| Clone Name | rbasd26l04 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY206371.1| Triticum aestivum photosystem II polypeptide mRNA, partial cds; nuclear gene for chloroplast product Length = 481 Score = 511 bits (258), Expect = e-142 Identities = 300/314 (95%) Strand = Plus / Minus Query: 136 gtgttacaggtagatgctttcttagccggcgagagcgctggtattgtagacgaggagggc 195 |||||||| ||||||||| ||||||||||||||||||||||| ||||||||||||||| | Sbjct: 323 gtgttacacgtagatgctctcttagccggcgagagcgctggtgttgtagacgaggaggac 264 Query: 196 gccgccgccgaggaggccggcgagggtgacggcccagataagaagcccggtcgttccacc 255 ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || Sbjct: 263 gccgccgccgaggaggccggcgagggtgacggcccagataagaagcccggtcgttccgcc 204 Query: 256 ggcgtagcggtcaccagattcggaccattcctctggcgtgtagattgggctgtagccgtc 315 ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| Sbjct: 203 ggcgtagcggtcaccagattcagaccattcctctggcgtgtagattgggctgtagccgtc 144 Query: 316 gacgttggcgccgtacttgtcaacaaactggtagacacccttcttgccgaccttcctgcc 375 |||||||||||||||||||||||| |||||||| || ||||||||||| ||||||||||| Sbjct: 143 gacgttggcgccgtacttgtcaacgaactggtacacgcccttcttgcccaccttcctgcc 84 Query: 376 gttggcgtcgatgtcgacggtcaagccgcccccgagtccgaggggcttgtcgaccttgat 435 |||||||||||||||||| ||||||||||| || ||||| |||||||||||||||||||| Sbjct: 83 gttggcgtcgatgtcgactgtcaagccgcctccaagtccaaggggcttgtcgaccttgat 24 Query: 436 cttcttgccaccgc 449 |||||||||||||| Sbjct: 23 cttcttgccaccgc 10 Score = 61.9 bits (31), Expect = 2e-06 Identities = 64/74 (86%), Gaps = 2/74 (2%) Strand = Plus / Minus Query: 50 ccatctgttcggatgaattactttgcaccgttgatgacatacatgcacatta--tagcta 107 |||||||||||||| |||||||||||| ||||||| ||||||| |||| | |||||| Sbjct: 425 ccatctgttcggatcaattactttgcatcgttgattgcatacattcacaggaggtagcta 366 Query: 108 cgtagattacagag 121 ||||||||||||| Sbjct: 365 tgtagattacagag 352
>ref|XM_480562.1| Oryza sativa (japonica cultivar-group), mRNA Length = 616 Score = 226 bits (114), Expect = 6e-56 Identities = 180/202 (89%) Strand = Plus / Minus Query: 157 ttagccggcgagagcgctggtattgtagacgaggagggcgccgccgccgaggaggccggc 216 |||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||| Sbjct: 477 ttagccggcgagggcgctggtgttgtagacgaggagggcgccgccgccgaggagcccggc 418 Query: 217 gagggtgacggcccagataagaagcccggtcgttccaccggcgtagcggtcaccagattc 276 |||||| ||||||||||| ||||||||||| |||||||| ||||| |||||| | Sbjct: 417 gagggtcacggcccagatcagaagcccggtggttccaccaacgtaggtgtcaccggtggg 358 Query: 277 ggaccattcctctggcgtgtagattgggctgtagccgtcgacgttggcgccgtacttgtc 336 ||||||||||| |||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 357 agaccattcctccggcgagtagattgggctgtagccgtcgacgtttgcgccgtacttgtc 298 Query: 337 aacaaactggtagacacccttc 358 ||| || ||||| ||||||||| Sbjct: 297 aacgaattggtacacacccttc 276 Score = 103 bits (52), Expect = 6e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 418 gggcttgtcgaccttgatcttcttgccaccgctgcagacgacggcgaaggaggagccccg 477 |||||||||| |||||||||||| |||||||||||||||| |||||||||||| ||||| Sbjct: 216 gggcttgtcggtcttgatcttcttcccaccgctgcagacgatggcgaaggaggatccccg 157 Query: 478 gcgggagagggacggcaggc 497 |||||||| |||||| |||| Sbjct: 156 gcgggagatggacggaaggc 137 Score = 48.1 bits (24), Expect = 0.031 Identities = 36/40 (90%) Strand = Plus / Minus Query: 502 cggcgccacaatcggcgaggtgatcatggaggctgccatc 541 ||||||||| | |||||||||||||||||| | ||||||| Sbjct: 123 cggcgccaccagcggcgaggtgatcatggatgttgccatc 84
>ref|XM_507163.1| PREDICTED Oryza sativa (japonica cultivar-group), P0556A11.19 mRNA Length = 711 Score = 226 bits (114), Expect = 6e-56 Identities = 180/202 (89%) Strand = Plus / Minus Query: 157 ttagccggcgagagcgctggtattgtagacgaggagggcgccgccgccgaggaggccggc 216 |||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||| Sbjct: 473 ttagccggcgagggcgctggtgttgtagacgaggagggcgccgccgccgaggagcccggc 414 Query: 217 gagggtgacggcccagataagaagcccggtcgttccaccggcgtagcggtcaccagattc 276 |||||| ||||||||||| ||||||||||| |||||||| ||||| |||||| | Sbjct: 413 gagggtcacggcccagatcagaagcccggtggttccaccaacgtaggtgtcaccggtggg 354 Query: 277 ggaccattcctctggcgtgtagattgggctgtagccgtcgacgttggcgccgtacttgtc 336 ||||||||||| |||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 353 agaccattcctccggcgagtagattgggctgtagccgtcgacgtttgcgccgtacttgtc 294 Query: 337 aacaaactggtagacacccttc 358 ||| || ||||| ||||||||| Sbjct: 293 aacgaattggtacacacccttc 272 Score = 103 bits (52), Expect = 6e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 418 gggcttgtcgaccttgatcttcttgccaccgctgcagacgacggcgaaggaggagccccg 477 |||||||||| |||||||||||| |||||||||||||||| |||||||||||| ||||| Sbjct: 212 gggcttgtcggtcttgatcttcttcccaccgctgcagacgatggcgaaggaggatccccg 153 Query: 478 gcgggagagggacggcaggc 497 |||||||| |||||| |||| Sbjct: 152 gcgggagatggacggaaggc 133 Score = 48.1 bits (24), Expect = 0.031 Identities = 36/40 (90%) Strand = Plus / Minus Query: 502 cggcgccacaatcggcgaggtgatcatggaggctgccatc 541 ||||||||| | |||||||||||||||||| | ||||||| Sbjct: 119 cggcgccaccagcggcgaggtgatcatggatgttgccatc 80
