ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd26o06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_470419.1| Oryza sativa (japonica cultivar-group), mRNA 200 4e-48
2dbj|AK073581.1| Oryza sativa (japonica cultivar-group) cDNA clon... 200 4e-48
3dbj|AK071162.1| Oryza sativa (japonica cultivar-group) cDNA clon... 200 4e-48
4dbj|AB070259.1| Oryza sativa (japonica cultivar-group) OsRPN5 mR... 200 4e-48
5dbj|AK104846.1| Oryza sativa (japonica cultivar-group) cDNA clon... 192 9e-46
6gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 155 2e-34
7dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 155 2e-34
8gb|AC096688.4| Oryza sativa chromosome 3 BAC OSJNBa0015N08 genom... 155 2e-34
9gb|AY104785.1| Zea mays PCO111061 mRNA sequence 141 3e-30
10gb|BT018925.1| Zea mays clone Contig44.F mRNA sequence 113 7e-22
11gb|BT018797.1| Zea mays clone EL01N0528E05.d mRNA sequence 113 7e-22
12ref|NM_203029.1| Arabidopsis thaliana EMB2107 AT5G09900 (EMB2107... 64 6e-07
13ref|NM_121027.2| Arabidopsis thaliana EMB2107 AT5G09900 (EMB2107... 64 6e-07
14gb|AY230832.1| Arabidopsis thaliana 26S proteasome subunit RPN5a... 64 6e-07
15gb|AY113906.1| Arabidopsis thaliana putative 26S proteasome p55 ... 64 6e-07
16gb|AY034908.1| Arabidopsis thaliana putative 26S proteasome p55 ... 64 6e-07
17gb|AC137522.11| Medicago truncatula clone mth2-9h8, complete seq... 62 2e-06
18gb|AC174293.6| Medicago truncatula clone mth2-70h5, complete seq... 62 2e-06
19emb|BX831293.1|CNS0A0PR Arabidopsis thaliana Full-length cDNA Co... 56 1e-04
20dbj|AB016893.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 56 1e-04
21gb|AY347860.1| Malus x domestica clone 10-6 26S proteasome regul... 52 0.002
22gb|AC157977.1| Genomic sequence for Zea mays chromosome 8 BAC cl... 50 0.009
23gb|AC009101.7|AC009101 Homo sapiens chromosome 16 clone RP11-439... 48 0.034
24ref|XM_413692.1| PREDICTED: Gallus gallus similar to PML isoform... 44 0.54
25ref|XM_413690.1| PREDICTED: Gallus gallus similar to ISLR (LOC41... 44 0.54
26emb|AL672186.7| Mouse DNA sequence from clone RP23-42G2 on chrom... 44 0.54
27emb|AL162720.8| Human DNA sequence from clone RP1-132N8 on chrom... 42 2.1
28emb|AL160392.12| Human DNA sequence from clone RP11-121N13 on ch... 42 2.1
29ref|XM_775319.1| PREDICTED: Strongylocentrotus purpuratus simila... 42 2.1
30emb|AL139080.11| Human DNA sequence from clone RP11-173N17 on ch... 42 2.1
31emb|BX322643.8| Zebrafish DNA sequence from clone CH211-281E1 in... 42 2.1
32gb|AC018517.7| Homo sapiens, clone RP11-115N12, complete sequence 42 2.1
33gb|AC159251.2| Mus musculus BAC clone RP24-113B8 from chromosome... 42 2.1
34emb|BX649268.11| Zebrafish DNA sequence from clone DKEY-106J22 i... 42 2.1
35gb|BC028866.1| Mus musculus jumonji domain containing 2A, mRNA (... 40 8.4
36ref|NM_172382.1| Mus musculus jumonji domain containing 2A (Jmjd... 40 8.4
37gb|AY268184.1| Felis catus cardiac troponin I (TNNI3) mRNA, comp... 40 8.4
38gb|AC126429.4| Mus musculus BAC clone RP24-403O23 from chromosom... 40 8.4
39gb|AC122519.4| Mus musculus BAC clone RP24-462C10 from chromosom... 40 8.4
40gb|AC129314.4| Mus musculus BAC clone RP23-365D12 from chromosom... 40 8.4
41gb|AC122187.3| Mus musculus BAC clone RP23-21P2 from 1, complete... 40 8.4
42gb|AC110378.4| Mus musculus BAC clone RP24-193H8 from 6, complet... 40 8.4
43emb|AL671986.7| Human DNA sequence from clone RP11-275F13 on chr... 40 8.4
44emb|AL589167.10| Human DNA sequence from clone RP11-236O12 on ch... 40 8.4
45emb|AL136976.11| Human DNA sequence from clone RP3-474I3 on chro... 40 8.4
46emb|AL138703.10| Human DNA sequence from clone RP11-413N19 on ch... 40 8.4
47gb|AF191797.1| His2 virus, complete genome 40 8.4
48dbj|AK001427.1| Homo sapiens cDNA FLJ10565 fis, clone NT2RP2002954 40 8.4
49dbj|AK145066.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cD... 40 8.4
50dbj|AK145947.1| Mus musculus 12 days pregnant adult female place... 40 8.4
51ref|XM_693987.1| PREDICTED: Danio rerio similar to ATP-binding c... 40 8.4
52dbj|AK172196.1| Mus musculus activated spleen cDNA, RIKEN full-l... 40 8.4
53gb|AC111139.19| Mus musculus chromosome 3, clone RP23-365L12, co... 40 8.4
54dbj|AK054095.1| Mus musculus 2 days pregnant adult female oviduc... 40 8.4
55gb|AC026740.6| Homo sapiens chromosome 5 clone CTD-2589H19, comp... 40 8.4
56ref|NM_001009237.1| Felis catus troponin I, cardiac (TNNI3), mRNA 40 8.4
57ref|XM_233441.3| PREDICTED: Rattus norvegicus jumonji domain con... 40 8.4
58gb|AC062016.5| Homo sapiens BAC clone RP11-59P4 from 2, complete... 40 8.4
59gb|CP000026.1| Salmonella enterica subsp. enterica serovar Parat... 40 8.4
60dbj|BS000215.2| Pan troglodytes chromosome 22 clone:RP43-183P07,... 40 8.4
61dbj|BS000216.1| Pan troglodytes chromosome 22 clone:RP43-057N15,... 40 8.4
62dbj|AB040952.1| Homo sapiens mRNA for KIAA1519 protein, partial cds 40 8.4
63dbj|AK129187.1| Mus musculus mRNA for mKIAA0677 protein 40 8.4
64gb|AC147900.2| Xenopus tropicalis clone CH216-53P23, complete se... 40 8.4
65gb|AC004664.1|AC004664 Homo sapiens chromosome 4 clone C0500H20 ... 40 8.4
66dbj|AP001699.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 8.4
67gb|BC001750.1| Homo sapiens centrosomal protein 72kDa, mRNA (cDN... 40 8.4
68gb|BC000132.2| Homo sapiens centrosomal protein 72kDa, mRNA (cDN... 40 8.4
69gb|AC116720.16| Mus musculus chromosome 3, clone RP23-223N19, co... 40 8.4
70ref|NM_018140.2| Homo sapiens centrosomal protein 72kDa (CEP72),... 40 8.4
71emb|AL626764.6| Mouse DNA sequence from clone RP23-94L18 on chro... 40 8.4
72dbj|AP001604.1| Homo sapiens genomic DNA, chromosome 21, clone:K... 40 8.4 
>ref|XM_470419.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1754

