ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd27a24
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK072187.1| Oryza sativa (japonica cultivar-group) cDNA clon... 392 e-106
2dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 291 2e-75
3dbj|AP003511.3| Oryza sativa (japonica cultivar-group) genomic D... 291 2e-75
4gb|AY107212.1| Zea mays PCO081119 mRNA sequence 238 2e-59
5ref|NM_001036796.1| Arabidopsis thaliana 5-formyltetrahydrofolat... 58 4e-05
6ref|NM_121306.2| Arabidopsis thaliana unknown protein AT5G13030 ... 58 4e-05
7gb|BT000882.1| Arabidopsis thaliana clone C105358 unknown protei... 58 4e-05
8gb|AF360158.1| Arabidopsis thaliana unknown protein (At5g13030) ... 58 4e-05
9emb|AL391711.1|ATT19L5 Arabidopsis thaliana DNA chromosome 5, BA... 58 4e-05
10emb|AL353013.1|ATT24H18 Arabidopsis thaliana DNA chromosome 5, B... 58 4e-05
11dbj|AK176734.1| Arabidopsis thaliana mRNA, partial cds, clone: R... 58 4e-05
12dbj|AK176541.1| Arabidopsis thaliana mRNA, partial cds, clone: R... 58 4e-05
13dbj|AK176478.1| Arabidopsis thaliana mRNA, partial cds, clone: R... 58 4e-05
14gb|AC020786.20| Mus musculus chromosome 7, clone RP23-178G8, com... 44 0.60
15gb|AC004099.1|AC004099 Homo sapiens chromosome 17, clone HCIT421... 44 0.60
16gb|AC122290.4| Mus musculus BAC clone RP23-254P19 from chromosom... 42 2.4
17emb|CR388365.9| Zebrafish DNA sequence from clone DKEY-24I24 in ... 42 2.4
18emb|BX248358.1| Corynebacterium diphtheriae gravis NCTC13129, co... 42 2.4
19ref|XM_679060.1| PREDICTED: Danio rerio similar to CG11281-PA (L... 42 2.4
20dbj|AP004529.1| Lotus japonicus genomic DNA, chromosome 1, clone... 42 2.4
21gb|AC171681.1| Mus musculus BAC clone RP24-530O2 from chromosome... 42 2.4
22gb|U80931.1| Caenorhabditis elegans cosmid T01B11, complete sequ... 40 9.4
23gb|AC147676.10| Canis Familiaris, clone XX-25H12, complete sequence 40 9.4
24emb|CT009717.9| Mouse DNA sequence from clone RP23-216H9 on chro... 40 9.4
25gb|AC002492.1|HUAC002492 Human Chromosome 16 BAC clone CIT987SK-... 40 9.4
26gb|AC182644.4| Pan troglodytes BAC clone CH251-64L5 from chromos... 40 9.4
27emb|AL513307.10| Human DNA sequence from clone RP11-239E12 on ch... 40 9.4
28emb|AL450992.17| Human DNA sequence from clone RP11-139D23 on ch... 40 9.4
29emb|AL513013.12| Human DNA sequence from clone RP5-990P15 on chr... 40 9.4
30emb|AL021528.1|HS394P21 Human DNA sequence from clone RP3-394P21... 40 9.4
31emb|BX043317.1|CNS095L5 Single read from an extremity of a full-... 40 9.4
32emb|BX043316.1|CNS095L4 Single read from an extremity of a full-... 40 9.4
33emb|BX019761.1|CNS08NET Single read from an extremity of a full-... 40 9.4
34emb|BX019760.1|CNS08NES Single read from an extremity of a full-... 40 9.4
35emb|BX017326.1|CNS08LJ6 Single read from an extremity of a full-... 40 9.4
36emb|BX011911.1|CNS08HCR Single read from an extremity of a full-... 40 9.4
37emb|BX011910.1|CNS08HCQ Single read from an extremity of a full-... 40 9.4
38emb|BX006760.1|CNS08DDO Single read from an extremity of a full-... 40 9.4
39emb|BX006759.1|CNS08DDN Single read from an extremity of a full-... 40 9.4
40emb|CR380957.1| Candida glabrata strain CBS138 chromosome K comp... 40 9.4
41emb|AJ222775.1|HVJ222775 Hordeum vulgare mRNA for putative heat ... 40 9.4
42gb|AC154324.2| Mus musculus BAC clone RP24-494E12 from chromosom... 40 9.4
43emb|AJ566116.1|DME566116 Drosophila melanogaster retrotransposon... 40 9.4
44gb|AE012439.1| Xanthomonas campestris pv. campestris str. ATCC 3... 40 9.4
45gb|AY561850.1| Drosophila melanogaster TART-A1 retrotransposon g... 40 9.4
46gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, ... 40 9.4
47gb|AC008785.7| Homo sapiens chromosome 16 clone CTD-2036A2, comp... 40 9.4
48gb|AC091489.4| Homo sapiens chromosome 16 clone RP11-164A6, comp... 40 9.4
49gb|AC084642.1|CBRG45J16 Caenorhabditis briggsae cosmid G45J16, c... 40 9.4
50gb|AC136431.3| Homo sapiens chromosome 16 clone RP11-148M17, com... 40 9.4
51gb|AC126760.4| Homo sapiens chromosome 16 clone RP11-1307B12, co... 40 9.4
52ref|XM_316417.2| Anopheles gambiae str. PEST ENSANGP00000021015 ... 40 9.4
53gb|AC153555.5| Mus musculus 10 BAC RP23-193J20 (Roswell Park Can... 40 9.4
54gb|AC130720.3| Mus musculus BAC clone RP24-292B4 from chromosome... 40 9.4
55gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome 40 9.4
56emb|CR962121.2| Medicago truncatula chromosome 5 clone mte1-77f5... 40 9.4
57dbj|AP006101.1| Lotus japonicus genomic DNA, chromosome 1, clone... 40 9.4
58gb|AC170917.2| Mus musculus BAC clone RP23-160F6 from chromosome... 40 9.4
59emb|AL662895.7| Mouse DNA sequence from clone RP23-340L19 on chr... 40 9.4 
>dbj|AK072187.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013145E07, full
            insert sequence
          Length = 2237

