>emb|AL450344.4| Human DNA sequence from clone RP11-136K14 on chromosome 6 Contains
three novel genes, the 5' end of a novel gene (contains
FLJ31738 and KIAA1209) and a CpG island, complete sequence
Length = 150005
Score = 40.1 bits (20), Expect = 8.5
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 85 tcccctcaccacaagcacct 104
||||||||||||||||||||
Sbjct: 64390 tcccctcaccacaagcacct 64409
>emb|AL137073.13| Human DNA sequence from clone RP11-404F11 on chromosome 9p23-24.1
Contains a novel gene encoding a protein similar to
bacterial N-acetylneuraminic acid condensing enzyme (NEUB)
and 3' end of the TBCID2 gene, a TRIM14 gene encoding
tripartite motif-containing 14 (KIAA0129), the CORO2A gene
encoding Coronin 2A (actin-binding protein), TBC1D2 gene
encoding TBC1 domain family, member 2 (PARIS1,
PARIS-1,DKFZP761D1823, DKFZp761D1823), and 4 CpG islands,
complete sequence
Length = 201300
Score = 40.1 bits (20), Expect = 8.5
Identities = 20/20 (100%)
Strand = Plus / Plus
Query: 484 cctcaccttgcccagggatc 503
||||||||||||||||||||
Sbjct: 160765 cctcaccttgcccagggatc 160784
>gb|AC101944.16| Mus musculus chromosome 1, clone RP24-118B6, complete sequence
Length = 174560
Score = 40.1 bits (20), Expect = 8.5
Identities = 23/24 (95%)
Strand = Plus / Minus
Query: 526 tggaggccaggaggctggatctag 549
|||||||| |||||||||||||||
Sbjct: 107794 tggaggcccggaggctggatctag 107771
Database: nt
Posted date: May 29, 2006 11:10 AM
Number of letters in database: 3,984,495,279
Number of sequences in database: 917,343
Database: /shigen/export/home/twatanab/db/nt/nt.01
Posted date: May 29, 2006 11:16 AM
Number of letters in database: 3,988,174,986
Number of sequences in database: 835,257
Database: /shigen/export/home/twatanab/db/nt/nt.02
Posted date: May 29, 2006 11:21 AM
Number of letters in database: 3,991,246,324
Number of sequences in database: 771,481
Database: /shigen/export/home/twatanab/db/nt/nt.03
Posted date: May 29, 2006 11:27 AM
Number of letters in database: 3,990,718,311
Number of sequences in database: 977,174
Database: /shigen/export/home/twatanab/db/nt/nt.04
Posted date: May 29, 2006 11:29 AM
Number of letters in database: 1,278,410,368
Number of sequences in database: 400,813
Lambda K H
1.37 0.711 1.31
Gapped
Lambda K H
1.37 0.711 1.31
Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,130,336
Number of Sequences: 3902068
Number of extensions: 4130336
Number of successful extensions: 77882
Number of sequences better than 10.0: 36
Number of HSP's better than 10.0 without gapping: 36
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 77366
Number of HSP's gapped (non-prelim): 516
length of query: 622
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 599
effective length of database: 17,143,297,704
effective search space: 10268835324696
effective search space used: 10268835324696
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)