 Score =  200 bits (101), Expect = 4e-48
 Identities = 215/253 (84%)
 Strand = Plus / Minus

                                                                        
Query: 362  gctttcaacaccgccttgtggatcatcgtctccttgtgtatttggtggcagctcttctcc 421
            ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 1464 gctttcaacaccgccttatggatcatcgtctccttgtgtatttggtgacagctcttctca 1405

                                                                        
Query: 422  accaggtccaggagcttctccaggttcgacgcccacgagttgagcaccccgttgctgtcc 481
            || || || ||||| ||||| ||||||| |||||| || ||||| |  || || ||||| 
Sbjct: 1404 acaagatcgaggagtttctcgaggttcgccgcccaggaattgagtataccattactgtct 1345

                                                                        
Query: 482  tgggctgtccggaaggacacgatccccattggtctgtcgatctttgcaatcaaggccttt 541
            || ||||| |||||| | || |  |||||||| ||||| ||||| |||||||  | ||||
Sbjct: 1344 tgtgctgtgcggaagcatacaacacccattggcctgtcaatcttcgcaatcagcgacttt 1285

                                                                        
Query: 542  gagttcaccatgtccgagatatgcttctctgcctcctgcaagctcaggcaaagaagatcc 601
            ||||| ||||||||||| |  || |||||||||||||||||||||| |||||||||||| 
Sbjct: 1284 gagtttaccatgtccgaaaggtgtttctctgcctcctgcaagctcaagcaaagaagatct 1225

                         
Query: 602  gccagcctcttca 614
            || ||||||||||
Sbjct: 1224 gcgagcctcttca 1212



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 221  cacgagttcccaaagcaaacaggcgatgct 250
            ||||||||||||||||||||||| ||||||
Sbjct: 1598 cacgagttcccaaagcaaacaggtgatgct 1569
to top
>dbj|AK073581.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033048G13, full
            insert sequence
          Length = 1648

 Score =  200 bits (101), Expect = 4e-48
 Identities = 215/253 (84%)
 Strand = Plus / Minus

                                                                        
Query: 362  gctttcaacaccgccttgtggatcatcgtctccttgtgtatttggtggcagctcttctcc 421
            ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 1453 gctttcaacaccgccttatggatcatcgtctccttgtgtatttggtgacagctcttctca 1394

                                                                        
Query: 422  accaggtccaggagcttctccaggttcgacgcccacgagttgagcaccccgttgctgtcc 481
            || || || ||||| ||||| ||||||| |||||| || ||||| |  || || ||||| 
Sbjct: 1393 acaagatcgaggagtttctcgaggttcgccgcccaggaattgagtataccattactgtct 1334

                                                                        
Query: 482  tgggctgtccggaaggacacgatccccattggtctgtcgatctttgcaatcaaggccttt 541
            || ||||| |||||| | || |  |||||||| ||||| ||||| |||||||  | ||||
Sbjct: 1333 tgtgctgtgcggaagcatacaacacccattggcctgtcaatcttcgcaatcagcgacttt 1274

                                                                        
Query: 542  gagttcaccatgtccgagatatgcttctctgcctcctgcaagctcaggcaaagaagatcc 601
            ||||| ||||||||||| |  || |||||||||||||||||||||| |||||||||||| 
Sbjct: 1273 gagtttaccatgtccgaaaggtgtttctctgcctcctgcaagctcaagcaaagaagatct 1214

                         
Query: 602  gccagcctcttca 614
            || ||||||||||
Sbjct: 1213 gcgagcctcttca 1201



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 221  cacgagttcccaaagcaaacaggcgatgct 250
            ||||||||||||||||||||||| ||||||
Sbjct: 1587 cacgagttcccaaagcaaacaggtgatgct 1558
to top
>dbj|AK071162.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023081N11, full
            insert sequence
          Length = 1890

 Score =  200 bits (101), Expect = 4e-48
 Identities = 215/253 (84%)
 Strand = Plus / Minus

                                                                        
Query: 362  gctttcaacaccgccttgtggatcatcgtctccttgtgtatttggtggcagctcttctcc 421
            ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 1486 gctttcaacaccgccttatggatcatcgtctccttgtgtatttggtgacagctcttctca 1427

                                                                        
Query: 422  accaggtccaggagcttctccaggttcgacgcccacgagttgagcaccccgttgctgtcc 481
            || || || ||||| ||||| ||||||| |||||| || ||||| |  || || ||||| 
Sbjct: 1426 acaagatcgaggagtttctcgaggttcgccgcccaggaattgagtataccattactgtct 1367

                                                                        
Query: 482  tgggctgtccggaaggacacgatccccattggtctgtcgatctttgcaatcaaggccttt 541
            || ||||| |||||| | || |  |||||||| ||||| ||||| |||||||  | ||||
Sbjct: 1366 tgtgctgtgcggaagcatacaacacccattggcctgtcaatcttcgcaatcagcgacttt 1307

                                                                        
Query: 542  gagttcaccatgtccgagatatgcttctctgcctcctgcaagctcaggcaaagaagatcc 601
            ||||| ||||||||||| |  || |||||||||||||||||||||| |||||||||||| 
Sbjct: 1306 gagtttaccatgtccgaaaggtgtttctctgcctcctgcaagctcaagcaaagaagatct 1247

                         
Query: 602  gccagcctcttca 614
            || ||||||||||
Sbjct: 1246 gcgagcctcttca 1234



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 221  cacgagttcccaaagcaaacaggcgatgct 250
            ||||||||||||||||||||||| ||||||
Sbjct: 1620 cacgagttcccaaagcaaacaggtgatgct 1591
to top
>dbj|AB070259.1| Oryza sativa (japonica cultivar-group) OsRPN5 mRNA for 26S
           proteasome regulatory particle non-ATPase subunit5,
           partial cds
          Length = 1075

 Score =  200 bits (101), Expect = 4e-48
 Identities = 215/253 (84%)
 Strand = Plus / Minus

                                                                       
Query: 362 gctttcaacaccgccttgtggatcatcgtctccttgtgtatttggtggcagctcttctcc 421
           ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 805 gctttcaacaccgccttatggatcatcgtctccttgtgtatttggtgacagctcttctca 746

                                                                       
Query: 422 accaggtccaggagcttctccaggttcgacgcccacgagttgagcaccccgttgctgtcc 481
           || || || ||||| ||||| ||||||| |||||| || ||||| |  || || ||||| 
Sbjct: 745 acaagatcgaggagtttctcgaggttcgccgcccaggaattgagtataccattactgtct 686

                                                                       
Query: 482 tgggctgtccggaaggacacgatccccattggtctgtcgatctttgcaatcaaggccttt 541
           || ||||| |||||| | || |  |||||||| ||||| ||||| |||||||  | ||||
Sbjct: 685 tgtgctgtgcggaagcatacaacacccattggcctgtcaatcttcgcaatcagcgacttt 626

                                                                       
Query: 542 gagttcaccatgtccgagatatgcttctctgcctcctgcaagctcaggcaaagaagatcc 601
           ||||| ||||||||||| |  || |||||||||||||||||||||| |||||||||||| 
Sbjct: 625 gagtttaccatgtccgaaaggtgtttctctgcctcctgcaagctcaagcaaagaagatct 566

                        
Query: 602 gccagcctcttca 614
           || ||||||||||
Sbjct: 565 gcgagcctcttca 553