 Score =  392 bits (198), Expect = e-106
 Identities = 345/394 (87%)
 Strand = Plus / Minus

                                                                        
Query: 294  gtttcatgacgagcaggatagcatgcacaccccaggcctgtatgcccaggccggtggcaa 353
            ||||||||| |||||||| ||||||||||| || ||||||||||||||||| ||||||||
Sbjct: 1888 gtttcatgatgagcaggacagcatgcacactcctggcctgtatgcccaggctggtggcaa 1829

                                                                        
Query: 354  gcgggcgtatttctccattcccggctgctcatcatatggatgttccataactttcaatag 413
             ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| 
Sbjct: 1828 ccgggcatatttctccattcctggctgctcatcatatggatgttccataactttcaataa 1769

                                                                        
Query: 414  ccggcgaacttcctcgtaatcacctagatcagctgcgtcaatcgctgtctggcagagata 473
            ||| |||||||| || ||||||||| | |||||||||||||| || ||||||||||||||
Sbjct: 1768 ccgacgaacttcatcataatcaccttgctcagctgcgtcaattgcagtctggcagagata 1709

                                                                        
Query: 474  gttccgaagaacatactttgggttgacacggttcattgccgctttcctttcttcatcaga 533
            ||||||||||||||||||||| || |||  |||||| || |||||||||||||| |||| 
Sbjct: 1708 gttccgaagaacatactttggattaacagagttcatggcagctttcctttcttcgtcagg 1649

                                                                        
Query: 534  gacaccgctagccaccagttcctcaatatatgtttgtacccaactaatccatgcttcttt 593
             || || || |  ||||  || ||||| || |||||||||||||||||||||||||| ||
Sbjct: 1648 aacgccacttgaaaccaactcttcaatgtaagtttgtacccaactaatccatgcttcctt 1589

                                                                        
Query: 594  tctttctttcccaatatccaggagtgcagcttttattggaacaagtagctcagtttctgg 653
            |||||||   |||||||| |||||||||||||| | |||||||||||||||  | |||||
Sbjct: 1588 tctttctggtccaatatctaggagtgcagctttaagtggaacaagtagctccttctctgg 1529

                                              
Query: 654  gatgtcacggtctgctttgacattcgaaagaaga 687
             |||| | |||||||||||||||| |||||||||
Sbjct: 1528 aatgttatggtctgctttgacatttgaaagaaga 1495
to top
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  291 bits (147), Expect = 2e-75
 Identities = 216/239 (90%)
 Strand = Plus / Plus

                                                                            
Query: 294      gtttcatgacgagcaggatagcatgcacaccccaggcctgtatgcccaggccggtggcaa 353
                ||||||||| |||||||| ||||||||||| || ||||||||||||||||| ||||||||
Sbjct: 12299932 gtttcatgatgagcaggacagcatgcacactcctggcctgtatgcccaggctggtggcaa 12299991