>dbj|AK121083.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023063I15, full insert sequence Length = 711 Score = 226 bits (114), Expect = 6e-56 Identities = 180/202 (89%) Strand = Plus / Minus Query: 157 ttagccggcgagagcgctggtattgtagacgaggagggcgccgccgccgaggaggccggc 216 |||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||| Sbjct: 473 ttagccggcgagggcgctggtgttgtagacgaggagggcgccgccgccgaggagcccggc 414 Query: 217 gagggtgacggcccagataagaagcccggtcgttccaccggcgtagcggtcaccagattc 276 |||||| ||||||||||| ||||||||||| |||||||| ||||| |||||| | Sbjct: 413 gagggtcacggcccagatcagaagcccggtggttccaccaacgtaggtgtcaccggtggg 354 Query: 277 ggaccattcctctggcgtgtagattgggctgtagccgtcgacgttggcgccgtacttgtc 336 ||||||||||| |||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 353 agaccattcctccggcgagtagattgggctgtagccgtcgacgtttgcgccgtacttgtc 294 Query: 337 aacaaactggtagacacccttc 358 ||| || ||||| ||||||||| Sbjct: 293 aacgaattggtacacacccttc 272 Score = 103 bits (52), Expect = 6e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 418 gggcttgtcgaccttgatcttcttgccaccgctgcagacgacggcgaaggaggagccccg 477 |||||||||| |||||||||||| |||||||||||||||| |||||||||||| ||||| Sbjct: 212 gggcttgtcggtcttgatcttcttcccaccgctgcagacgatggcgaaggaggatccccg 153 Query: 478 gcgggagagggacggcaggc 497 |||||||| |||||| |||| Sbjct: 152 gcgggagatggacggaaggc 133 Score = 48.1 bits (24), Expect = 0.031 Identities = 36/40 (90%) Strand = Plus / Minus Query: 502 cggcgccacaatcggcgaggtgatcatggaggctgccatc 541 ||||||||| | |||||||||||||||||| | ||||||| Sbjct: 119 cggcgccaccagcggcgaggtgatcatggatgttgccatc 80
>dbj|AK105055.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-042-F10, full insert sequence Length = 640 Score = 226 bits (114), Expect = 6e-56 Identities = 180/202 (89%) Strand = Plus / Minus Query: 157 ttagccggcgagagcgctggtattgtagacgaggagggcgccgccgccgaggaggccggc 216 |||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||| Sbjct: 501 ttagccggcgagggcgctggtgttgtagacgaggagggcgccgccgccgaggagcccggc 442 Query: 217 gagggtgacggcccagataagaagcccggtcgttccaccggcgtagcggtcaccagattc 276 |||||| ||||||||||| ||||||||||| |||||||| ||||| |||||| | Sbjct: 441 gagggtcacggcccagatcagaagcccggtggttccaccaacgtaggtgtcaccggtggg 382 Query: 277 ggaccattcctctggcgtgtagattgggctgtagccgtcgacgttggcgccgtacttgtc 336 ||||||||||| |||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 381 agaccattcctccggcgagtagattgggctgtagccgtcgacgtttgcgccgtacttgtc 322 Query: 337 aacaaactggtagacacccttc 358 ||| || ||||| ||||||||| Sbjct: 321 aacgaattggtacacacccttc 300 Score = 103 bits (52), Expect = 6e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 418 gggcttgtcgaccttgatcttcttgccaccgctgcagacgacggcgaaggaggagccccg 477 |||||||||| |||||||||||| |||||||||||||||| |||||||||||| ||||| Sbjct: 240 gggcttgtcggtcttgatcttcttcccaccgctgcagacgatggcgaaggaggatccccg 181 Query: 478 gcgggagagggacggcaggc 497 |||||||| |||||| |||| Sbjct: 180 gcgggagatggacggaaggc 161 Score = 48.1 bits (24), Expect = 0.031 Identities = 36/40 (90%) Strand = Plus / Minus Query: 502 cggcgccacaatcggcgaggtgatcatggaggctgccatc 541 ||||||||| | |||||||||||||||||| | ||||||| Sbjct: 147 cggcgccaccagcggcgaggtgatcatggatgttgccatc 108
>gb|U86018.1|OSU86018 Oryza sativa photosystem II 10 kDa polypeptide mRNA, complete cds Length = 580 Score = 226 bits (114), Expect = 6e-56 Identities = 180/202 (89%) Strand = Plus / Minus Query: 157 ttagccggcgagagcgctggtattgtagacgaggagggcgccgccgccgaggaggccggc 216 |||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||| Sbjct: 416 ttagccggcgagggcgctggtgttgtagacgaggagggcgccgccgccgaggagcccggc 357 Query: 217 gagggtgacggcccagataagaagcccggtcgttccaccggcgtagcggtcaccagattc 276 |||||| ||||||||||| ||||||||||| |||||||| ||||| |||||| | Sbjct: 356 gagggtcacggcccagatcagaagcccggtggttccaccaacgtaggtgtcaccggtggg 297 Query: 277 ggaccattcctctggcgtgtagattgggctgtagccgtcgacgttggcgccgtacttgtc 336 ||||||||||| |||| ||||||||||||||||||||||||||| |||||||||||||| Sbjct: 296 agaccattcctccggcgagtagattgggctgtagccgtcgacgtttgcgccgtacttgtc 237 Query: 337 aacaaactggtagacacccttc 358 ||| || ||||| ||||||||| Sbjct: 236 aacgaattggtacacacccttc 215 Score = 103 bits (52), Expect = 6e-19 Identities = 73/80 (91%) Strand = Plus / Minus Query: 418 gggcttgtcgaccttgatcttcttgccaccgctgcagacgacggcgaaggaggagccccg 477 |||||||||| |||||||||||| |||||||||||||||| |||||||||||| ||||| Sbjct: 155 gggcttgtcggtcttgatcttcttcccaccgctgcagacgatggcgaaggaggatccccg 96 Query: 478 gcgggagagggacggcaggc 497 |||||||| |||||| |||| Sbjct: 95 gcgggagatggacggaaggc 76 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Minus Query: 502 cggcgccacaatcggcgaggtgatcatgga 531 ||||||||| | |||||||||||||||||| Sbjct: 62 cggcgccaccagcggcgaggtgatcatgga 33