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 221 cacgagttcccaaagcaaacaggcgatgct 250
           ||||||||||||||||||||||| ||||||
Sbjct: 939 cacgagttcccaaagcaaacaggtgatgct 910
to top
>dbj|AK104846.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-H04, full
            insert sequence
          Length = 1690

 Score =  192 bits (97), Expect = 9e-46
 Identities = 214/253 (84%)
 Strand = Plus / Minus

                                                                        
Query: 362  gctttcaacaccgccttgtggatcatcgtctccttgtgtatttggtggcagctcttctcc 421
            ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 1428 gctttcaacaccgccttatggatcatcgtctccttgtgtatttggtgacagctcttctca 1369

                                                                        
Query: 422  accaggtccaggagcttctccaggttcgacgcccacgagttgagcaccccgttgctgtcc 481
            || || || ||||| ||||| ||||||| |||||| || ||||| |  || || ||||| 
Sbjct: 1368 acaagatcgaggagtttctcgaggttcgccgcccaggaattgagtataccattactgtct 1309

                                                                        
Query: 482  tgggctgtccggaaggacacgatccccattggtctgtcgatctttgcaatcaaggccttt 541
            || ||||| |||||| | || |  |||||||| ||||| ||||| |||||||  | ||||
Sbjct: 1308 tgtgctgtgcggaagcatacaacacccattggcctgtcaatcttcgcaatcagcgacttt 1249

                                                                        
Query: 542  gagttcaccatgtccgagatatgcttctctgcctcctgcaagctcaggcaaagaagatcc 601
            ||||| ||| ||||||| |  || |||||||||||||||||||||| |||||||||||| 
Sbjct: 1248 gagtttaccgtgtccgaaaggtgtttctctgcctcctgcaagctcaagcaaagaagatct 1189

                         
Query: 602  gccagcctcttca 614
            || ||||||||||
Sbjct: 1188 gcgagcctcttca 1176



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                          
Query: 221  cacgagttcccaaagcaaacaggcgatgct 250
            ||||||||||||||||||||||| ||||||
Sbjct: 1562 cacgagttcccaaagcaaacaggtgatgct 1533
to top
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  155 bits (78), Expect = 2e-34
 Identities = 183/218 (83%)
 Strand = Plus / Plus

                                                                            
Query: 362      gctttcaacaccgccttgtggatcatcgtctccttgtgtatttggtggcagctcttctcc 421
                ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 35530491 gctttcaacaccgccttatggatcatcgtctccttgtgtatttggtgacagctcttctca 35530550

                                                                            
Query: 422      accaggtccaggagcttctccaggttcgacgcccacgagttgagcaccccgttgctgtcc 481
                || || || ||||| ||||| ||||||| |||||| || ||||| |  || || ||||| 
Sbjct: 35530551 acaagatcgaggagtttctcgaggttcgccgcccaggaattgagtataccattactgtct 35530610

                                                                            
Query: 482      tgggctgtccggaaggacacgatccccattggtctgtcgatctttgcaatcaaggccttt 541
                || ||||| |||||| | || |  |||||||| ||||| ||||| |||||||  | ||||
Sbjct: 35530611 tgtgctgtgcggaagcatacaacacccattggcctgtcaatcttcgcaatcagcgacttt 35530670

                                                      
Query: 542      gagttcaccatgtccgagatatgcttctctgcctcctg 579
                ||||| ||||||||||| |  || ||||||||||||||
Sbjct: 35530671 gagtttaccatgtccgaaaggtgtttctctgcctcctg 35530708



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 576      cctgcaagctcaggcaaagaagatccgccagcctcttca 614
                |||||||||||| |||||||||||| || ||||||||||
Sbjct: 35530799 cctgcaagctcaagcaaagaagatctgcgagcctcttca 35530837



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                              
Query: 221      cacgagttcccaaagcaaacaggcgatgct 250
                ||||||||||||||||||||||| ||||||
Sbjct: 35530357 cacgagttcccaaagcaaacaggtgatgct 35530386
to top
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score =  155 bits (78), Expect = 2e-34
 Identities = 183/218 (83%)
 Strand = Plus / Plus

                                                                            
Query: 362      gctttcaacaccgccttgtggatcatcgtctccttgtgtatttggtggcagctcttctcc 421
                ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 35620563 gctttcaacaccgccttatggatcatcgtctccttgtgtatttggtgacagctcttctca 35620622

                                                                            
Query: 422      accaggtccaggagcttctccaggttcgacgcccacgagttgagcaccccgttgctgtcc 481
                || || || ||||| ||||| ||||||| |||||| || ||||| |  || || ||||| 
Sbjct: 35620623 acaagatcgaggagtttctcgaggttcgccgcccaggaattgagtataccattactgtct 35620682

                                                                            
Query: 482      tgggctgtccggaaggacacgatccccattggtctgtcgatctttgcaatcaaggccttt 541
                || ||||| |||||| | || |  |||||||| ||||| ||||| |||||||  | ||||
Sbjct: 35620683 tgtgctgtgcggaagcatacaacacccattggcctgtcaatcttcgcaatcagcgacttt 35620742

                                                      
Query: 542      gagttcaccatgtccgagatatgcttctctgcctcctg 579
                ||||| ||||||||||| |  || ||||||||||||||
Sbjct: 35620743 gagtttaccatgtccgaaaggtgtttctctgcctcctg 35620780



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                       
Query: 576      cctgcaagctcaggcaaagaagatccgccagcctcttca 614
                |||||||||||| |||||||||||| || ||||||||||
Sbjct: 35620871 cctgcaagctcaagcaaagaagatctgcgagcctcttca 35620909



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                              
Query: 221      cacgagttcccaaagcaaacaggcgatgct 250
                ||||||||||||||||||||||| ||||||
Sbjct: 35620429 cacgagttcccaaagcaaacaggtgatgct 35620458
to top
>gb|AC096688.4| Oryza sativa chromosome 3 BAC OSJNBa0015N08 genomic sequence, complete
             sequence
          Length = 145290

 Score =  155 bits (78), Expect = 2e-34
 Identities = 183/218 (83%)
 Strand = Plus / Plus

                                                                         
Query: 362   gctttcaacaccgccttgtggatcatcgtctccttgtgtatttggtggcagctcttctcc 421
             ||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| 
Sbjct: 63454 gctttcaacaccgccttatggatcatcgtctccttgtgtatttggtgacagctcttctca 63513

                                                                         
Query: 422   accaggtccaggagcttctccaggttcgacgcccacgagttgagcaccccgttgctgtcc 481
             || || || ||||| ||||| ||||||| |||||| || ||||| |  || || ||||| 
Sbjct: 63514 acaagatcgaggagtttctcgaggttcgccgcccaggaattgagtataccattactgtct 63573

                                                                         
Query: 482   tgggctgtccggaaggacacgatccccattggtctgtcgatctttgcaatcaaggccttt 541
             || ||||| |||||| | || |  |||||||| ||||| ||||| |||||||  | ||||
Sbjct: 63574 tgtgctgtgcggaagcatacaacacccattggcctgtcaatcttcgcaatcagcgacttt 63633

                                                   
Query: 542   gagttcaccatgtccgagatatgcttctctgcctcctg 579
             ||||| ||||||||||| |  || ||||||||||||||
Sbjct: 63634 gagtttaccatgtccgaaaggtgtttctctgcctcctg 63671



 Score = 54.0 bits (27), Expect = 6e-04
 Identities = 36/39 (92%)
 Strand = Plus / Plus

