ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd26n17
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AF107258.1| Homo sapiens chromosome 21q22.1 PAC 295E05A, comp... 40 4.3
2gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome 40 4.3
3dbj|AP000237.3| Homo sapiens genomic DNA, chromosome 21 clone:RP... 40 4.3
4dbj|AP001706.1| Homo sapiens genomic DNA, chromosome 21q, sectio... 40 4.3
5dbj|AP000197.1| Homo sapiens genomic DNA, chromosome 21q22.1, D2... 40 4.3
6dbj|AP000093.1| Homo sapiens genomic DNA of 21q22.1, GART and AM... 40 4.3

>gb|AF107258.1| Homo sapiens chromosome 21q22.1 PAC 295E05A, complete sequence
          Length = 154311

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 25    ccagtttcaagtaatggcatgggagagc 52
             |||||||||||| |||||||| ||||||
Sbjct: 17843 ccagtttcaagtcatggcatgagagagc 17816



to top

>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome
          Length = 4892717

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 73      gccgctccatggccgcgtca 92
               ||||||||||||||||||||
Sbjct: 2212668 gccgctccatggccgcgtca 2212649



to top

>dbj|AP000237.3| Homo sapiens genomic DNA, chromosome 21 clone:RP11-269P7, complete
             sequence
          Length = 153265

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 25    ccagtttcaagtaatggcatgggagagc 52
             |||||||||||| |||||||| ||||||
Sbjct: 51881 ccagtttcaagtcatggcatgagagagc 51854



to top

>dbj|AP001706.1| Homo sapiens genomic DNA, chromosome 21q, section 50/105
          Length = 340000

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 25    ccagtttcaagtaatggcatgggagagc 52
             |||||||||||| |||||||| ||||||
Sbjct: 79103 ccagtttcaagtcatggcatgagagagc 79076



to top

>dbj|AP000197.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone
             B355D16-T1073, segment 3/8, complete sequence
          Length = 100000

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 25    ccagtttcaagtaatggcatgggagagc 52
             |||||||||||| |||||||| ||||||
Sbjct: 59893 ccagtttcaagtcatggcatgagagagc 59920



to top

>dbj|AP000093.1| Homo sapiens genomic DNA of 21q22.1, GART and AML related,
             B335D16-P10G11 region, segment 3/7
          Length = 100000

 Score = 40.1 bits (20), Expect = 4.3
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 25    ccagtttcaagtaatggcatgggagagc 52
             |||||||||||| |||||||| ||||||
Sbjct: 59893 ccagtttcaagtcatggcatgagagagc 59920


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,662,812
Number of Sequences: 3902068
Number of extensions: 1662812
Number of successful extensions: 24909
Number of sequences better than 10.0: 6
Number of HSP's better than 10.0 without gapping: 6
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 24891
Number of HSP's gapped (non-prelim): 18
length of query: 325
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 303
effective length of database: 17,147,199,772
effective search space: 5195601530916
effective search space used: 5195601530916
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top