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete sequence Length = 28434780 Score = 143 bits (72), Expect = 7e-31 Identities = 90/96 (93%) Strand = Plus / Plus Query: 157 ttagccggcgagagcgctggtattgtagacgaggagggcgccgccgccgaggaggccggc 216 |||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||| Sbjct: 5800357 ttagccggcgagggcgctggtgttgtagacgaggagggcgccgccgccgaggagcccggc 5800416 Query: 217 gagggtgacggcccagataagaagcccggtcgttcc 252 |||||| ||||||||||| ||||||||||| ||||| Sbjct: 5800417 gagggtcacggcccagatcagaagcccggtggttcc 5800452 Score = 103 bits (52), Expect = 6e-19 Identities = 73/80 (91%) Strand = Plus / Plus Query: 418 gggcttgtcgaccttgatcttcttgccaccgctgcagacgacggcgaaggaggagccccg 477 |||||||||| |||||||||||| |||||||||||||||| |||||||||||| ||||| Sbjct: 5801772 gggcttgtcggtcttgatcttcttcccaccgctgcagacgatggcgaaggaggatccccg 5801831 Query: 478 gcgggagagggacggcaggc 497 |||||||| |||||| |||| Sbjct: 5801832 gcgggagatggacggaaggc 5801851 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Plus Query: 305 ctgtagccgtcgacgttggcgccgtacttgtcaacaaactggtagacacccttc 358 ||||||||||||||||| ||||||||||||||||| || ||||| ||||||||| Sbjct: 5801289 ctgtagccgtcgacgtttgcgccgtacttgtcaacgaattggtacacacccttc 5801342 Score = 48.1 bits (24), Expect = 0.031 Identities = 36/40 (90%) Strand = Plus / Plus Query: 502 cggcgccacaatcggcgaggtgatcatggaggctgccatc 541 ||||||||| | |||||||||||||||||| | ||||||| Sbjct: 5801865 cggcgccaccagcggcgaggtgatcatggatgttgccatc 5801904 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Plus Query: 278 gaccattcctctggcgtgtagattgggctg 307 ||||||||||| |||| ||||||||||||| Sbjct: 5801149 gaccattcctccggcgagtagattgggctg 5801178 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Minus Query: 198 cgccgccgaggaggccggcgaggg 221 ||||||||||||| |||||||||| Sbjct: 25883082 cgccgccgaggagtccggcgaggg 25883059 Score = 40.1 bits (20), Expect = 7.6 Identities = 23/24 (95%) Strand = Plus / Plus Query: 185 acgaggagggcgccgccgccgagg 208 |||||||||| ||||||||||||| Sbjct: 8339937 acgaggagggtgccgccgccgagg 8339960
>dbj|AP004589.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC clone:P0556A11 Length = 138096 Score = 143 bits (72), Expect = 7e-31 Identities = 90/96 (93%) Strand = Plus / Plus Query: 157 ttagccggcgagagcgctggtattgtagacgaggagggcgccgccgccgaggaggccggc 216 |||||||||||| |||||||| |||||||||||||||||||||||||||||||| ||||| Sbjct: 54502 ttagccggcgagggcgctggtgttgtagacgaggagggcgccgccgccgaggagcccggc 54561 Query: 217 gagggtgacggcccagataagaagcccggtcgttcc 252 |||||| ||||||||||| ||||||||||| ||||| Sbjct: 54562 gagggtcacggcccagatcagaagcccggtggttcc 54597 Score = 103 bits (52), Expect = 6e-19 Identities = 73/80 (91%) Strand = Plus / Plus Query: 418 gggcttgtcgaccttgatcttcttgccaccgctgcagacgacggcgaaggaggagccccg 477 |||||||||| |||||||||||| |||||||||||||||| |||||||||||| ||||| Sbjct: 55917 gggcttgtcggtcttgatcttcttcccaccgctgcagacgatggcgaaggaggatccccg 55976 Query: 478 gcgggagagggacggcaggc 497 |||||||| |||||| |||| Sbjct: 55977 gcgggagatggacggaaggc 55996 Score = 75.8 bits (38), Expect = 1e-10 Identities = 50/54 (92%) Strand = Plus / Plus Query: 305 ctgtagccgtcgacgttggcgccgtacttgtcaacaaactggtagacacccttc 358 ||||||||||||||||| ||||||||||||||||| || ||||| ||||||||| Sbjct: 55434 ctgtagccgtcgacgtttgcgccgtacttgtcaacgaattggtacacacccttc 55487 Score = 48.1 bits (24), Expect = 0.031 Identities = 36/40 (90%) Strand = Plus / Plus Query: 502 cggcgccacaatcggcgaggtgatcatggaggctgccatc 541 ||||||||| | |||||||||||||||||| | ||||||| Sbjct: 56010 cggcgccaccagcggcgaggtgatcatggatgttgccatc 56049 Score = 44.1 bits (22), Expect = 0.49 Identities = 28/30 (93%) Strand = Plus / Plus Query: 278 gaccattcctctggcgtgtagattgggctg 307 ||||||||||| |||| ||||||||||||| Sbjct: 55294 gaccattcctccggcgagtagattgggctg 55323
>dbj|AK103688.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033136G12, full insert sequence Length = 2703 Score = 95.6 bits (48), Expect = 1e-16 Identities = 63/68 (92%) Strand = Plus / Minus Query: 430 cttgatcttcttgccaccgctgcagacgacggcgaaggaggagccccggcgggagaggga 489 |||||||||||| |||||||||||||||| |||||||||||| ||||||||||||| ||| Sbjct: 200 cttgatcttcttcccaccgctgcagacgatggcgaaggaggatccccggcgggagatgga 141 Query: 490 cggcaggc 497 ||| |||| Sbjct: 140 cggaaggc 133 Score = 48.1 bits (24), Expect = 0.031 Identities = 36/40 (90%) Strand = Plus / Minus Query: 502 cggcgccacaatcggcgaggtgatcatggaggctgccatc 541 ||||||||| | |||||||||||||||||| | ||||||| Sbjct: 119 cggcgccaccagcggcgaggtgatcatggatgttgccatc 80
>gb|AY146990.1| Xerophyta humilis photosystem II 10 kDa protein (PsbR) mRNA, complete cds Length = 698 Score = 56.0 bits (28), Expect = 1e-04 Identities = 67/80 (83%) Strand = Plus / Minus Query: 278 gaccattcctctggcgtgtagattgggctgtagccgtcgacgttggcgccgtacttgtca 337 |||||||| ||||| | |||||| ||||||||||| || || || || || || ||||| Sbjct: 375 gaccattcgtctggtgagtagatcgggctgtagccatcaacatttgcaccatatttgtcc 316 Query: 338 acaaactggtagacaccctt 357 ||||| |||||||||||||| Sbjct: 315 acaaattggtagacaccctt 296
>gb|J03887.1|SPIPSBIA Spinach psbI gene encoding the 10kd polypeptide of photosystem II, complete cds Length = 590 Score = 56.0 bits (28), Expect = 1e-04 Identities = 55/64 (85%) Strand = Plus / Minus Query: 294 tgtagattgggctgtagccgtcgacgttggcgccgtacttgtcaacaaactggtagacac 353 |||||||||| ||||| || || || ||||| || |||||||||||||| ||||| |||| Sbjct: 303 tgtagattggactgtaaccatcaacattggcaccatacttgtcaacaaattggtaaacac 244 Query: 354 cctt 357 |||| Sbjct: 243 cctt 240 Score = 42.1 bits (21), Expect = 1.9 Identities = 27/29 (93%) Strand = Plus / Minus Query: 422 ttgtcgaccttgatcttcttgccaccgct 450 ||||| ||||||||||||||| ||||||| Sbjct: 169 ttgtcaaccttgatcttcttgacaccgct 141
>gb|DQ296038.1| Arachis hypogaea chloroplast photosystem II 10 kDa protein mRNA, partial cds; nuclear gene for chloroplast product Length = 387 Score = 54.0 bits (27), Expect = 5e-04 Identities = 54/63 (85%) Strand = Plus / Minus Query: 295 gtagattgggctgtagccgtcgacgttggcgccgtacttgtcaacaaactggtagacacc 354 |||||| || ||||| || ||||| || || ||||||||||| ||||||||||| ||||| Sbjct: 252 gtagataggactgtaaccatcgacattagcaccgtacttgtccacaaactggtacacacc 193 Query: 355 ctt 357 ||| Sbjct: 192 ctt 190