                                                    
Query: 576   cctgcaagctcaggcaaagaagatccgccagcctcttca 614
             |||||||||||| |||||||||||| || ||||||||||
Sbjct: 63762 cctgcaagctcaagcaaagaagatctgcgagcctcttca 63800



 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Plus

                                           
Query: 221   cacgagttcccaaagcaaacaggcgatgct 250
             ||||||||||||||||||||||| ||||||
Sbjct: 63320 cacgagttcccaaagcaaacaggtgatgct 63349
to top
>gb|AY104785.1| Zea mays PCO111061 mRNA sequence
          Length = 1893

 Score =  141 bits (71), Expect = 3e-30
 Identities = 206/251 (82%)
 Strand = Plus / Minus

                                                                        
Query: 362  gctttcaacaccgccttgtggatcatcgtctccttgtgtatttggtggcagctcttctcc 421
            |||||||| ||||||||||||||||| |||||||||||||| ||||| ||||||||||| 
Sbjct: 1520 gctttcaataccgccttgtggatcatagtctccttgtgtatctggtgacagctcttctcg 1461

                                                                        
Query: 422  accaggtccaggagcttctccaggttcgacgcccacgagttgagcaccccgttgctgtcc 481
            || ||||| || |||| ||| ||||| |  ||||||||||| ||    || |||||||| 
Sbjct: 1460 acaaggtcaagaagctgctcgaggtttgtagcccacgagttaagtgtgccattgctgtct 1401

                                                                        
Query: 482  tgggctgtccggaaggacacgatccccattggtctgtcgatctttgcaatcaaggccttt 541
            ||||  |||||||||   || |  ||||| || |||||||||||||| |  |  |  |||
Sbjct: 1400 tgggtcgtccggaagctgacaactcccatcggcctgtcgatctttgccactagagatttt 1341

                                                                        
Query: 542  gagttcaccatgtccgagatatgcttctctgcctcctgcaagctcaggcaaagaagatcc 601
            |||||||||||||| || | ||||||||||||||||||||| |||||||| || ||||| 
Sbjct: 1340 gagttcaccatgtctgaaagatgcttctctgcctcctgcaaactcaggcagagcagatca 1281

                       
Query: 602  gccagcctctt 612
            || ||||||||
Sbjct: 1280 gcaagcctctt 1270
to top
>gb|BT018925.1| Zea mays clone Contig44.F mRNA sequence
          Length = 1684

 Score =  113 bits (57), Expect = 7e-22
 Identities = 201/249 (80%)
 Strand = Plus / Minus

                                                                        
Query: 363  ctttcaacaccgccttgtggatcatcgtctccttgtgtatttggtggcagctcttctcca 422
            |||| ||| ||| |||||||||||| ||||| || ||||| | ||||||||||||||| |
Sbjct: 1432 cttttaacgccgtcttgtggatcatggtctctttatgtatctcgtggcagctcttctcaa 1373

                                                                        
Query: 423  ccaggtccaggagcttctccaggttcgacgcccacgagttgagcaccccgttgctgtcct 482
            | |||||||| |||||||| ||| |||  ||||| ||||| ||    || |||||||| |
Sbjct: 1372 cgaggtccagaagcttctcaaggctcgtggcccatgagttcagtgtgccattgctgtctt 1313

                                                                        
Query: 483  gggctgtccggaaggacacgatccccattggtctgtcgatctttgcaatcaaggcctttg 542
            |||  |||||||||   || |  ||||| || |||||||||||||| |  |  |  || |
Sbjct: 1312 gggtcgtccggaagctgacaactcccatcggcctgtcgatctttgccactagagatttcg 1253

                                                                        
Query: 543  agttcaccatgtccgagatatgcttctctgcctcctgcaagctcaggcaaagaagatccg 602
            |||| |||||||| |||| |||||||||||||||||||||  |||||||||||||||| |
Sbjct: 1252 agttaaccatgtctgagagatgcttctctgcctcctgcaaagtcaggcaaagaagatcag 1193

                     
Query: 603  ccagcctct 611
            | |||||||
Sbjct: 1192 caagcctct 1184
to top
>gb|BT018797.1| Zea mays clone EL01N0528E05.d mRNA sequence
          Length = 1949

 Score =  113 bits (57), Expect = 7e-22
 Identities = 201/249 (80%)
 Strand = Plus / Minus

                                                                        
Query: 363  ctttcaacaccgccttgtggatcatcgtctccttgtgtatttggtggcagctcttctcca 422
            |||| ||| ||| |||||||||||| ||||| || ||||| | ||||||||||||||| |
Sbjct: 1731 cttttaacgccgtcttgtggatcatggtctctttatgtatctcgtggcagctcttctcaa 1672

                                                                        
Query: 423  ccaggtccaggagcttctccaggttcgacgcccacgagttgagcaccccgttgctgtcct 482
            | |||||||| |||||||| ||| |||  ||||| ||||| ||    || |||||||| |
Sbjct: 1671 cgaggtccagaagcttctcaaggctcgtggcccatgagttcagtgtgccattgctgtctt 1612

                                                                        
Query: 483  gggctgtccggaaggacacgatccccattggtctgtcgatctttgcaatcaaggcctttg 542
            |||  |||||||||   || |  ||||| || |||||||||||||| |  |  |  || |
Sbjct: 1611 gggtcgtccggaagctgacaactcccatcggcctgtcgatctttgccactagagatttcg 1552

                                                                        
Query: 543  agttcaccatgtccgagatatgcttctctgcctcctgcaagctcaggcaaagaagatccg 602
            |||| |||||||| |||| |||||||||||||||||||||  |||||||||||||||| |
Sbjct: 1551 agttaaccatgtctgagagatgcttctctgcctcctgcaaagtcaggcaaagaagatcag 1492

                     
Query: 603  ccagcctct 611
            | |||||||
Sbjct: 1491 caagcctct 1483
to top
>ref|NM_203029.1| Arabidopsis thaliana EMB2107 AT5G09900 (EMB2107) transcript variant
            AT5G09900.2 mRNA, complete cds
          Length = 1615

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 158/200 (79%)
 Strand = Plus / Minus

                                                                        
Query: 392  tccttgtgtatttggtggcagctcttctccaccaggtccaggagcttctccaggttcgac 451
            |||||||| ||||||||||| ||||| ||||| || || || ||||||||||  |||   
Sbjct: 1397 tccttgtgaatttggtggcaactcttttccacaagatctagaagcttctccaaattccct 1338

                                                                        
Query: 452  gcccacgagttgagcaccccgttgctgtcctgggctgtccggaaggacacgatccccatt 511
            ||||||||||| || | | ||||||||||||  ||  || ||||| |||| || ||   |
Sbjct: 1337 gcccacgagtttagaatctcgttgctgtcctttgcgatctggaagcacacaattccagat 1278

                                                                        
Query: 512  ggtctgtcgatctttgcaatcaaggcctttgagttcaccatgtccgagatatgcttctct 571
            |||||||| || ||||||||||  || |||||    ||||| ||||| | ||||||||| 
Sbjct: 1277 ggtctgtctatttttgcaatcagtgcttttgacactaccatctccgatagatgcttctcc 1218

                                
Query: 572  gcctcctgcaagctcaggca 591
            ||||||| || |||||||||
Sbjct: 1217 gcctcctccatgctcaggca 1198
to top
>ref|NM_121027.2| Arabidopsis thaliana EMB2107 AT5G09900 (EMB2107) transcript variant
            AT5G09900.1 mRNA, complete cds
          Length = 1646