                                                                            
Query: 354      gcgggcgtatttctccattcccggctgctcatcatatggatgttccataactttcaatag 413
                 ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| 
Sbjct: 12299992 ccgggcatatttctccattcctggctgctcatcatatggatgttccataactttcaataa 12300051

                                                                            
Query: 414      ccggcgaacttcctcgtaatcacctagatcagctgcgtcaatcgctgtctggcagagata 473
                ||| |||||||| || ||||||||| | |||||||||||||| || ||||||||||||||
Sbjct: 12300052 ccgacgaacttcatcataatcaccttgctcagctgcgtcaattgcagtctggcagagata 12300111

                                                                           
Query: 474      gttccgaagaacatactttgggttgacacggttcattgccgctttcctttcttcatcag 532
                ||||||||||||||||||||| || |||  |||||| || |||||||||||||| ||||
Sbjct: 12300112 gttccgaagaacatactttggattaacagagttcatggcagctttcctttcttcgtcag 12300170



 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Plus

                                                                            
Query: 556      tcaatatatgtttgtacccaactaatccatgcttcttttctttctttcccaatatccagg 615
                ||||| || |||||||||||||||||||||||||| |||||||||   |||||||| |||
Sbjct: 12300717 tcaatgtaagtttgtacccaactaatccatgcttcctttctttctggtccaatatctagg 12300776

                                                                            
Query: 616      agtgcagcttttattggaacaagtagctcagtttctgggatgtcacggtctgctttgaca 675
                ||||||||||| | |||||||||||||||  | ||||| |||| | ||||||||||||||
Sbjct: 12300777 agtgcagctttaagtggaacaagtagctccttctctggaatgttatggtctgctttgaca 12300836

                            
Query: 676      ttcgaaagaaga 687
                || |||||||||
Sbjct: 12300837 tttgaaagaaga 12300848
to top
>dbj|AP003511.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0578B12
          Length = 151192

 Score =  291 bits (147), Expect = 2e-75
 Identities = 216/239 (90%)
 Strand = Plus / Plus

                                                                         
Query: 294   gtttcatgacgagcaggatagcatgcacaccccaggcctgtatgcccaggccggtggcaa 353
             ||||||||| |||||||| ||||||||||| || ||||||||||||||||| ||||||||
Sbjct: 16392 gtttcatgatgagcaggacagcatgcacactcctggcctgtatgcccaggctggtggcaa 16451

                                                                         
Query: 354   gcgggcgtatttctccattcccggctgctcatcatatggatgttccataactttcaatag 413
              ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||| 
Sbjct: 16452 ccgggcatatttctccattcctggctgctcatcatatggatgttccataactttcaataa 16511

                                                                         
Query: 414   ccggcgaacttcctcgtaatcacctagatcagctgcgtcaatcgctgtctggcagagata 473
             ||| |||||||| || ||||||||| | |||||||||||||| || ||||||||||||||
Sbjct: 16512 ccgacgaacttcatcataatcaccttgctcagctgcgtcaattgcagtctggcagagata 16571

                                                                        
Query: 474   gttccgaagaacatactttgggttgacacggttcattgccgctttcctttcttcatcag 532
             ||||||||||||||||||||| || |||  |||||| || |||||||||||||| ||||
Sbjct: 16572 gttccgaagaacatactttggattaacagagttcatggcagctttcctttcttcgtcag 16630



 Score =  135 bits (68), Expect = 2e-28
 Identities = 116/132 (87%)
 Strand = Plus / Plus

                                                                         
Query: 556   tcaatatatgtttgtacccaactaatccatgcttcttttctttctttcccaatatccagg 615
             ||||| || |||||||||||||||||||||||||| |||||||||   |||||||| |||
Sbjct: 17177 tcaatgtaagtttgtacccaactaatccatgcttcctttctttctggtccaatatctagg 17236

                                                                         
Query: 616   agtgcagcttttattggaacaagtagctcagtttctgggatgtcacggtctgctttgaca 675
             ||||||||||| | |||||||||||||||  | ||||| |||| | ||||||||||||||
Sbjct: 17237 agtgcagctttaagtggaacaagtagctccttctctggaatgttatggtctgctttgaca 17296

                         
Query: 676   ttcgaaagaaga 687
             || |||||||||
Sbjct: 17297 tttgaaagaaga 17308
to top
>gb|AY107212.1| Zea mays PCO081119 mRNA sequence
          Length = 1323