>dbj|AB090880.1| Aster tripolium mRNA for thiol protease, complete cds Length = 910 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 329 tacttgtcaacaaactggtagacacccttc 358 |||||||||||||| ||||||||||||||| Sbjct: 352 tacttgtcaacaaattggtagacacccttc 323
>dbj|AU066512.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl inducible, complete cds, clone:NaEX96-50 Length = 453 Score = 50.1 bits (25), Expect = 0.008 Identities = 40/45 (88%) Strand = Plus / Minus Query: 292 cgtgtagattgggctgtagccgtcgacgttggcgccgtacttgtc 336 ||||||||||||| ||| ||||| ||||| |||||||||||||| Sbjct: 281 cgtgtagattggggagtatccgtccacgttagcgccgtacttgtc 237
>gb|AF262979.1|AF262979 Triticum aestivum protein disulfide isomerase 1 precursor (PDI1) mRNA, complete cds Length = 1784 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 187 gaggagggcgccgccgccgaggaggccg 214 ||||||| |||||||||||||||||||| Sbjct: 101 gaggaggccgccgccgccgaggaggccg 128
>emb|AJ868105.1| Triticum aestivum subsp. aestivum mRNA for protein disulfide isomerase (PDI gene), clone CPDI-4A Length = 1745 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 187 gaggagggcgccgccgccgaggaggccg 214 ||||||| |||||||||||||||||||| Sbjct: 108 gaggaggccgccgccgccgaggaggccg 135
>emb|AJ868102.1| Triticum aestivum subsp. aestivum PDI gene for protein disulfide isomerase, exons 1-10, clone GPDI-4A Length = 3561 Score = 48.1 bits (24), Expect = 0.031 Identities = 27/28 (96%) Strand = Plus / Plus Query: 187 gaggagggcgccgccgccgaggaggccg 214 ||||||| |||||||||||||||||||| Sbjct: 108 gaggaggccgccgccgccgaggaggccg 135
>gb|CP000110.1| Synechococcus sp. CC9605, complete genome Length = 2510659 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2487649 tgccgttggcgtcgatgtcgaaggtca 2487675
>ref|NM_001003067.1| Canis familiaris heat shock protein 70 (HSP70), mRNA Length = 2322 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1547 tgccgttggcgtcgatgtcgaaggtca 1521
>gb|AE014291.4| Brucella suis 1330 chromosome I, complete sequence Length = 2107794 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2051001 tgccgttggcgtcgatgtcgaaggtca 2050975
>gb|AF109906.1|MMHC310M6 Mus musculus MHC class III region RD gene, partial cds; Bf, C2, G9A, NG22, G9, HSP70, HSP70, HSC70t, and smRNP genes, complete cds; G7A gene, partial cds; and unknown genes Length = 158405 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 119798 tgccgttggcgtcgatgtcgaaggtca 119824 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 106884 tgccgttggcgtcgatgtcgaaggtca 106910 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 127758 ccgttggcgtcgatgtcgaaggtca 127734
>gb|CP000143.1| Rhodobacter sphaeroides 2.4.1 chromosome 1, complete genome Length = 3188609 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2940226 tgccgttggcgtcgatgtcgaaggtca 2940252
>gb|CP000094.1| Pseudomonas fluorescens PfO-1, complete genome Length = 6438405 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 896368 tgccgttggcgtcgatgtcgaaggtca 896342
>gb|BC054782.1| Mus musculus heat shock protein 1A, mRNA (cDNA clone MGC:65617 IMAGE:6815894), complete cds Length = 2953 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1652 tgccgttggcgtcgatgtcgaaggtca 1626
>ref|NM_010478.1| Mus musculus heat shock protein 1B (Hspa1b), mRNA Length = 1926 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1453 tgccgttggcgtcgatgtcgaaggtca 1427
>ref|XM_994759.1| PREDICTED: Mus musculus heat shock protein 1B (Hspa1b), mRNA Length = 3158 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2032 tgccgttggcgtcgatgtcgaaggtca 2006
>ref|XM_001002974.1| PREDICTED: Mus musculus heat shock protein 1B, transcript variant 6 (Hspa1b), mRNA Length = 3110 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1984 tgccgttggcgtcgatgtcgaaggtca 1958
>ref|XM_911557.2| PREDICTED: Mus musculus heat shock protein 1B, transcript variant 5 (Hspa1b), mRNA Length = 3158 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2032 tgccgttggcgtcgatgtcgaaggtca 2006
>ref|XM_001004998.1| PREDICTED: Mus musculus heat shock protein 1B, transcript variant 1 (Hspa1b), mRNA Length = 3110 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1984 tgccgttggcgtcgatgtcgaaggtca 1958
>ref|XM_001004999.1| PREDICTED: Mus musculus heat shock protein 1B, transcript variant 2 (Hspa1b), mRNA Length = 3158 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2032 tgccgttggcgtcgatgtcgaaggtca 2006
>ref|XM_001002795.1| PREDICTED: Mus musculus heat shock protein 1B, transcript variant 1 (Hspa1b), mRNA Length = 3110 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1984 tgccgttggcgtcgatgtcgaaggtca 1958
>ref|XM_001002803.1| PREDICTED: Mus musculus heat shock protein 1B, transcript variant 2 (Hspa1b), mRNA Length = 3158 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2032 tgccgttggcgtcgatgtcgaaggtca 2006
>emb|X74271.1|RNHSP70 Rattus norvegicus hsp70.1 gene Length = 5918 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 3600 tgccgttggcgtcgatgtcgaaggtca 3574
