 23  gatcattaaagagttgcaaa 42



to top

>gb|AC114322.2| Homo sapiens chromosome 5 clone RP11-74D3, complete sequence
          Length = 133348

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 331   acaaaaggtagcaaaataca 350
             ||||||||||||||||||||
Sbjct: 72653 acaaaaggtagcaaaataca 72634



to top

>gb|DQ420780.1| Uncultured soil fungus clone 174-2 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and large subunit ribosomal RNA gene, partial
           sequence
          Length = 598

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 61  gatcattaaagagttgcaaa 80



to top

>gb|AC074274.15| Homo sapiens 3 BAC RP11-325B23 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 44530

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 10    ttctttgataaatgtctatt 29
             ||||||||||||||||||||
Sbjct: 34412 ttctttgataaatgtctatt 34431



to top

>gb|AC108694.2| Homo sapiens 3q BAC RP11-764C7 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 35585

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 625  tcattaaagagttgcaaatg 644
            ||||||||||||||||||||
Sbjct: 2571 tcattaaagagttgcaaatg 2552



to top

>gb|AC117424.6| Homo sapiens 3 BAC RP11-172I10 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 136511

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 625  tcattaaagagttgcaaatg 644
            ||||||||||||||||||||
Sbjct: 2642 tcattaaagagttgcaaatg 2623



to top

>gb|AF486637.1| Podospora curvicolla 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 28S ribosomal RNA gene, partial sequence
          Length = 543

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 19  gatcattaaagagttgcaaa 38



to top

>gb|AF443852.1|AF443852 Podospora setosa 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene and
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 543

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 19  gatcattaaagagttgcaaa 38



to top

>gb|AF443849.1|AF443849 Podospora comata 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene and
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 547

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 19  gatcattaaagagttgcaaa 38



to top

>gb|AF443848.1|AF443848 Podospora bicolor 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 28S ribosomal RNA gene, partial sequence
          Length = 540

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 19  gatcattaaagagttgcaaa 38



to top

>gb|AF399011.1| Pseudomonas phage phiKZ, complete genome
          Length = 280334

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 275   tcattagaagacctatctaa 294
             ||||||||||||||||||||
Sbjct: 91898 tcattagaagacctatctaa 91917



to top

>gb|AC099514.2| Homo sapiens chromosome 5 clone RP11-454E7, complete sequence
          Length = 181674

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 168   gtatcattagaagtcttttctaaa 191
             ||||||||||||||||||| ||||
Sbjct: 20989 gtatcattagaagtcttttttaaa 21012



to top

>gb|AY681200.1| Apodus oryzae 18S ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 550

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 39  gatcattaaagagttgcaaa 58



to top

>gb|AC121223.5| Rattus norvegicus  BAC CH230-70M4 (Children's Hospital Oakland Research
              Institute Rat (BN/SsNHsd/MCW) BAC library) complete
              sequence
          Length = 263147

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 127    atcagaaaacaaaataccca 146
              ||||||||||||||||||||
Sbjct: 181110 atcagaaaacaaaataccca 181091



to top

>gb|AC159982.4| Mus musculus chromosome 19, clone RP24-383P9, complete sequence
          Length = 198886

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 262   aagagagaaaatctcattag 281
             ||||||||||||||||||||
Sbjct: 63002 aagagagaaaatctcattag 62983



to top

>gb|AY999131.1| Zopfiella longicaudata strain IFO 30296 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 576

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 48  gatcattaaagagttgcaaa 67



to top

>gb|AY999130.1| Zopfiella tetraspora strain IFO 32904 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 584

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 50  gatcattaaagagttgcaaa 69



to top

>gb|AY999129.1| Zopfiella latipes strain IFO 9826 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 561

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 49  gatcattaaagagttgcaaa 68



to top

>gb|AY999123.1| Podospora cochleariformis strain CBS 249.71 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 571

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 49  gatcattaaagagttgcaaa 68



to top

>gb|AF393809.1|AF393809 Apium graveolens sucrose synthase-like protein mRNA, partial cds
          Length = 522

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 130 agaaaacaaaatacccagat 149
           ||||||||||||||||||||
Sbjct: 412 agaaaacaaaatacccagat 431



to top

>gb|AY627829.1| Epacris pulchella root associated fungus EP26 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1,
           5.8S ribosomal RNA gene, and internal transcribed spacer
           2, complete sequence; and 28S ribosomal RNA gene,
           partial sequence
          Length = 517

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 4   gatcattaaagagttgcaaa 23



to top

>gb|AC016661.7|AC016661 Arabidopsis thaliana chromosome 3 BAC F11F8 genomic sequence, complete
             sequence
          Length = 107603

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 367   ttacaagttacattttccac 386
             ||||||||||||||||||||
Sbjct: 11060 ttacaagttacattttccac 11041



to top

>gb|AC073218.6| Homo sapiens BAC clone RP11-529E15 from 2, complete sequence
          Length = 150263