 Score =  238 bits (120), Expect = 2e-59
 Identities = 318/384 (82%)
 Strand = Plus / Minus

                                                                        
Query: 304  gagcaggatagcatgcacaccccaggcctgtatgcccaggccggtggcaagcgggcgtat 363
            |||||||| ||||||||||| ||||| ||||||||||| || |||||||| || || |||
Sbjct: 1099 gagcaggacagcatgcacactccaggtctgtatgcccaagctggtggcaaccgtgcatat 1040

                                                                        
Query: 364  ttctccattcccggctgctcatcatatggatgttccataactttcaatagccggcgaact 423
            |||||||||||||||||||| ||||| ||||  | ||| ||  | |  | ||||||||| 
Sbjct: 1039 ttctccattcccggctgctcgtcatacggattatgcattaccctaagcacccggcgaacc 980

                                                                        
Query: 424  tcctcgtaatcacctagatcagctgcgtcaatcgctgtctggcagagatagttccgaaga 483
            ||||||||||| ||| | |||||| |||| || || | ||||||||||||||| || |||
Sbjct: 979  tcctcgtaatcgccttgctcagctacgtcgatagcagactggcagagatagttgcggaga 920

                                                                        
Query: 484  acatactttgggttgacacggttcattgccgctttcctttcttcatcagagacaccgcta 543
            | ||||||||| || |||  |||||| || |||||||||||||||||||  || ||||| 
Sbjct: 919  atatactttggattaacagagttcatcgcggctttcctttcttcatcaggaacgccgctc 860

                                                                        
Query: 544  gccaccagttcctcaatatatgtttgtacccaactaatccatgcttcttttctttctttc 603
             ||||||| || |||||||| || ||||||||||||||||||||||| || |||||||||
Sbjct: 859  tccaccagctcttcaatataagtctgtacccaactaatccatgcttccttcctttctttc 800

                                                                        
Query: 604  ccaatatccaggagtgcagcttttattggaacaagtagctcagtttctgggatgtcacgg 663
            |||||||| ||||| ||||| || | ||| ||||| |||||| | || || ||  || | 
Sbjct: 799  ccaatatctaggagagcagccttcagtgggacaagcagctcattctccggaataccagga 740

                                    
Query: 664  tctgctttgacattcgaaagaaga 687
            || || ||||||||||||||||||
Sbjct: 739  tccgcattgacattcgaaagaaga 716
to top
>ref|NM_001036796.1| Arabidopsis thaliana 5-formyltetrahydrofolate cyclo-ligase AT5G13050
            transcript variant AT5G13050.2 mRNA, complete cds
          Length = 1547

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Plus

                                                                        
Query: 313  agcatgcacaccccaggcctgtatgcccaggccggtggcaagcgggcgtatttctccatt 372
            |||||||| || || |||||||| |||||||| || ||||| || || ||||||||||| 
Sbjct: 1307 agcatgcagacgcctggcctgtaagcccaggcaggaggcaaccgagcatatttctccatc 1366

                             
Query: 373  cccggctgctcatcata 389
            |||||||| || |||||
Sbjct: 1367 cccggctgttcctcata 1383
to top
>ref|NM_121306.2| Arabidopsis thaliana unknown protein AT5G13030 mRNA, complete cds
          Length = 2359

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                        
Query: 313  agcatgcacaccccaggcctgtatgcccaggccggtggcaagcgggcgtatttctccatt 372
            |||||||| || || |||||||| |||||||| || ||||| || || ||||||||||| 
Sbjct: 1886 agcatgcagacgcctggcctgtaagcccaggcaggaggcaaccgagcatatttctccatc 1827

                             
Query: 373  cccggctgctcatcata 389
            |||||||| || |||||
Sbjct: 1826 cccggctgttcctcata 1810
to top
>gb|BT000882.1| Arabidopsis thaliana clone C105358 unknown protein (At5g13030) mRNA,
            complete cds
          Length = 1933

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                        
Query: 313  agcatgcacaccccaggcctgtatgcccaggccggtggcaagcgggcgtatttctccatt 372
            |||||||| || || |||||||| |||||||| || ||||| || || ||||||||||| 
Sbjct: 1886 agcatgcagacgcctggcctgtaagcccaggcaggaggcaaccgagcatatttctccatc 1827

                             
Query: 373  cccggctgctcatcata 389
            |||||||| || |||||
Sbjct: 1826 cccggctgttcctcata 1810
to top
>gb|AF360158.1| Arabidopsis thaliana unknown protein (At5g13030) mRNA, complete cds
          Length = 2074

