ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd26l16
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1ref|XM_480372.1| Oryza sativa (japonica cultivar-group), mRNA 40 2.2
2ref|XM_896987.2| PREDICTED: Mus musculus microtubule associated ... 40 2.2
3ref|XM_923668.2| PREDICTED: Mus musculus microtubule associated ... 40 2.2
4ref|XM_949167.1| Theileria annulata strain Ankara hypothetical p... 40 2.2
5gb|AC165290.2| Mus musculus BAC clone RP23-343A4 from chromosome... 40 2.2
6emb|CR788323.5| Zebrafish DNA sequence from clone DKEYP-71G11 in... 40 2.2
7gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hilde... 40 2.2
8dbj|AK046702.1| Mus musculus 4 days neonate male adipose cDNA, R... 40 2.2
9dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.2
10dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 2.2
11dbj|AP004692.2| Oryza sativa (japonica cultivar-group) genomic D... 40 2.2
12dbj|AK121489.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 2.2
13emb|AL662992.3|OSJN00193 Oryza sativa genomic DNA, chromosome 4,... 40 2.2
14emb|AL606620.3|OSJN00065 Oryza sativa genomic DNA, chromosome 4,... 40 2.2
15gb|AC167975.3| Mus musculus BAC clone RP23-171A14 from chromosom... 40 2.2
16ref|XM_528105.1| PREDICTED: Pan troglodytes similar to neureguli... 38 8.8
17ref|NM_013962.1| Homo sapiens neuregulin 1 (NRG1), transcript va... 38 8.8
18gb|AC154422.2| Mus musculus BAC clone RP24-218O2 from chromosome... 38 8.8
19emb|BX640540.3| Chicken DNA sequence from clone WAG-124D2, compl... 38 8.8
20ref|XM_649491.1| Entamoeba histolytica HM-1:IMSS amino acid tran... 38 8.8
21gb|AE017245.1| Mycoplasma synoviae 53, complete genome 38 8.8
22emb|AL732290.4| Human DNA sequence from clone CTD-2338C19 on chr... 38 8.8
23gb|AF491780.1| Homo sapiens neuregulin 1 (NRG1) gene, partial cd... 38 8.8
24emb|AL354919.16| Human DNA sequence from clone RP11-84A19 on chr... 38 8.8
25gb|AC133618.3| Rattus norvegicus 18 BAC CH230-71N8 (Children's H... 38 8.8
26emb|CR381585.11| Zebrafish DNA sequence from clone DKEY-27P7 in ... 38 8.8
27gb|AC087341.4| Homo sapiens chromosome 8, clone RP11-381I15, com... 38 8.8
28gb|AC104029.5| Homo sapiens chromosome 8, clone RP11-478B14, com... 38 8.8
29gb|AF188026.4| Homo sapiens chromosome 8 clone CTD-2373L20 map 8... 38 8.8
30gb|AC104000.5| Homo sapiens chromosome 8, clone RP11-97N12, comp... 38 8.8
31gb|AC090776.3| Homo sapiens chromosome 8, clone CTD-2373L20, com... 38 8.8
32gb|AC007860.6| Homo sapiens 8 BAC RP11-709E21 (Roswell Park Canc... 38 8.8
33ref|XM_926044.1| PREDICTED: Homo sapiens similar to neuregulin 1... 38 8.8
34emb|BX322574.10| Zebrafish DNA sequence from clone DKEY-35I15 in... 38 8.8
35tpg|BK000383.1| TPA: TPA_exp: Homo sapiens neuregulin 1 isoform ... 38 8.8
36gb|AC009956.12| Homo sapiens BAC clone RP11-195F23 from 2, compl... 38 8.8
37dbj|AB006902.2| Acinetobacter sp. NCIMB9871 cyclohexanol metabol... 38 8.8
38emb|CT824641.5| Human DNA sequence from clone XX-HCC1954_31F14, ... 38 8.8
39emb|AL808147.21| Mouse DNA sequence from clone RP23-80N9 on chro... 38 8.8
40gb|L12260.1|HUMGGF2A Human recombinant glial growth factor 2 mRN... 38 8.8
41emb|AL606903.8| Mouse DNA sequence from clone RP23-278I3 on chro... 38 8.8 
>ref|XM_480372.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1980