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 169   tatcattagaagtcttttctaaat 192
             ||||| ||||||||||||||||||
Sbjct: 99414 tatcaatagaagtcttttctaaat 99391



to top

>gb|AC074097.6| Homo sapiens BAC clone RP11-333M19 from 2, complete sequence
          Length = 89857

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 48    tcctaatttttaaaagaatc 67
             ||||||||||||||||||||
Sbjct: 31700 tcctaatttttaaaagaatc 31681



to top

>gb|AC092967.5| Homo sapiens 3 BAC RP11-521A24 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 179848

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 363    catgttacaagttacatttt 382
              ||||||||||||||||||||
Sbjct: 101605 catgttacaagttacatttt 101624



to top

>gb|AC127286.3| Mus musculus BAC clone RP23-340I4 from chromosome unknown, complete
              sequence
          Length = 190953

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 242    tattcagatttcctaatctt 261
              ||||||||||||||||||||
Sbjct: 164984 tattcagatttcctaatctt 165003



to top

>gb|AC068914.7| Homo sapiens BAC clone CTD-2026C7 from 2, complete sequence
          Length = 129954

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 485    acataaaagtaaagttagaa 504
              ||||||||||||||||||||
Sbjct: 105242 acataaaagtaaagttagaa 105261



to top

>emb|AL935305.13| Zebrafish DNA sequence from clone CH211-226I4 in linkage group 23,
              complete sequence
          Length = 190222

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 165    aaagtatcattagaagtcttttct 188
              |||||||||||||| |||||||||
Sbjct: 106767 aaagtatcattagaggtcttttct 106790



to top

>gb|DQ163920.1| Bacteriophage SD1-M, complete genome
          Length = 281083

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 275   tcattagaagacctatctaa 294
             ||||||||||||||||||||
Sbjct: 92993 tcattagaagacctatctaa 93012



to top

>emb|BX649280.4| Mouse DNA sequence from clone RP23-302H19 on chromosome X, complete
             sequence
          Length = 101790

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 54    tttttaaaagaatctcctta 73
             ||||||||||||||||||||
Sbjct: 75270 tttttaaaagaatctcctta 75251



to top

>gb|AY916068.1| Uncultured sordariaceous ectomycorrhiza isolate P4 internal
           transcribed spacer 1, partial sequence; 5.8S ribosomal
           RNA gene and internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 612

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 61  gatcattaaagagttgcaaa 80



to top

>gb|AY428788.1| Cephalosporium maydis strain CM2A1 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 556

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 25  gatcattaaagagttgcaaa 44



to top

>gb|AY428787.1| Cephalosporium maydis strain CM3B 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 557

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 25  gatcattaaagagttgcaaa 44



to top

>gb|AY428786.1| Cephalosporium maydis strain CM884 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 556

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 25  gatcattaaagagttgcaaa 44



to top

>gb|AY428785.1| Cephalosporium maydis strain CM1A 18S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 1, 5.8S ribosomal
           RNA gene, and internal transcribed spacer 2, complete
           sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 555

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 25  gatcattaaagagttgcaaa 44



to top

>emb|AL359951.4|CNS05TF3 Human chromosome 14 DNA sequence BAC R-196A3 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 176202

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 10     ttctttgataaatgtctatt 29
              ||||||||||||||||||||
Sbjct: 155601 ttctttgataaatgtctatt 155620



to top

>emb|BX539328.4| Mouse DNA sequence from clone RP23-108I21 on chromosome X, complete
             sequence
          Length = 113887

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 242   tattcagatttcctaatctt 261
             ||||||||||||||||||||
Sbjct: 12018 tattcagatttcctaatctt 11999



to top

>emb|Z82261.1|CEC35D6 Caenorhabditis elegans Cosmid C35D6, complete sequence
          Length = 42844

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 650   caatgatttcgaaagaaaca 669
             ||||||||||||||||||||
Sbjct: 41089 caatgatttcgaaagaaaca 41070



to top

>emb|BX640480.22| Zebrafish DNA sequence from clone DKEYP-86F2 in linkage group 18,
             complete sequence
          Length = 186258

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 165   aaagtatcattagaagtcttttct 188
             |||||||||| |||||||||||||
Sbjct: 14277 aaagtatcataagaagtcttttct 14300



to top

>gb|AC007632.4|AC007632 Homo sapiens clone R529C19B from chromosome 18, complete sequence
          Length = 205959

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 9     attctttgataaatgtctattaaa 32
             |||||||||| |||||||||||||
Sbjct: 26053 attctttgatgaatgtctattaaa 26030



to top

>emb|AJ012300.1|PDI012300 Phialemonium dimorphosporum 5.8S rRNA gene and internal transcribed
           spacers 1 and 2
          Length = 546

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 23  gatcattaaagagttgcaaa 42



to top

>emb|AJ012299.1|PDI012299 Phialemonium dimorphosporum 5.8S rRNA gene and internal transcribed
           spacers 1 and 2, strain FMR 6321
          Length = 547