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 158/200 (79%)
 Strand = Plus / Minus

                                                                        
Query: 392  tccttgtgtatttggtggcagctcttctccaccaggtccaggagcttctccaggttcgac 451
            |||||||| ||||||||||| ||||| ||||| || || || ||||||||||  |||   
Sbjct: 1428 tccttgtgaatttggtggcaactcttttccacaagatctagaagcttctccaaattccct 1369

                                                                        
Query: 452  gcccacgagttgagcaccccgttgctgtcctgggctgtccggaaggacacgatccccatt 511
            ||||||||||| || | | ||||||||||||  ||  || ||||| |||| || ||   |
Sbjct: 1368 gcccacgagtttagaatctcgttgctgtcctttgcgatctggaagcacacaattccagat 1309

                                                                        
Query: 512  ggtctgtcgatctttgcaatcaaggcctttgagttcaccatgtccgagatatgcttctct 571
            |||||||| || ||||||||||  || |||||    ||||| ||||| | ||||||||| 
Sbjct: 1308 ggtctgtctatttttgcaatcagtgcttttgacactaccatctccgatagatgcttctcc 1249

                                
Query: 572  gcctcctgcaagctcaggca 591
            ||||||| || |||||||||
Sbjct: 1248 gcctcctccatgctcaggca 1229
to top
>gb|AY230832.1| Arabidopsis thaliana 26S proteasome subunit RPN5a (RPN5a) mRNA,
            complete cds
          Length = 1468

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 158/200 (79%)
 Strand = Plus / Minus

                                                                        
Query: 392  tccttgtgtatttggtggcagctcttctccaccaggtccaggagcttctccaggttcgac 451
            |||||||| ||||||||||| ||||| ||||| || || || ||||||||||  |||   
Sbjct: 1301 tccttgtgaatttggtggcaactcttttccacaagatctagaagcttctccaaattccct 1242

                                                                        
Query: 452  gcccacgagttgagcaccccgttgctgtcctgggctgtccggaaggacacgatccccatt 511
            ||||||||||| || | | ||||||||||||  ||  || ||||| |||| || ||   |
Sbjct: 1241 gcccacgagtttagaatctcgttgctgtcctttgcgatctggaagcacacaattccagat 1182

                                                                        
Query: 512  ggtctgtcgatctttgcaatcaaggcctttgagttcaccatgtccgagatatgcttctct 571
            |||||||| || ||||||||||  || |||||    ||||| ||||| | ||||||||| 
Sbjct: 1181 ggtctgtctatttttgcaatcagtgcttttgacactaccatctccgatagatgcttctcc 1122

                                
Query: 572  gcctcctgcaagctcaggca 591
            ||||||| || |||||||||
Sbjct: 1121 gcctcctccatgctcaggca 1102
to top
>gb|AY113906.1| Arabidopsis thaliana putative 26S proteasome p55 protein (At5g09900)
            mRNA, complete cds
          Length = 1329

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 158/200 (79%)
 Strand = Plus / Minus

                                                                        
Query: 392  tccttgtgtatttggtggcagctcttctccaccaggtccaggagcttctccaggttcgac 451
            |||||||| ||||||||||| ||||| ||||| || || || ||||||||||  |||   
Sbjct: 1295 tccttgtgaatttggtggcaactcttttccacaagatctagaagcttctccaaattccct 1236

                                                                        
Query: 452  gcccacgagttgagcaccccgttgctgtcctgggctgtccggaaggacacgatccccatt 511
            ||||||||||| || | | ||||||||||||  ||  || ||||| |||| || ||   |
Sbjct: 1235 gcccacgagtttagaatctcgttgctgtcctttgcgatctggaagcacacaattccagat 1176

                                                                        
Query: 512  ggtctgtcgatctttgcaatcaaggcctttgagttcaccatgtccgagatatgcttctct 571
            |||||||| || ||||||||||  || |||||    ||||| ||||| | ||||||||| 
Sbjct: 1175 ggtctgtctatttttgcaatcagtgcttttgacactaccatctccgatagatgcttctcc 1116

                                
Query: 572  gcctcctgcaagctcaggca 591
            ||||||| || |||||||||
Sbjct: 1115 gcctcctccatgctcaggca 1096
to top
>gb|AY034908.1| Arabidopsis thaliana putative 26S proteasome p55 protein (At5g09900)
            mRNA, complete cds
          Length = 1643

 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 158/200 (79%)
 Strand = Plus / Minus

                                                                        
Query: 392  tccttgtgtatttggtggcagctcttctccaccaggtccaggagcttctccaggttcgac 451
            |||||||| ||||||||||| ||||| ||||| || || || ||||||||||  |||   
Sbjct: 1428 tccttgtgaatttggtggcaactcttttccacaagatctagaagcttctccaaattccct 1369

                                                                        
Query: 452  gcccacgagttgagcaccccgttgctgtcctgggctgtccggaaggacacgatccccatt 511
            ||||||||||| || | | ||||||||||||  ||  || ||||| |||| || ||   |
Sbjct: 1368 gcccacgagtttagaatctcgttgctgtcctttgcgatctggaagcacacaattccagat 1309

                                                                        
Query: 512  ggtctgtcgatctttgcaatcaaggcctttgagttcaccatgtccgagatatgcttctct 571
            |||||||| || ||||||||||  || |||||    ||||| ||||| | ||||||||| 
Sbjct: 1308 ggtctgtctatttttgcaatcagtgcttttgacactaccatctccgatagatgcttctcc 1249

                                
Query: 572  gcctcctgcaagctcaggca 591
            ||||||| || |||||||||
Sbjct: 1248 gcctcctccatgctcaggca 1229
to top
>gb|AC137522.11| Medicago truncatula clone mth2-9h8, complete sequence
          Length = 117720

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 112/139 (80%)
 Strand = Plus / Minus

                                                                         
Query: 392   tccttgtgtatttggtggcagctcttctccaccaggtccaggagcttctccaggttcgac 451
             |||||||||||||| || |||||||||||||| || || || |||||||||| ||| |  
Sbjct: 26909 tccttgtgtatttgatgacagctcttctccacaagatcaagcagcttctccaagtttgct 26850

                                                                         
Query: 452   gcccacgagttgagcaccccgttgctgtcctgggctgtccggaaggacacgatccccatt 511
             ||||| ||||| || ||  | ||||| ||||  |||||  ||||  | || || ||||||
Sbjct: 26849 gcccatgagttaagtacatcattgctatcctttgctgtttggaaacagactattcccatt 26790

                                
Query: 512   ggtctgtcgatctttgcaa 530
             |||||||| ||||||||||
Sbjct: 26789 ggtctgtcaatctttgcaa 26771



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Minus

                                                                
Query: 392  tccttgtgtatttggtggcagctcttctccaccaggtccaggagcttctcca 443
            |||||||||||||| || |||||||||||||| || || || ||||||||||
Sbjct: 1878 tccttgtgtatttgatgacagctcttctccacaagatcaagcagcttctcca 1827
to top
>gb|AC174293.6| Medicago truncatula clone mth2-70h5, complete sequence
          Length = 132047

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 112/139 (80%)
 Strand = Plus / Plus