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 2    gaatttaagattgcatatgttttgcatttaca 33
            ||||||||||||||   |||||||||||||||
Sbjct: 1979 gaatttaagattgctactgttttgcatttaca 1948
to top
>ref|XM_896987.2| PREDICTED: Mus musculus microtubule associated serine/threonine
            kinase family member 4, transcript variant 2 (Mast4),
            mRNA
          Length = 3990

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 141  tctacagctagggagggagg 160
            ||||||||||||||||||||
Sbjct: 2578 tctacagctagggagggagg 2559
to top
>ref|XM_923668.2| PREDICTED: Mus musculus microtubule associated serine/threonine
            kinase family member 4, transcript variant 8 (Mast4),
            mRNA
          Length = 3993

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 141  tctacagctagggagggagg 160
            ||||||||||||||||||||
Sbjct: 2581 tctacagctagggagggagg 2562
to top
>ref|XM_949167.1| Theileria annulata strain Ankara hypothetical protein (TA20505)
           partial mRNA
          Length = 1716

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 21  ttttgcatttacaagtacatcatc 44
           ||||||||||||| ||||||||||
Sbjct: 594 ttttgcatttacacgtacatcatc 571
to top
>gb|AC165290.2| Mus musculus BAC clone RP23-343A4 from chromosome 13, complete sequence
          Length = 206249

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 141   tctacagctagggagggagg 160
             ||||||||||||||||||||
Sbjct: 41932 tctacagctagggagggagg 41951
to top
>emb|CR788323.5| Zebrafish DNA sequence from clone DKEYP-71G11 in linkage group 2,
              complete sequence
          Length = 107248

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 11     attgcatatgttttgcattt 30
              ||||||||||||||||||||
Sbjct: 102201 attgcatatgttttgcattt 102182
to top
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome
          Length = 3570858

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 77      gggaggaggcgccctatcca 96
               ||||||||||||||||||||
Sbjct: 1092031 gggaggaggcgccctatcca 1092012
to top
>dbj|AK046702.1| Mus musculus 4 days neonate male adipose cDNA, RIKEN full-length
            enriched library, clone:B430318O09
            product:unclassifiable, full insert sequence
          Length = 3321

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 141  tctacagctagggagggagg 160
            ||||||||||||||||||||
Sbjct: 1938 tctacagctagggagggagg 1919
to top
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4,
              complete sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 11     attgcatatgttttgcattt 30
              ||||||||||||||||||||
Sbjct: 376334 attgcatatgttttgcattt 376315
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                               
Query: 2       gaatttaagattgcatatgttttgcatttaca 33
               ||||||||||||||   |||||||||||||||
Sbjct: 4690287 gaatttaagattgctactgttttgcatttaca 4690256
to top
>dbj|AP004692.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0455A11
          Length = 158629

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 2     gaatttaagattgcatatgttttgcatttaca 33
             ||||||||||||||   |||||||||||||||
Sbjct: 48303 gaatttaagattgctactgttttgcatttaca 48272
to top
>dbj|AK121489.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023150L05, full
            insert sequence
          Length = 1980

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                            
Query: 2    gaatttaagattgcatatgttttgcatttaca 33
            ||||||||||||||   |||||||||||||||
Sbjct: 1979 gaatttaagattgctactgttttgcatttaca 1948
to top
>emb|AL662992.3|OSJN00193 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0004G23,
             complete sequence
          Length = 115972

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    attgcatatgttttgcattt 30
             ||||||||||||||||||||
Sbjct: 60993 attgcatatgttttgcattt 60974
to top
>emb|AL606620.3|OSJN00065 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0085F13,
             complete sequence
          Length = 130249

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 11    attgcatatgttttgcattt 30
             ||||||||||||||||||||
Sbjct: 15086 attgcatatgttttgcattt 15067
to top
>gb|AC167975.3| Mus musculus BAC clone RP23-171A14 from chromosome 13, complete sequence
          Length = 220418

 Score = 40.1 bits (20), Expect = 2.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 141    tctacagctagggagggagg 160
              ||||||||||||||||||||
Sbjct: 128063 tctacagctagggagggagg 128082
to top
>ref|XM_528105.1| PREDICTED: Pan troglodytes similar to neuregulin 1 isoform GGF2;
           heregulin, alpha (45kD, ERBB2 p185-activator); glial
           growth factor; neu differentiation factor; sensory and
           motor neuron derived factor (LOC472733), mRNA
          Length = 1059