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 23  gatcattaaagagttgcaaa 42



to top

>emb|AJ012298.1|PDI012298 Phialemonium dimorphosporum 5.8S rRNA gene and internal transcribed
           spacers 1 and 2, strain CBS 491.82
          Length = 545

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 23  gatcattaaagagttgcaaa 42



to top

>dbj|AP003079.3| Homo sapiens genomic DNA, chromosome 11 clone:RP11-141E21, complete
             sequence
          Length = 166045

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 51    taatttttaaaagaatctcc 70
             ||||||||||||||||||||
Sbjct: 47966 taatttttaaaagaatctcc 47985



to top

>gb|AY706336.1| Trichocladium asperum strain DAOM 232342 18S ribosomal RNA gene,
            partial sequence; internal transcribed spacer 1, 5.8S
            ribosomal RNA gene, and internal transcribed spacer 2,
            complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 2222

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 623  gatcattaaagagttgcaaa 642
            ||||||||||||||||||||
Sbjct: 1716 gatcattaaagagttgcaaa 1735



to top

>gb|AY706334.1| Humicola grisea var. grisea strain DAOM 232586 18S ribosomal RNA
            gene, partial sequence; internal transcribed spacer 1,
            5.8S ribosomal RNA gene, and internal transcribed spacer
            2, complete sequence; and 28S ribosomal RNA gene, partial
            sequence
          Length = 2215

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 623  gatcattaaagagttgcaaa 642
            ||||||||||||||||||||
Sbjct: 1716 gatcattaaagagttgcaaa 1735



to top

>gb|AC110118.8| Rattus norvegicus  BAC CH230-310N6 (Children's Hospital Oakland
             Research Institute Rat (BN/SsNHsd/MCW) BAC library)
             complete sequence
          Length = 175663

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 127   atcagaaaacaaaataccca 146
             ||||||||||||||||||||
Sbjct: 92284 atcagaaaacaaaataccca 92265



to top

>emb|AJ875376.1| Uncultured fungus 18S rRNA gene (partial), 5.8S rRNA gene, 28S rRNA
           gene (partial), ITS1 and ITS2
          Length = 608

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 61  gatcattaaagagttgcaaa 80



to top

>emb|AL954813.14| Mouse DNA sequence from clone RP24-541E15 on chromosome 4, complete
           sequence
          Length = 140383

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 331 acaaaaggtagcaaaataca 350
           ||||||||||||||||||||
Sbjct: 743 acaaaaggtagcaaaataca 724



to top

>gb|AC172751.1| Mus musculus BAC clone RP23-341F9 from chromosome 14, complete sequence
          Length = 200222

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 481    acccacataaaagtaaagttagaa 504
              |||||||||||| |||||||||||
Sbjct: 139652 acccacataaaaataaagttagaa 139629



to top

>gb|AC122119.11| Mus musculus chromosome 19, clone RP24-252F4, complete sequence
          Length = 183160

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 262    aagagagaaaatctcattag 281
              ||||||||||||||||||||
Sbjct: 150321 aagagagaaaatctcattag 150340



to top

>emb|AL627403.13| Mouse DNA sequence from clone RP23-29F4 on chromosome X, complete
              sequence
          Length = 184697

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 526    acagaaacctattgtttgcc 545
              ||||||||||||||||||||
Sbjct: 133191 acagaaacctattgtttgcc 133172



to top

>emb|AL806517.9| Mouse DNA sequence from clone RP23-20K17 on chromosome 4, complete
            sequence
          Length = 192432

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 331  acaaaaggtagcaaaataca 350
            ||||||||||||||||||||
Sbjct: 1258 acaaaaggtagcaaaataca 1277



to top

>gb|U17215.1|U17215 Gaeumannomyces incrustans I3 18S, 5.8S and 26S rRNA genes, partial
           sequence
          Length = 648

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 163 gatcattaaagagttgcaaa 182



to top

>gb|U17214.1|U17214 Gaeumannomyces incrustans I1 18S and 5.8S rRNA genes, partial
           sequence
          Length = 646

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 163 gatcattaaagagttgcaaa 182



to top

>emb|AJ010027.1|CMA10027 Cephalosporium maydis 5.8S gene, ITS1, ITS2 and partial 18S and 26S
           rRNA genes, isolate 272213
          Length = 517

 Score = 40.1 bits (20), Expect = 9.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 623 gatcattaaagagttgcaaa 642
           ||||||||||||||||||||
Sbjct: 6   gatcattaaagagttgcaaa 25


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 8,354,099
Number of Sequences: 3902068
Number of extensions: 8354099
Number of successful extensions: 167535
Number of sequences better than 10.0: 92
Number of HSP's better than 10.0 without gapping: 92
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 167311
Number of HSP's gapped (non-prelim): 224
length of query: 716
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 693
effective length of database: 17,143,297,704
effective search space: 11880305308872
effective search space used: 11880305308872
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top