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                        
Query: 313  agcatgcacaccccaggcctgtatgcccaggccggtggcaagcgggcgtatttctccatt 372
            |||||||| || || |||||||| |||||||| || ||||| || || ||||||||||| 
Sbjct: 1881 agcatgcagacgcctggcctgtaagcccaggcaggaggcaaccgagcatatttctccatc 1822

                             
Query: 373  cccggctgctcatcata 389
            |||||||| || |||||
Sbjct: 1821 cccggctgttcctcata 1805
to top
>emb|AL391711.1|ATT19L5 Arabidopsis thaliana DNA chromosome 5, BAC clone T19L5 (ESSA project)
          Length = 82207

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                        
Query: 313  agcatgcacaccccaggcctgtatgcccaggccggtggcaagcgggcgtatttctccatt 372
            |||||||| || || |||||||| |||||||| || ||||| || || ||||||||||| 
Sbjct: 9771 agcatgcagacgcctggcctgtaagcccaggcaggaggcaaccgagcatatttctccatc 9712

                             
Query: 373  cccggctgctcatcata 389
            |||||||| || |||||
Sbjct: 9711 cccggctgttcctcata 9695
to top
>emb|AL353013.1|ATT24H18 Arabidopsis thaliana DNA chromosome 5, BAC clone T24H18 (ESSA project)
          Length = 90020

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                         
Query: 313   agcatgcacaccccaggcctgtatgcccaggccggtggcaagcgggcgtatttctccatt 372
             |||||||| || || |||||||| |||||||| || ||||| || || ||||||||||| 
Sbjct: 88262 agcatgcagacgcctggcctgtaagcccaggcaggaggcaaccgagcatatttctccatc 88203

                              
Query: 373   cccggctgctcatcata 389
             |||||||| || |||||
Sbjct: 88202 cccggctgttcctcata 88186
to top
>dbj|AK176734.1| Arabidopsis thaliana mRNA, partial cds, clone: RAFL25-27-N17
          Length = 2066

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                        
Query: 313  agcatgcacaccccaggcctgtatgcccaggccggtggcaagcgggcgtatttctccatt 372
            |||||||| || || |||||||| |||||||| || ||||| || || ||||||||||| 
Sbjct: 1884 agcatgcagacgcctggcctgtaagcccaggcaggaggcaaccgagcatatttctccatc 1825

                             
Query: 373  cccggctgctcatcata 389
            |||||||| || |||||
Sbjct: 1824 cccggctgttcctcata 1808
to top
>dbj|AK176541.1| Arabidopsis thaliana mRNA, partial cds, clone: RAFL25-06-C11
          Length = 2064

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                        
Query: 313  agcatgcacaccccaggcctgtatgcccaggccggtggcaagcgggcgtatttctccatt 372
            |||||||| || || |||||||| |||||||| || ||||| || || ||||||||||| 
Sbjct: 1884 agcatgcagacgcctggcctgtaagcccaggcaggaggcaaccgagcatatttctccatc 1825

                             
Query: 373  cccggctgctcatcata 389
            |||||||| || |||||
Sbjct: 1824 cccggctgttcctcata 1808
to top
>dbj|AK176478.1| Arabidopsis thaliana mRNA, partial cds, clone: RAFL24-27-O06
          Length = 2066

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 65/77 (84%)
 Strand = Plus / Minus

                                                                        
Query: 313  agcatgcacaccccaggcctgtatgcccaggccggtggcaagcgggcgtatttctccatt 372
            |||||||| || || |||||||| |||||||| || ||||| || || ||||||||||| 
Sbjct: 1878 agcatgcagacgcctggcctgtaagcccaggcaggaggcaaccgagcatatttctccatc 1819

                             
Query: 373  cccggctgctcatcata 389
            |||||||| || |||||
Sbjct: 1818 cccggctgttcctcata 1802
to top
>gb|AC020786.20| Mus musculus chromosome 7, clone RP23-178G8, complete sequence
          Length = 227330

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 587   cttcttttctttctttcccaat 608
             ||||||||||||||||||||||
Sbjct: 85555 cttcttttctttctttcccaat 85576
to top
>gb|AC004099.1|AC004099 Homo sapiens chromosome 17, clone HCIT421K24, complete sequence
          Length = 136222

 Score = 44.1 bits (22), Expect = 0.60
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 140   aagccaaggcaacaaacaacag 161
             ||||||||||||||||||||||
Sbjct: 60600 aagccaaggcaacaaacaacag 60579
to top
>gb|AC122290.4| Mus musculus BAC clone RP23-254P19 from chromosome 14, complete
             sequence
          Length = 163287