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 76  ggggaggaggcgccctatc 94
           |||||||||||||||||||
Sbjct: 463 ggggaggaggcgccctatc 481
to top
>ref|NM_013962.1| Homo sapiens neuregulin 1 (NRG1), transcript variant GGF2, mRNA
          Length = 1986

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 76  ggggaggaggcgccctatc 94
           |||||||||||||||||||
Sbjct: 724 ggggaggaggcgccctatc 742
to top
>gb|AC154422.2| Mus musculus BAC clone RP24-218O2 from chromosome 13, complete sequence
          Length = 170866

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    ttgcatatgttttgcattt 30
             |||||||||||||||||||
Sbjct: 59898 ttgcatatgttttgcattt 59880
to top
>emb|BX640540.3| Chicken DNA sequence from clone WAG-124D2, complete sequence
          Length = 161956

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 147    gctagggagggagggaaga 165
              |||||||||||||||||||
Sbjct: 132017 gctagggagggagggaaga 132035
to top
>ref|XM_649491.1| Entamoeba histolytica HM-1:IMSS amino acid transporter, putative
            (49.t00031) partial mRNA
          Length = 1431

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 16   atatgttttgcatttacaa 34
            |||||||||||||||||||
Sbjct: 1024 atatgttttgcatttacaa 1042
to top
>gb|AE017245.1| Mycoplasma synoviae 53, complete genome
          Length = 799476

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 57     gcaaacaattctatgcaaa 75
              |||||||||||||||||||
Sbjct: 372017 gcaaacaattctatgcaaa 372035
to top
>emb|AL732290.4| Human DNA sequence from clone CTD-2338C19 on chromosome X, complete
             sequence
          Length = 66122

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    ttgcatatgttttgcattt 30
             |||||||||||||||||||
Sbjct: 46681 ttgcatatgttttgcattt 46663
to top
>gb|AF491780.1| Homo sapiens neuregulin 1 (NRG1) gene, partial cds, alternatively spliced
          Length = 1285452

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 76     ggggaggaggcgccctatc 94
              |||||||||||||||||||
Sbjct: 245308 ggggaggaggcgccctatc 245326
to top
>emb|AL354919.16| Human DNA sequence from clone RP11-84A19 on chromosome 1 Contains the
             5' end of the BAI2 gene for brain-specific angiogenesis
             inhibitor 2, the gene for a novel protein (FLJ33697,
             FLJ25348, FLJ39908, FLJ25348, FLJ38510, FLJ38873), a novel
             gene (FLJ46627) and three CpG islands, complete sequence
          Length = 124413

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 12    ttgcatatgttttgcattt 30
             |||||||||||||||||||
Sbjct: 61333 ttgcatatgttttgcattt 61315
to top
>gb|AC133618.3| Rattus norvegicus 18 BAC CH230-71N8 (Children's Hospital Oakland Research
              Institute) complete sequence
          Length = 234684

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 146    agctagggagggagggaag 164
              |||||||||||||||||||
Sbjct: 103203 agctagggagggagggaag 103221
to top
>emb|CR381585.11| Zebrafish DNA sequence from clone DKEY-27P7 in linkage group 20 Contains
              the gene for a novel protein similar to mouse and human
              integrin beta 1 binding protein 1 (ITGB1BP1), the gene for
              a novel protein similar to vertebrate development and
              differentiation enhancing factor 2 (DDEF2) and three CpG
              islands, complete sequence
          Length = 209698

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 112    tgatctgttagttattagt 130
              |||||||||||||||||||
Sbjct: 183812 tgatctgttagttattagt 183794
to top
>gb|AC087341.4| Homo sapiens chromosome 8, clone RP11-381I15, complete sequence
          Length = 177835

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 3     aatttaagattgcatatgt 21
             |||||||||||||||||||
Sbjct: 90451 aatttaagattgcatatgt 90433
to top
>gb|AC104029.5| Homo sapiens chromosome 8, clone RP11-478B14, complete sequence
          Length = 177443

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 76     ggggaggaggcgccctatc 94
              |||||||||||||||||||
Sbjct: 156424 ggggaggaggcgccctatc 156406
to top
>gb|AF188026.4| Homo sapiens chromosome 8 clone CTD-2373L20 map 8q24.3, complete
             sequence
          Length = 101456