>gb|AY466608.1| Sus scrofa heat shock protein 70.2 (hsp70.2) mRNA, complete cds Length = 1926 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1453 tgccgttggcgtcgatgtcgaaggtca 1427
>gb|AY823737.1| Pseudomonas putida strain PCL1445 GrpE (gprE), DnaK (dnaK), and DnaJ (dnaJ) genes, complete cds Length = 4228 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2403 tgccgttggcgtcgatgtcgaaggtca 2377
>gb|BC054065.1| Mus musculus cDNA clone IMAGE:5255819 Length = 1613 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 700 tgccgttggcgtcgatgtcgaaggtca 726
>emb|Y09633.4|BJDNAKJ Bradyrhizobium japonicum rph, hrcA, grpE, dnaK, dnaJ & pmtA genes Length = 10486 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 6114 tgccgttggcgtcgatgtcgaaggtca 6088
>emb|X77208.1|RNHSP702 R.norvegicus Hsp70-2 gene Length = 4047 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2700 tgccgttggcgtcgatgtcgaaggtca 2674
>emb|X77207.1|RNHSP701 R.norvegicus Hsp70-1 gene Length = 3783 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2403 tgccgttggcgtcgatgtcgaaggtca 2377
>emb|X75357.1|RNHS70P R.norvegicus (Wistar) hsp70 gene for heat shock protein 70 Length = 2779 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1954 tgccgttggcgtcgatgtcgaaggtca 1928
>emb|BX883045.1| Rattus norvegicus chromosome 20, major histocompatibility complex, assembled from 40 BACs, strain Brown Norway (BN/ssNHsd), RT1n haplotype; segment 4/11 Length = 346406 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 162871 tgccgttggcgtcgatgtcgaaggtca 162897 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 148285 tgccgttggcgtcgatgtcgaaggtca 148311 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 170814 ccgttggcgtcgatgtcgaaggtca 170790
>emb|BX572594.1| Rhodopseudomonas palustris CGA009 complete genome; segment 2/16 Length = 348971 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 12920 tgccgttggcgtcgatgtcgaaggtca 12894
>emb|BX569695.1| Synechococcus sp. WH8102 complete genome; segment 7/7 Length = 344615 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 323861 tgccgttggcgtcgatgtcgaaggtca 323887
>gb|AY923047.1| Bradyrhizobium canariense strain BTA-1 Hsp70 class chaperone (dnaK) gene, partial cds Length = 598 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 185 tgccgttggcgtcgatgtcgaaggtca 159
>gb|AY923045.1| Bradyrhizobium japonicum bv. genistearum strain FN13 Hsp70 class chaperone (dnaK) gene, partial cds Length = 598 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 185 tgccgttggcgtcgatgtcgaaggtca 159
>gb|AY923044.1| Bradyrhizobium japonicum strain USDA 122 Hsp70 class chaperone (dnaK) gene, partial cds Length = 598 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 185 tgccgttggcgtcgatgtcgaaggtca 159
>gb|AY923040.1| Bradyrhizobium yuanmingense strain TAL760 Hsp70 class chaperone (dnaK) gene, partial cds Length = 598 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 185 tgccgttggcgtcgatgtcgaaggtca 159
>gb|AY923039.1| Bradyrhizobium yuanmingense strain CCBAU 10071 Hsp70 class chaperone (dnaK) gene, partial cds Length = 598 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 185 tgccgttggcgtcgatgtcgaaggtca 159
>gb|AY923034.1| Bradyrhizobium yuanmingense strain LMTR 41 Hsp70 class chaperone (dnaK) gene, partial cds Length = 598 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 185 tgccgttggcgtcgatgtcgaaggtca 159
>gb|AY923033.1| Bradyrhizobium yuanmingense strain LMTR 30 Hsp70 class chaperone (dnaK) gene, partial cds Length = 598 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 185 tgccgttggcgtcgatgtcgaaggtca 159
>gb|AY923032.1| Bradyrhizobium yuanmingense strain LMTR 28 Hsp70 class chaperone (dnaK) gene, partial cds Length = 598 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 185 tgccgttggcgtcgatgtcgaaggtca 159
>gb|CP000076.1| Pseudomonas fluorescens Pf-5, complete genome Length = 7074893 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 955962 tgccgttggcgtcgatgtcgaaggtca 955936
>gb|AC087117.9| Mus Musculus Strain C57BL6/J chromosome 17 BAC, RP23-349B4, Complete Sequence, complete sequence Length = 221899 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 79090 tgccgttggcgtcgatgtcgaaggtca 79116 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 66172 tgccgttggcgtcgatgtcgaaggtca 66198 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 87060 ccgttggcgtcgatgtcgaaggtca 87036
>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome Length = 2932766 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 125109 tgccgttggcgtcgatgtcgaaggtca 125083
>dbj|AK132331.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched library, clone:4022418L05 product:heat shock protein 1A, full insert sequence Length = 2796 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1685 tgccgttggcgtcgatgtcgaaggtca 1659
>ref|NM_031971.1| Rattus norvegicus heat shock 70kD protein 1A (Hspa1a), mRNA Length = 2455 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1630 tgccgttggcgtcgatgtcgaaggtca 1604
>ref|NM_010479.1| Mus musculus heat shock protein 1A (Hspa1a), mRNA Length = 2953 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1652 tgccgttggcgtcgatgtcgaaggtca 1626