                                                                         
Query: 392   tccttgtgtatttggtggcagctcttctccaccaggtccaggagcttctccaggttcgac 451
             |||||||||||||| || |||||||||||||| || || || |||||||||| ||| |  
Sbjct: 20976 tccttgtgtatttgatgacagctcttctccacaagatcaagcagcttctccaagtttgct 21035

                                                                         
Query: 452   gcccacgagttgagcaccccgttgctgtcctgggctgtccggaaggacacgatccccatt 511
             ||||| ||||| || ||  | ||||| ||||  |||||  ||||  | || || ||||||
Sbjct: 21036 gcccatgagttaagtacatcattgctatcctttgctgtttggaaacagactattcccatt 21095

                                
Query: 512   ggtctgtcgatctttgcaa 530
             |||||||| ||||||||||
Sbjct: 21096 ggtctgtcaatctttgcaa 21114



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 46/52 (88%)
 Strand = Plus / Plus

                                                                 
Query: 392   tccttgtgtatttggtggcagctcttctccaccaggtccaggagcttctcca 443
             |||||||||||||| || |||||||||||||| || || || ||||||||||
Sbjct: 46009 tccttgtgtatttgatgacagctcttctccacaagatcaagcagcttctcca 46060
to top
>emb|BX831293.1|CNS0A0PR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTLS76ZC01 of Adult vegetative tissue of strain col-0
            of Arabidopsis thaliana (thale cress)
          Length = 1577

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 157/200 (78%)
 Strand = Plus / Minus

                                                                        
Query: 392  tccttgtgtatttggtggcagctcttctccaccaggtccaggagcttctccaggttcgac 451
            |||||||| ||||||||||| ||||| ||||| || || || ||||||||||  |||   
Sbjct: 1397 tccttgtgaatttggtggcaactcttttccacaagatctagaagcttctccaaattccct 1338

                                                                        
Query: 452  gcccacgagttgagcaccccgttgctgtcctgggctgtccggaaggacacgatccccatt 511
            ||||||||||| || | | ||||||||||||  ||  || ||||| |||| || ||   |
Sbjct: 1337 gcccacgagtttagaatctcgttgctgtcctttgcgatctggaagcacacaattccagat 1278

                                                                        
Query: 512  ggtctgtcgatctttgcaatcaaggcctttgagttcaccatgtccgagatatgcttctct 571
            |||||||| || ||||| ||||  || |||||    ||||| ||||| | ||||||||| 
Sbjct: 1277 ggtctgtctatttttgcgatcagtgcttttgacactaccatctccgatagatgcttctcc 1218

                                
Query: 572  gcctcctgcaagctcaggca 591
            ||||||| || |||||||||
Sbjct: 1217 gcctcctccatgctcaggca 1198
to top
>dbj|AB016893.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MYH9
          Length = 82390

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 148/188 (78%)
 Strand = Plus / Plus

                                                                         
Query: 392   tccttgtgtatttggtggcagctcttctccaccaggtccaggagcttctccaggttcgac 451
             |||||||| ||||||||||| ||||| ||||| || || || ||||||||||  |||   
Sbjct: 42260 tccttgtgaatttggtggcaactcttttccacaagatctagaagcttctccaaattccct 42319

                                                                         
Query: 452   gcccacgagttgagcaccccgttgctgtcctgggctgtccggaaggacacgatccccatt 511
             ||||||||||| || | | ||||||||||||  ||  || ||||| |||| || ||   |
Sbjct: 42320 gcccacgagtttagaatctcgttgctgtcctttgcgatctggaagcacacaattccagat 42379

                                                                         
Query: 512   ggtctgtcgatctttgcaatcaaggcctttgagttcaccatgtccgagatatgcttctct 571
             |||||||| || ||||||||||  || |||||    ||||| ||||| | ||||||||| 
Sbjct: 42380 ggtctgtctatttttgcaatcagtgcttttgacactaccatctccgatagatgcttctcc 42439

                     
Query: 572   gcctcctg 579
             ||||||||
Sbjct: 42440 gcctcctg 42447
to top
>gb|AY347860.1| Malus x domestica clone 10-6 26S proteasome regulatory p55-like
           protein mRNA, partial cds
          Length = 257

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 26/26 (100%)
 Strand = Plus / Minus

                                     
Query: 395 ttgtgtatttggtggcagctcttctc 420
           ||||||||||||||||||||||||||
Sbjct: 62  ttgtgtatttggtggcagctcttctc 37
to top
>gb|AC157977.1| Genomic sequence for Zea mays chromosome 8 BAC clone ZMMBBb0284N04,
             complete sequence
          Length = 107631

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 34/37 (91%)
 Strand = Plus / Plus

                                                  
Query: 539   tttgagttcaccatgtccgagatatgcttctctgcct 575
             ||||||||||||||||| || | ||||||||||||||
Sbjct: 67539 tttgagttcaccatgtctgaaagatgcttctctgcct 67575
to top
>gb|AC009101.7|AC009101 Homo sapiens chromosome 16 clone RP11-439I14, complete sequence
          Length = 172293

 Score = 48.1 bits (24), Expect = 0.034
 Identities = 27/28 (96%)
 Strand = Plus / Plus

                                         
Query: 133   ccaaagaatacaaataatgttcagaaaa 160
             |||||||||||||||||| |||||||||
Sbjct: 56735 ccaaagaatacaaataattttcagaaaa 56762
to top
>ref|XM_413692.1| PREDICTED: Gallus gallus similar to PML isoform 1 (LOC415304), mRNA
          Length = 1578

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 413 ctcttctccaccaggtccaggagcttctcc 442
           |||||||||||||| ||||| |||||||||
Sbjct: 89  ctcttctccaccagctccagcagcttctcc 60
to top
>ref|XM_413690.1| PREDICTED: Gallus gallus similar to ISLR (LOC415302), mRNA
          Length = 2595

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 413 ctcttctccaccaggtccaggagcttctcc 442
           |||||||||||||| ||||| |||||||||
Sbjct: 989 ctcttctccaccagctccagcagcttctcc 960
to top
>emb|AL672186.7| Mouse DNA sequence from clone RP23-42G2 on chromosome X, complete
              sequence
          Length = 205757

 Score = 44.1 bits (22), Expect = 0.54
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 420    ccaccaggtccaggagcttctc 441
              ||||||||||||||||||||||
Sbjct: 105217 ccaccaggtccaggagcttctc 105238
to top
>emb|AL162720.8| Human DNA sequence from clone RP1-132N8 on chromosome 6 Contains a
            pseudogene of the likely ortholog of mouse suppressors of
            cytokine signalling 5 (SOCS5, CIS6, CISH6, KIAA0761),
            complete sequence
          Length = 57355

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 140  atacaaataatgttcagaaaa 160
            |||||||||||||||||||||
Sbjct: 9321 atacaaataatgttcagaaaa 9301
to top
>emb|AL160392.12| Human DNA sequence from clone RP11-121N13 on chromosome 13 Contains the
             5' end of the DCAMKL1 gene for doublecortin and CaM
             kinase-like 1 (DCLK KIAA0369), a novel gene and two CpG
             islands, complete sequence
          Length = 106585

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 339   attcagttcaaaatggttttcaggc 363
             |||||||| ||||||||||||||||
Sbjct: 22090 attcagtttaaaatggttttcaggc 22114
to top
>ref|XM_775319.1| PREDICTED: Strongylocentrotus purpuratus similar to Glycoprotein
           3-alpha-L-fucosyltransferase A (Core
           alpha-(1,3)-fucosyltransferase) (LOC574917), mRNA
          Length = 1089