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 21    ttttgcatttacaagtacatcat 43
             |||||||||||| ||||||||||
Sbjct: 78369 ttttgcatttaccagtacatcat 78391
to top
>gb|AC104000.5| Homo sapiens chromosome 8, clone RP11-97N12, complete sequence
          Length = 156855

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 76    ggggaggaggcgccctatc 94
             |||||||||||||||||||
Sbjct: 93039 ggggaggaggcgccctatc 93057
to top
>gb|AC090776.3| Homo sapiens chromosome 8, clone CTD-2373L20, complete sequence
          Length = 101459

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 21    ttttgcatttacaagtacatcat 43
             |||||||||||| ||||||||||
Sbjct: 23089 ttttgcatttaccagtacatcat 23067
to top
>gb|AC007860.6| Homo sapiens 8 BAC RP11-709E21 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 186298

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 21     ttttgcatttacaagtacatcat 43
              |||||||||||| ||||||||||
Sbjct: 120683 ttttgcatttaccagtacatcat 120661
to top
>ref|XM_926044.1| PREDICTED: Homo sapiens similar to neuregulin 1 isoform GGF2
           (LOC653104), mRNA
          Length = 1059

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 76  ggggaggaggcgccctatc 94
           |||||||||||||||||||
Sbjct: 463 ggggaggaggcgccctatc 481
to top
>emb|BX322574.10| Zebrafish DNA sequence from clone DKEY-35I15 in linkage group 3,
             complete sequence
          Length = 150999

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 10    gattgcatatgttttgcat 28
             |||||||||||||||||||
Sbjct: 15853 gattgcatatgttttgcat 15871
to top
>tpg|BK000383.1| TPA: TPA_exp: Homo sapiens neuregulin 1 isoform (NRG1) gene,
              alternatively spliced, complete cds
          Length = 1421559

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 76     ggggaggaggcgccctatc 94
              |||||||||||||||||||
Sbjct: 245308 ggggaggaggcgccctatc 245326
to top
>gb|AC009956.12| Homo sapiens BAC clone RP11-195F23 from 2, complete sequence
          Length = 61552

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                   
Query: 108  tctgtgatctgttagttattagt 130
            |||||||||| ||||||||||||
Sbjct: 2224 tctgtgatctattagttattagt 2202
to top
>dbj|AB006902.2| Acinetobacter sp. NCIMB9871 cyclohexanol metabolic gene cluster (chnB,
             chnE, chnR, orf3, chnA, orf5, chnD, chnC), complete cds
          Length = 16160

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                    
Query: 17    tatgttttgcatttacaagtaca 39
             ||||||||| |||||||||||||
Sbjct: 15770 tatgttttgaatttacaagtaca 15748
to top
>emb|CT824641.5| Human DNA sequence from clone XX-HCC1954_31F14, complete sequence
          Length = 110526

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 21    ttttgcatttacaagtacatcat 43
             |||||||||||| ||||||||||
Sbjct: 30758 ttttgcatttaccagtacatcat 30780
to top
>emb|AL808147.21| Mouse DNA sequence from clone RP23-80N9 on chromosome 4, complete
             sequence
          Length = 233270

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 18    atgttttgcatttacaagt 36
             |||||||||||||||||||
Sbjct: 84645 atgttttgcatttacaagt 84627
to top
>gb|L12260.1|HUMGGF2A Human recombinant glial growth factor 2 mRNA, complete cds and
           flanking regions
          Length = 1986

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 76  ggggaggaggcgccctatc 94
           |||||||||||||||||||
Sbjct: 724 ggggaggaggcgccctatc 742
to top
>emb|AL606903.8| Mouse DNA sequence from clone RP23-278I3 on chromosome 4, complete
              sequence
          Length = 175238

 Score = 38.2 bits (19), Expect = 8.8
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 146    agctagggagggagggaag 164
              |||||||||||||||||||
Sbjct: 159195 agctagggagggagggaag 159177


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,914,449
Number of Sequences: 3902068
Number of extensions: 1914449
Number of successful extensions: 383935
Number of sequences better than 10.0: 41
Number of HSP's better than 10.0 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 383635
Number of HSP's gapped (non-prelim): 300
length of query: 179
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 157
effective length of database: 17,147,199,772
effective search space: 2692110364204
effective search space used: 2692110364204
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top