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 599   ctttcccaatatccaggagtg 619
             |||||||||||||||||||||
Sbjct: 11350 ctttcccaatatccaggagtg 11370
to top
>emb|CR388365.9| Zebrafish DNA sequence from clone DKEY-24I24 in linkage group 16,
             complete sequence
          Length = 150795

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 597   ttctttcccaatatccaggag 617
             |||||||||||||||||||||
Sbjct: 48403 ttctttcccaatatccaggag 48423
to top
>emb|BX248358.1| Corynebacterium diphtheriae gravis NCTC13129, complete genome; segment
             5/8
          Length = 348408

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 653   ggatgtcacggtctgctttga 673
             |||||||||||||||||||||
Sbjct: 85066 ggatgtcacggtctgctttga 85086
to top
>ref|XM_679060.1| PREDICTED: Danio rerio similar to CG11281-PA (LOC556296), mRNA
          Length = 1863

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 597  ttctttcccaatatccaggag 617
            |||||||||||||||||||||
Sbjct: 1452 ttctttcccaatatccaggag 1432
to top
>dbj|AP004529.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT01K12, TM0058a,
             complete sequence
          Length = 78249

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 584   atgcttcttttctttctttcc 604
             |||||||||||||||||||||
Sbjct: 37319 atgcttcttttctttctttcc 37339
to top
>gb|AC171681.1| Mus musculus BAC clone RP24-530O2 from chromosome 14, complete sequence
          Length = 198038

 Score = 42.1 bits (21), Expect = 2.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 599    ctttcccaatatccaggagtg 619
              |||||||||||||||||||||
Sbjct: 173084 ctttcccaatatccaggagtg 173104
to top
>gb|U80931.1| Caenorhabditis elegans cosmid T01B11, complete sequence
          Length = 31334

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 589   tcttttctttctttcccaat 608
             ||||||||||||||||||||
Sbjct: 16902 tcttttctttctttcccaat 16921
to top
>gb|AC147676.10| Canis Familiaris, clone XX-25H12, complete sequence
          Length = 203436

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 515    ctttcctttcttcatcagagacac 538
              ||||||||||||||| ||||||||
Sbjct: 116560 ctttcctttcttcatgagagacac 116583
to top
>emb|CT009717.9| Mouse DNA sequence from clone RP23-216H9 on chromosome 13, complete
             sequence
          Length = 220233

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 584   atgcttcttttctttctttc 603
             ||||||||||||||||||||
Sbjct: 22082 atgcttcttttctttctttc 22101
to top
>gb|AC002492.1|HUAC002492 Human Chromosome 16 BAC clone CIT987SK-A-256A9, complete sequence
          Length = 179245

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 583    catgcttcttttctttcttt 602
              ||||||||||||||||||||
Sbjct: 109618 catgcttcttttctttcttt 109637
to top
>gb|AC182644.4| Pan troglodytes BAC clone CH251-64L5 from chromosome 4, complete
             sequence
          Length = 157801

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 382   tcatcatatggatgttccat 401
             ||||||||||||||||||||
Sbjct: 22587 tcatcatatggatgttccat 22568
to top
>emb|AL513307.10| Human DNA sequence from clone RP11-239E12 on chromosome 1, complete
             sequence
          Length = 168544

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 584   atgcttcttttctttctttc 603
             ||||||||||||||||||||
Sbjct: 19198 atgcttcttttctttctttc 19217
to top
>emb|AL450992.17| Human DNA sequence from clone RP11-139D23 on chromosome 1 Contains two
             novel genes (FLJ37964), the gene for C-terminal modulator
             protein (CTMP), a keratin 8 (KRT8) pseudogene, the S100A10
             gene for S100 calcium binding protein A10 (annexin II
             ligand, calpactin I, light polypeptide (p11)), the 5' end
             of a novel gene, a novel pseudogene and a CpG island,
             complete sequence
          Length = 185447

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 588   ttcttttctttctttcccaa 607
             ||||||||||||||||||||
Sbjct: 64193 ttcttttctttctttcccaa 64174
to top
>emb|AL513013.12| Human DNA sequence from clone RP5-990P15 on chromosome 1 Contains the
             5' end of a novel gene, a novel gene (DKFZp564J047), two
             novel genes and a CpG island, complete sequence
          Length = 77001