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 428 tccaggagcttctccaggttc 448
           |||||||||||||||||||||
Sbjct: 563 tccaggagcttctccaggttc 543
to top
>emb|AL139080.11| Human DNA sequence from clone RP11-173N17 on chromosome 13q12.11-12.3
             Contains the 3' end of the MIPEP gene for intermediate
             mitochondrial peptidase and a pseudogene similar to part
             of cytochrome c oxidase III (MTCO3), complete sequence
          Length = 81764

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 468   ccccgttgctgtcctgggctg 488
             |||||||||||||||||||||
Sbjct: 41965 ccccgttgctgtcctgggctg 41945
to top
>emb|BX322643.8| Zebrafish DNA sequence from clone CH211-281E1 in linkage group 21,
             complete sequence
          Length = 153972

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 173   gtattcgtcattccctgtggttacagtat 201
             |||| ||||| ||||||||||||||||||
Sbjct: 24227 gtatgcgtcactccctgtggttacagtat 24199
to top
>gb|AC018517.7| Homo sapiens, clone RP11-115N12, complete sequence
          Length = 180917

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 59    tctcccagcaagcaaatcatt 79
             |||||||||||||||||||||
Sbjct: 15834 tctcccagcaagcaaatcatt 15854
to top
>gb|AC159251.2| Mus musculus BAC clone RP24-113B8 from chromosome 12, complete sequence
          Length = 200896

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 340   ttcagttcaaaatggttttca 360
             |||||||||||||||||||||
Sbjct: 67892 ttcagttcaaaatggttttca 67912
to top
>emb|BX649268.11| Zebrafish DNA sequence from clone DKEY-106J22 in linkage group 21,
              complete sequence
          Length = 172409

 Score = 42.1 bits (21), Expect = 2.1
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                           
Query: 173    gtattcgtcattccctgtggttacagtat 201
              |||| ||||| ||||||||||||||||||
Sbjct: 122786 gtatgcgtcactccctgtggttacagtat 122758
to top
>gb|BC028866.1| Mus musculus jumonji domain containing 2A, mRNA (cDNA clone
           MGC:28562 IMAGE:4207552), complete cds
          Length = 3308

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 415 cttctccaccaggtccagga 434
           ||||||||||||||||||||
Sbjct: 584 cttctccaccaggtccagga 565
to top
>ref|NM_172382.1| Mus musculus jumonji domain containing 2A (Jmjd2a), mRNA
          Length = 3308

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 415 cttctccaccaggtccagga 434
           ||||||||||||||||||||
Sbjct: 584 cttctccaccaggtccagga 565
to top
>gb|AY268184.1| Felis catus cardiac troponin I (TNNI3) mRNA, complete cds
          Length = 755

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 565 cttctctgcctcctgcaagc 584
           ||||||||||||||||||||
Sbjct: 15  cttctctgcctcctgcaagc 34
to top
>gb|AC126429.4| Mus musculus BAC clone RP24-403O23 from chromosome 6, complete sequence
          Length = 152532

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 423    ccaggtccaggagcttctcc 442
              ||||||||||||||||||||
Sbjct: 149926 ccaggtccaggagcttctcc 149945
to top
>gb|AC122519.4| Mus musculus BAC clone RP24-462C10 from chromosome 6, complete sequence
          Length = 138242

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 423    ccaggtccaggagcttctcc 442
              ||||||||||||||||||||
Sbjct: 113516 ccaggtccaggagcttctcc 113497
to top
>gb|AC129314.4| Mus musculus BAC clone RP23-365D12 from chromosome 1, complete sequence
          Length = 200605

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 353   ggttttcaggctttcaacac 372
             ||||||||||||||||||||
Sbjct: 41338 ggttttcaggctttcaacac 41319
to top
>gb|AC122187.3| Mus musculus BAC clone RP23-21P2 from 1, complete sequence
          Length = 252095

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 353    ggttttcaggctttcaacac 372
              ||||||||||||||||||||
Sbjct: 223250 ggttttcaggctttcaacac 223231
to top
>gb|AC110378.4| Mus musculus BAC clone RP24-193H8 from 6, complete sequence
          Length = 166527

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 423   ccaggtccaggagcttctcc 442
             ||||||||||||||||||||
Sbjct: 76993 ccaggtccaggagcttctcc 77012
to top
>emb|AL671986.7| Human DNA sequence from clone RP11-275F13 on chromosome 1 Contains the
             5' end of the C1orf34 gene for chromosome 1 open reading
             frame 34, a novel gene, the 3' end of the EPS15 gene for
             epidermal growth factor receptor pathway substrate 15 and
             a proteasome (prosome macropain) 26S subunit non-ATPase 7
             (Mov34 homolog) (PSMD7) pseudogene, complete sequence
          Length = 113813

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 152   ttcagaaaaatacagcaaatagta 175
             |||||||||||| |||||||||||
Sbjct: 22860 ttcagaaaaatatagcaaatagta 22837
to top
>emb|AL589167.10| Human DNA sequence from clone RP11-236O12 on chromosome Xq13.3-21.2
             Contains an STS and GSSs, complete sequence
          Length = 120255

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 149   atgttcagaaaaatacagca 168
             ||||||||||||||||||||
Sbjct: 29249 atgttcagaaaaatacagca 29268
to top
>emb|AL136976.11| Human DNA sequence from clone RP3-474I3 on chromosome 6 Contains part
             of the novel gene for KIAA1116, complete sequence
          Length = 55012

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 180   tcattccctgtggttacagt 199
             ||||||||||||||||||||
Sbjct: 52058 tcattccctgtggttacagt 52077
to top
>emb|AL138703.10| Human DNA sequence from clone RP11-413N19 on chromosome 13 Contains
             FABP3P2 for fatty acid binding protein 3 pseudogene 2
             (FABP3P, FABP3-PS), complete sequence
          Length = 129866

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 339   attcagttcaaaatggtttt 358
             ||||||||||||||||||||
Sbjct: 34556 attcagttcaaaatggtttt 34575
to top
>gb|AF191797.1| His2 virus, complete genome
          Length = 16067

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 352  tggttttcaggctttcaaca 371
            ||||||||||||||||||||
Sbjct: 8180 tggttttcaggctttcaaca 8199
to top
>dbj|AK001427.1| Homo sapiens cDNA FLJ10565 fis, clone NT2RP2002954
          Length = 2355

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 410  cagctcttctccaccaggtccaggagcttctccagg 445
            |||||| | ||||||||||||| |||| ||||||||
Sbjct: 1316 cagctcctgtccaccaggtccaagagcgtctccagg 1281
to top
>dbj|AK145066.1| Mus musculus mammary gland RCB-0526 Jyg-MC(A) cDNA, RIKEN
           full-length enriched library, clone:G830034N12
           product:jumonji domain containing 2A, full insert
           sequence
          Length = 4607

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 415 cttctccaccaggtccagga 434
           ||||||||||||||||||||
Sbjct: 667 cttctccaccaggtccagga 648
to top
>dbj|AK145947.1| Mus musculus 12 days pregnant adult female placenta cDNA, RIKEN
           full-length enriched library, clone:I530017E21
           product:jumonji domain containing 2A, full insert
           sequence
          Length = 4537

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 415 cttctccaccaggtccagga 434
           ||||||||||||||||||||
Sbjct: 603 cttctccaccaggtccagga 584
to top
>ref|XM_693987.1| PREDICTED: Danio rerio similar to ATP-binding cassette transporter
           sub-family A member 7 (LOC570500), partial mRNA
          Length = 857