>dbj|AK159139.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420004H17 product:heat shock protein 1A, full insert sequence Length = 2775 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1651 tgccgttggcgtcgatgtcgaaggtca 1625
>ref|XM_694630.1| PREDICTED: Danio rerio similar to heat shock protein 70.2 (LOC571074), mRNA Length = 2169 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1696 tgccgttggcgtcgatgtcgaaggtca 1670
>dbj|AK160912.1| Mus musculus 18 days pregnant adult female placenta and extra embryonic tissue cDNA, RIKEN full-length enriched library, clone:3830416D11 product:heat shock protein 1A, full insert sequence Length = 2400 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1685 tgccgttggcgtcgatgtcgaaggtca 1659
>dbj|AK165042.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130315L20 product:heat shock protein 1A, full insert sequence Length = 2810 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1689 tgccgttggcgtcgatgtcgaaggtca 1663
>dbj|AK171820.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830012K21 product:heat shock protein 1A, full insert sequence Length = 2773 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1685 tgccgttggcgtcgatgtcgaaggtca 1659
>gb|S62228.1| ischaemia-induced gene [Meriones unguiculatus=gerbils, mRNA, 628 nt] Length = 628 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 481 tgccgttggcgtcgatgtcgaaggtca 455
>gb|CP000230.1| Rhodospirillum rubrum ATCC 11170, complete genome Length = 4352825 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 4094564 tgccgttggcgtcgatgtcgaaggtca 4094590
>gb|AF507046.1| Meiothermus ruber dnaK operon, complete sequence Length = 4664 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2065 tgccgttggcgtcgatgtcgaaggtca 2039
>gb|AF222752.1|AF222752 Bradyrhizobium sp. WM9 heat shock protein (dnaK) gene, partial cds Length = 1810 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1433 tgccgttggcgtcgatgtcgaaggtca 1407
>gb|AE009633.1| Brucella melitensis 16M chromosome I, section 190 of 195 of the complete sequence Length = 10254 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 636 tgccgttggcgtcgatgtcgaaggtca 662
>gb|M95799.1|BRUHSPDNA Brucella ovis heat shock protein 70 (dnaK) and heat shock protein 40 (dnaJ) genes, complete cds Length = 3979 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1873 tgccgttggcgtcgatgtcgaaggtca 1847
>ref|NM_213766.1| Sus scrofa heat shock protein 70.2 (HSP70.2), mRNA Length = 1926 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1453 tgccgttggcgtcgatgtcgaaggtca 1427
>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome Length = 9105828 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 726498 tgccgttggcgtcgatgtcgaaggtca 726472
>gb|AE017223.1| Brucella abortus biovar 1 str. 9-941 chromosome I, complete sequence Length = 2124241 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2067467 tgccgttggcgtcgatgtcgaaggtca 2067441
>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome Length = 6021225 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 5714003 tgccgttggcgtcgatgtcgaaggtca 5714029
>dbj|AB114672.1| Canis familiaris hsp70 mRNA for heat shock protein 70, complete cds, cell_type:white blood cell Length = 2026 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1531 tgccgttggcgtcgatgtcgaaggtca 1505
>gb|AY328397.1| Bradyrhizobium sp. Pp2-4 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328399.1| Bradyrhizobium sp. Ppar1-21 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328398.1| Bradyrhizobium sp. jwc91.2 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328396.1| Bradyrhizobium sp. Ai1a-2 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328395.1| Bradyrhizobium sp. Dr3b-11 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328394.1| Bradyrhizobium sp. Cj3.3 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328393.1| Bradyrhizobium elkanii strain USDA 94 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328392.1| Bradyrhizobium elkanii strain USDA 76 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328391.1| Bradyrhizobium sp. 5111P DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328390.1| Bradyrhizobium sp. Ppau3-41 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328389.1| Bradyrhizobium sp. 5028A DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328387.1| Bradyrhizobium sp. Tv2a-2 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328386.1| Bradyrhizobium sp. Pe1.3 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328385.1| Bradyrhizobium sp. Pe4 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328384.1| Bradyrhizobium sp. Mm1.3 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328383.1| Bradyrhizobium sp. La5-8 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328382.1| Bradyrhizobium sp. Dr4a.7 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328381.1| Bradyrhizobium sp. Ec3.3 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>gb|AY328380.1| Bradyrhizobium sp. Pp3a.1 DnaK (dnaK) gene, partial cds Length = 603 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 182 tgccgttggcgtcgatgtcgaaggtca 156