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 583   catgcttcttttctttcttt 602
             ||||||||||||||||||||
Sbjct: 31372 catgcttcttttctttcttt 31353
to top
>emb|AL021528.1|HS394P21 Human DNA sequence from clone RP3-394P21 on chromosome 1p36.12-36.13
             Contains the PAX7 gene for Paired box gene 7 and two CpG
             islands, complete sequence
          Length = 136124

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 584   atgcttcttttctttctttc 603
             ||||||||||||||||||||
Sbjct: 88683 atgcttcttttctttctttc 88702
to top
>emb|BX043317.1|CNS095L5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAC15DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 829

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 336 tgcccaggccggtggcaagc 355
           ||||||||||||||||||||
Sbjct: 603 tgcccaggccggtggcaagc 584
to top
>emb|BX043316.1|CNS095L4 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAC15DD09 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 927

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 336 tgcccaggccggtggcaagc 355
           ||||||||||||||||||||
Sbjct: 718 tgcccaggccggtggcaagc 737
to top
>emb|BX019761.1|CNS08NET Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA3AF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 968

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 336 tgcccaggccggtggcaagc 355
           ||||||||||||||||||||
Sbjct: 691 tgcccaggccggtggcaagc 672
to top
>emb|BX019760.1|CNS08NES Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA3AF04 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 923

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 336 tgcccaggccggtggcaagc 355
           ||||||||||||||||||||
Sbjct: 725 tgcccaggccggtggcaagc 744
to top
>emb|BX017326.1|CNS08LJ6 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA26AD06 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 753

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 336 tgcccaggccggtggcaagc 355
           ||||||||||||||||||||
Sbjct: 669 tgcccaggccggtggcaagc 650
to top
>emb|BX011911.1|CNS08HCR Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA19AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 877

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 336 tgcccaggccggtggcaagc 355
           ||||||||||||||||||||
Sbjct: 537 tgcccaggccggtggcaagc 518
to top
>emb|BX011910.1|CNS08HCQ Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA19AA02 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 850

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 336 tgcccaggccggtggcaagc 355
           ||||||||||||||||||||
Sbjct: 734 tgcccaggccggtggcaagc 753
to top
>emb|BX006760.1|CNS08DDO Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 3-PRIME end of
           clone FK0AAA11BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1024

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 336 tgcccaggccggtggcaagc 355
           ||||||||||||||||||||
Sbjct: 580 tgcccaggccggtggcaagc 561
to top
>emb|BX006759.1|CNS08DDN Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA11BE11 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 1005

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 336 tgcccaggccggtggcaagc 355
           ||||||||||||||||||||
Sbjct: 770 tgcccaggccggtggcaagc 789
to top
>emb|CR380957.1| Candida glabrata strain CBS138 chromosome K complete sequence
          Length = 1302002

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 242    ctatacagcccaaaaaagtataca 265
              |||| |||||||||||||||||||
Sbjct: 433874 ctattcagcccaaaaaagtataca 433851
to top
>emb|AJ222775.1|HVJ222775 Hordeum vulgare mRNA for putative heat shock cognate protein, clone
           RG12
          Length = 330

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 658 tcacggtctgctttgacatt 677
           ||||||||||||||||||||
Sbjct: 169 tcacggtctgctttgacatt 188
to top
>gb|AC154324.2| Mus musculus BAC clone RP24-494E12 from chromosome 14, complete
             sequence
          Length = 198197

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 584   atgcttcttttctttctttc 603
             ||||||||||||||||||||
Sbjct: 95742 atgcttcttttctttctttc 95723
to top
>emb|AJ566116.1|DME566116 Drosophila melanogaster retrotransposon TART-A, clone 17G23
          Length = 15576

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                         
Query: 576   actaatccatgcttcttttctttctttc 603
             ||||||||||||||| ||||||||||||
Sbjct: 11601 actaatccatgcttc-tttctttctttc 11575



 Score = 40.1 bits (20), Expect = 9.4
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                       
Query: 576 actaatccatgcttcttttctttctttc 603
           ||||||||||||||| ||||||||||||
Sbjct: 454 actaatccatgcttc-tttctttctttc 428
to top
>gb|AE012439.1| Xanthomonas campestris pv. campestris str. ATCC 33913,  section 347
            of 460 of the complete genome
          Length = 11447

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 363  tttctccattcccggctgct 382
            ||||||||||||||||||||
Sbjct: 2283 tttctccattcccggctgct 2264
to top
>gb|AY561850.1| Drosophila melanogaster TART-A1 retrotransposon gag protein and pol
            protein genes, complete cds
          Length = 13424