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 427 gtccaggagcttctccaggt 446
           ||||||||||||||||||||
Sbjct: 308 gtccaggagcttctccaggt 289
to top
>dbj|AK172196.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched
           library, clone:F830103M15 product:unclassifiable, full
           insert sequence
          Length = 2696

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 423 ccaggtccaggagcttctcc 442
           ||||||||||||||||||||
Sbjct: 540 ccaggtccaggagcttctcc 521
to top
>gb|AC111139.19| Mus musculus chromosome 3, clone RP23-365L12, complete sequence
          Length = 188633

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 428   tccaggagcttctccaggtt 447
             ||||||||||||||||||||
Sbjct: 12727 tccaggagcttctccaggtt 12746
to top
>dbj|AK054095.1| Mus musculus 2 days pregnant adult female oviduct cDNA, RIKEN
           full-length enriched library, clone:E230017M21
           product:weakly similar to GASC-1 PROTEIN [Homo sapiens],
           full insert sequence
          Length = 3268

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 415 cttctccaccaggtccagga 434
           ||||||||||||||||||||
Sbjct: 645 cttctccaccaggtccagga 626
to top
>gb|AC026740.6| Homo sapiens chromosome 5 clone CTD-2589H19, complete sequence
          Length = 201464

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                 
Query: 410   cagctcttctccaccaggtccaggagcttctccagg 445
             |||||| | ||||||||||||| |||| ||||||||
Sbjct: 29357 cagctcctgtccaccaggtccaagagcgtctccagg 29322
to top
>ref|NM_001009237.1| Felis catus troponin I, cardiac (TNNI3), mRNA
          Length = 755

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 565 cttctctgcctcctgcaagc 584
           ||||||||||||||||||||
Sbjct: 15  cttctctgcctcctgcaagc 34
to top
>ref|XM_233441.3| PREDICTED: Rattus norvegicus jumonji domain containing 2A (predicted)
            (Jmjd2a_predicted), mRNA
          Length = 3733

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 415  cttctccaccaggtccagga 434
            ||||||||||||||||||||
Sbjct: 1053 cttctccaccaggtccagga 1034
to top
>gb|AC062016.5| Homo sapiens BAC clone RP11-59P4 from 2, complete sequence
          Length = 187799

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 560   atatgcttctctgcctcctg 579
             ||||||||||||||||||||
Sbjct: 10583 atatgcttctctgcctcctg 10564
to top
>gb|CP000026.1| Salmonella enterica subsp. enterica serovar Paratyphi A str. ATCC 9150
          Length = 4585229

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 239     acaggcgatgctctcacttg 258
               ||||||||||||||||||||
Sbjct: 3633578 acaggcgatgctctcacttg 3633559
to top
>dbj|BS000215.2| Pan troglodytes chromosome 22 clone:RP43-183P07, map 22, complete
              sequences
          Length = 151501

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 402    tttggtggcagctcttctccacca 425
              ||||||||||||||||| ||||||
Sbjct: 120822 tttggtggcagctcttcaccacca 120845
to top
>dbj|BS000216.1| Pan troglodytes chromosome 22 clone:RP43-057N15, map 22, complete
             sequences
          Length = 164711

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 402   tttggtggcagctcttctccacca 425
             ||||||||||||||||| ||||||
Sbjct: 17357 tttggtggcagctcttcaccacca 17380
to top
>dbj|AB040952.1| Homo sapiens mRNA for KIAA1519 protein, partial cds
          Length = 2352

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 410  cagctcttctccaccaggtccaggagcttctccagg 445
            |||||| | ||||||||||||| |||| ||||||||
Sbjct: 1311 cagctcctgtccaccaggtccaagagcgtctccagg 1276
to top
>dbj|AK129187.1| Mus musculus mRNA for mKIAA0677 protein
          Length = 4516

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 415 cttctccaccaggtccagga 434
           ||||||||||||||||||||
Sbjct: 536 cttctccaccaggtccagga 517
to top
>gb|AC147900.2| Xenopus tropicalis clone CH216-53P23, complete sequence
          Length = 157316

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 127   tggataccaaagaatacaaa 146
             ||||||||||||||||||||
Sbjct: 66508 tggataccaaagaatacaaa 66527
to top
>gb|AC004664.1|AC004664 Homo sapiens chromosome 4 clone C0500H20 map 4p16, complete sequence
          Length = 172072

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 126   gtggataccaaagaatacaaataa 149
             ||||| ||||||||||||||||||
Sbjct: 21042 gtggaaaccaaagaatacaaataa 21065
to top
>dbj|AP001699.1| Homo sapiens genomic DNA, chromosome 21q, section 43/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 402   tttggtggcagctcttctccacca 425
             ||||||||||||||||| ||||||
Sbjct: 17419 tttggtggcagctcttcaccacca 17442
to top
>gb|BC001750.1| Homo sapiens centrosomal protein 72kDa, mRNA (cDNA clone MGC:952
            IMAGE:3533449), complete cds
          Length = 2360

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 410  cagctcttctccaccaggtccaggagcttctccagg 445
            |||||| | ||||||||||||| |||| ||||||||
Sbjct: 1299 cagctcctgtccaccaggtccaagagcgtctccagg 1264
to top
>gb|BC000132.2| Homo sapiens centrosomal protein 72kDa, mRNA (cDNA clone MGC:5307
            IMAGE:2899944), complete cds
          Length = 2366

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 410  cagctcttctccaccaggtccaggagcttctccagg 445
            |||||| | ||||||||||||| |||| ||||||||
Sbjct: 1312 cagctcctgtccaccaggtccaagagcgtctccagg 1277
to top
>gb|AC116720.16| Mus musculus chromosome 3, clone RP23-223N19, complete sequence
          Length = 203748

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 428   tccaggagcttctccaggtt 447
             ||||||||||||||||||||
Sbjct: 12247 tccaggagcttctccaggtt 12228
to top
>ref|NM_018140.2| Homo sapiens centrosomal protein 72kDa (CEP72), mRNA
          Length = 2366

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 410  cagctcttctccaccaggtccaggagcttctccagg 445
            |||||| | ||||||||||||| |||| ||||||||
Sbjct: 1312 cagctcctgtccaccaggtccaagagcgtctccagg 1277
to top
>emb|AL626764.6| Mouse DNA sequence from clone RP23-94L18 on chromosome 4, complete
              sequence
          Length = 219582

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 415    cttctccaccaggtccagga 434
              ||||||||||||||||||||
Sbjct: 138765 cttctccaccaggtccagga 138784
to top
>dbj|AP001604.1| Homo sapiens genomic DNA, chromosome 21, clone:KB1648B8, APP-D21S292
             region, complete sequence
          Length = 186930

 Score = 40.1 bits (20), Expect = 8.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 402   tttggtggcagctcttctccacca 425
             ||||||||||||||||| ||||||
Sbjct: 45206 tttggtggcagctcttcaccacca 45229


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,571,566
Number of Sequences: 3902068
Number of extensions: 5571566
Number of successful extensions: 110711
Number of sequences better than 10.0: 72
Number of HSP's better than 10.0 without gapping: 72
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 110535
Number of HSP's gapped (non-prelim): 161
length of query: 614
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 591
effective length of database: 17,143,297,704
effective search space: 10131688943064
effective search space used: 10131688943064
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top