>dbj|AB114675.1| Canis familiaris hsp70 mRNA for heat shock protein 70, complete cds, cell_type:reticulocyte Length = 2027 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1524 tgccgttggcgtcgatgtcgaaggtca 1498
>dbj|AB114674.1| Canis familiaris hsp70 mRNA for heat shock protein 70, complete cds, cell_type:reticulocyte Length = 2028 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1525 tgccgttggcgtcgatgtcgaaggtca 1499
>dbj|AB114673.1| Canis familiaris hsp70 mRNA for heat shock protein 70, complete cds, cell_type:white blood cell Length = 2012 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1518 tgccgttggcgtcgatgtcgaaggtca 1492
>gb|AE015451.1| Pseudomonas putida KT2440 complete genome Length = 6181863 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 5376116 tgccgttggcgtcgatgtcgaaggtca 5376142
>ref|NM_212504.1| Rattus norvegicus heat shock 70kD protein 1B (mapped) (Hspa1b_mapped), mRNA Length = 5918 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 3603 tgccgttggcgtcgatgtcgaaggtca 3577
>emb|AM040264.1| Brucella melitensis biovar Abortus chromosome I, complete sequence, strain 2308 Length = 2121359 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2064586 tgccgttggcgtcgatgtcgaaggtca 2064560
>gb|U80215.1|DPU80215 Deinococcus proteolyticus 70 kDa heat shock protein Hsp70 (DnaK) gene, partial cds Length = 1878 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1402 tgccgttggcgtcgatgtcgaaggtca 1376
>emb|AL773559.16| Pig DNA sequence from clone XX-711D2, complete sequence Length = 32570 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 9298 tgccgttggcgtcgatgtcgaaggtca 9324
>gb|M12572.1|MUSHSP68B Mouse heat shock protein (hsp68) mRNA, clone MHS213, partial cds Length = 1434 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 328 tgccgttggcgtcgatgtcgaaggtca 302
>gb|M12571.1|MUSHSP68A Mouse heat shock protein (hsp68) mRNA, clone MHS243, partial cds Length = 1506 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 790 tgccgttggcgtcgatgtcgaaggtca 764
>gb|M76613.1|MUSHP7A2 Mouse heat shock inducible (hsp70A1) gene, complete cds Length = 3292 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2492 tgccgttggcgtcgatgtcgaaggtca 2466
>gb|M35021.1|MUSHSP7A2 Mouse heat shock protein 70.1 (hsp70.1) gene, complete cds Length = 3518 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 2258 tgccgttggcgtcgatgtcgaaggtca 2232
>gb|M12573.1|MUSHSP68C Mouse heat shock protein (hsp68) mRNA, clone MHS214, partial cds Length = 1330 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 211 tgccgttggcgtcgatgtcgaaggtca 185
>gb|L16764.1|RATHSP70A Rattus norvegicus heat shock protein 70 (HSP70) mRNA, complete cds Length = 2455 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1630 tgccgttggcgtcgatgtcgaaggtca 1604
>dbj|AB075027.1| Canis familiaris hsp70 mRNA for heat shock protein 70, complete cds Length = 2322 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 1547 tgccgttggcgtcgatgtcgaaggtca 1521
>emb|AL773527.8| Pig DNA sequence from clone XX-707F1, complete sequence Length = 137286 Score = 46.1 bits (23), Expect = 0.12 Identities = 26/27 (96%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||||| ||||| Sbjct: 133714 tgccgttggcgtcgatgtcgaaggtca 133740
>gb|CP000031.1| Silicibacter pomeroyi DSS-3, complete genome Length = 4109442 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 192 gggcgccgccgccgaggaggccggcg 217 ||||||| |||||||||||||||||| Sbjct: 3325859 gggcgcccccgccgaggaggccggcg 3325834 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 44129 tgccgttggcgtcgatgtcga 44109
>ref|NM_190628.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 333 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 193 ggcgccgccgccgaggaggccg 214 |||||||||||||||||||||| Sbjct: 75 ggcgccgccgccgaggaggccg 54
>gb|AE016822.1| Leifsonia xyli subsp. xyli str. CTCB07, complete genome Length = 2584158 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 201 cgccgaggaggccggcgagggtgacg 226 ||||||||||||| |||||||||||| Sbjct: 2296707 cgccgaggaggcccgcgagggtgacg 2296682
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 373 gccgttggcgtcgatgtcgacggtca 398 |||||||||||||||||||| ||||| Sbjct: 4852410 gccgttggcgtcgatgtcgaaggtca 4852385
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 193 ggcgccgccgccgaggaggccg 214 |||||||||||||||||||||| Sbjct: 36647721 ggcgccgccgccgaggaggccg 36647742 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 cgccgaggaggccggcgagg 220 |||||||||||||||||||| Sbjct: 1486758 cgccgaggaggccggcgagg 1486739 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 201 cgccgaggaggccggcgagg 220 |||||||||||||||||||| Sbjct: 1443113 cgccgaggaggccggcgagg 1443094
>dbj|AP004072.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0529H11 Length = 165969 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Plus Query: 193 ggcgccgccgccgaggaggccg 214 |||||||||||||||||||||| Sbjct: 120987 ggcgccgccgccgaggaggccg 121008
>gb|AF195209.1|AF195209 Pyrus pyrifolia strain Whangkeumbae polypeptide precursor of photosystem II (PP1) mRNA, partial cds Length = 280 Score = 44.1 bits (22), Expect = 0.49 Identities = 25/26 (96%) Strand = Plus / Minus Query: 332 ttgtcaacaaactggtagacaccctt 357 ||||| |||||||||||||||||||| Sbjct: 280 ttgtctacaaactggtagacaccctt 255