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Minus

                                        
Query: 576  actaatccatgcttcttttctttctttc 603
            ||||||||||||||| ||||||||||||
Sbjct: 9426 actaatccatgcttc-tttctttctttc 9400
to top
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome
          Length = 5148708

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 363     tttctccattcccggctgct 382
               ||||||||||||||||||||
Sbjct: 1115509 tttctccattcccggctgct 1115490
to top
>gb|AC008785.7| Homo sapiens chromosome 16 clone CTD-2036A2, complete sequence
          Length = 185030

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 583   catgcttcttttctttcttt 602
             ||||||||||||||||||||
Sbjct: 53520 catgcttcttttctttcttt 53501
to top
>gb|AC091489.4| Homo sapiens chromosome 16 clone RP11-164A6, complete sequence
          Length = 150214

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 583    catgcttcttttctttcttt 602
              ||||||||||||||||||||
Sbjct: 124918 catgcttcttttctttcttt 124899
to top
>gb|AC084642.1|CBRG45J16 Caenorhabditis briggsae cosmid G45J16, complete sequence
          Length = 41451

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 590   cttttctttctttcccaata 609
             ||||||||||||||||||||
Sbjct: 19318 cttttctttctttcccaata 19337
to top
>gb|AC136431.3| Homo sapiens chromosome 16 clone RP11-148M17, complete sequence
          Length = 168721

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 583   catgcttcttttctttcttt 602
             ||||||||||||||||||||
Sbjct: 96829 catgcttcttttctttcttt 96810
to top
>gb|AC126760.4| Homo sapiens chromosome 16 clone RP11-1307B12, complete sequence
          Length = 211419

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 583    catgcttcttttctttcttt 602
              ||||||||||||||||||||
Sbjct: 159829 catgcttcttttctttcttt 159810
to top
>ref|XM_316417.2| Anopheles gambiae str. PEST ENSANGP00000021015
           (ENSANGG00000018526), partial mRNA
          Length = 1353

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 336 tgcccaggccggtggcaagc 355
           ||||||||||||||||||||
Sbjct: 759 tgcccaggccggtggcaagc 778
to top
>gb|AC153555.5| Mus musculus 10 BAC RP23-193J20 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 208079

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 587    cttcttttctttctttccca 606
              ||||||||||||||||||||
Sbjct: 189762 cttcttttctttctttccca 189781
to top
>gb|AC130720.3| Mus musculus BAC clone RP24-292B4 from chromosome 1, complete sequence
          Length = 176143

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 326   caggcctgtatgcccaggcc 345
             ||||||||||||||||||||
Sbjct: 39189 caggcctgtatgcccaggcc 39170
to top
>gb|AE008384.1| Methanosarcina mazei strain Goe1, complete genome
          Length = 4096345

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 585     tgcttcttttctttctttcc 604
               ||||||||||||||||||||
Sbjct: 1528439 tgcttcttttctttctttcc 1528420
to top
>emb|CR962121.2| Medicago truncatula chromosome 5 clone mte1-77f5, COMPLETE SEQUENCE
          Length = 107392

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 149   caacaaacaacagcataact 168
             ||||||||||||||||||||
Sbjct: 83828 caacaaacaacagcataact 83847
to top
>dbj|AP006101.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT09A07, TM0181,
           complete sequence
          Length = 185320

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 583 catgcttcttttctttcttt 602
           ||||||||||||||||||||
Sbjct: 388 catgcttcttttctttcttt 369
to top
>gb|AC170917.2| Mus musculus BAC clone RP23-160F6 from chromosome 1, complete sequence
          Length = 195784

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 326   caggcctgtatgcccaggcc 345
             ||||||||||||||||||||
Sbjct: 72857 caggcctgtatgcccaggcc 72838
to top
>emb|AL662895.7| Mouse DNA sequence from clone RP23-340L19 on chromosome 11, complete
             sequence
          Length = 214811

 Score = 40.1 bits (20), Expect = 9.4
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 387   atatggatgttccataactttcaatagc 414
             ||||||||| |||||||||||| |||||
Sbjct: 58448 atatggatgatccataactttctatagc 58475


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,874,807
Number of Sequences: 3902068
Number of extensions: 7874807
Number of successful extensions: 181243
Number of sequences better than 10.0: 59
Number of HSP's better than 10.0 without gapping: 57
Number of HSP's successfully gapped in prelim test: 2
Number of HSP's that attempted gapping in prelim test: 180964
Number of HSP's gapped (non-prelim): 281
length of query: 687
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 664
effective length of database: 17,143,297,704
effective search space: 11383149675456
effective search space used: 11383149675456
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top