>dbj|AK101770.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033064I03, full insert sequence Length = 829 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 193 ggcgccgccgccgaggaggccg 214 |||||||||||||||||||||| Sbjct: 189 ggcgccgccgccgaggaggccg 168
>emb|CR936257.1| Natronomonas pharaonis DSM 2160 complete genome Length = 2595221 Score = 44.1 bits (22), Expect = 0.49 Identities = 22/22 (100%) Strand = Plus / Minus Query: 199 gccgccgaggaggccggcgagg 220 |||||||||||||||||||||| Sbjct: 521772 gccgccgaggaggccggcgagg 521751
>gb|AY642911.1| Bifidobacterium breve dnak operon, partial sequence Length = 4496 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1384 tgccgttggcgtcgatgtcga 1364
>gb|AY651253.1| Rhynchobodo ATCC50359 heat shock protein 70 cytosolic isoform gene, partial cds Length = 1828 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 1401 ccgttggcgtcgatgtcgaaggtca 1377
>ref|XM_475365.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1941 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1468 tgccgttggcgtcgatgtcga 1448
>ref|NM_131397.2| Danio rerio heat shock cognate 70-kd protein (hsp70), mRNA Length = 2770 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 2123 ccgttggcgtcgatgtcgaaggtca 2099
>gb|BT016462.1| Zea mays clone Contig295 mRNA sequence Length = 1014 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 369 tgccgttggcgtcgatgtcga 349
>gb|AC136219.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OSJNBa0073E05, complete sequence Length = 178013 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 193 ggcgccgccgccgaggaggcc 213 ||||||||||||||||||||| Sbjct: 141277 ggcgccgccgccgaggaggcc 141297
>gb|AF109905.1|MMHC213L3 Mus musculus major histocompatibility locus class III regions Hsc70t gene, partial cds; smRNP, G7A, NG23, MutS homolog, CLCP, NG24, NG25, and NG26 genes, complete cds; and unknown genes Length = 135545 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 1190 ccgttggcgtcgatgtcgaaggtca 1166
>gb|CP000144.1| Rhodobacter sphaeroides 2.4.1 chromosome 2, complete genome Length = 943016 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 183 agacgaggagggcgccgccgccgag 207 ||||||||| ||||||||||||||| Sbjct: 331553 agacgaggaaggcgccgccgccgag 331577
>gb|AE000516.2| Mycobacterium tuberculosis CDC1551, complete genome Length = 4403837 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 421263 tgccgttggcgtcgatgtcga 421243 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 195 cgccgccgccgaggaggccg 214 |||||||||||||||||||| Sbjct: 3072319 cgccgccgccgaggaggccg 3072338
>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome Length = 3345170 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 2168586 tgccgttggcgtcgatgtcga 2168566
>gb|AY294226.1| Uncultured bacterium cosmid gbiox603r, complete sequence Length = 40150 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 528 tgccgttggcgtcgatgtcga 548
>gb|AC117265.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1281_H05, complete sequence Length = 163130 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 44419 tgccgttggcgtcgatgtcga 44439
>gb|CP000115.1| Nitrobacter winogradskyi Nb-255, complete genome Length = 3402093 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 228575 tgccgttggcgtcgatgtcga 228555
>gb|BC056709.1| Danio rerio heat shock cognate 70-kd protein, mRNA (cDNA clone MGC:65778 IMAGE:6789418), complete cds Length = 2375 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 1581 ccgttggcgtcgatgtcgaaggtca 1557
>ref|XM_484041.4| PREDICTED: Mus musculus chromodomain helicase DNA binding protein 3, transcript variant 1 (Chd3), mRNA Length = 7464 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 187 gaggagggcgccgccgccgaggagg 211 ||||||| ||||||||||||||||| Sbjct: 106 gaggaggacgccgccgccgaggagg 130
>gb|CP000352.1| Ralstonia metallidurans CH34, complete genome Length = 3928089 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 3177078 tgccgttggcgtcgatgtcga 3177098 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 429 ccttgatcttcttgccaccgc 449 ||||||||||||||||||||| Sbjct: 1016828 ccttgatcttcttgccaccgc 1016808
>gb|AY316747.1| Rhizobium sp. NGR234 megaplasmid 2 contig 1, complete sequence Length = 357655 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 371 ctgccgttggcgtcgatgtcg 391 ||||||||||||||||||||| Sbjct: 265959 ctgccgttggcgtcgatgtcg 265939
>gb|AF474375.1| Penaeus monodon heat shock protein 70 mRNA, complete cds Length = 2207 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1493 tgccgttggcgtcgatgtcga 1473
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1764176 tgccgttggcgtcgatgtcga 1764156
>gb|AY310323.1| Streptomyces sp. FR-008 heptaene macrolide complex synthesis gene cluster, complete sequence Length = 138203 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 186 cgaggagggcgccgccgccgaggag 210 |||||||| |||||||||||||||| Sbjct: 30809 cgaggaggtcgccgccgccgaggag 30833
>gb|DQ278176.1| Theileria sp. China putative heat schock protein 70 mRNA, partial cds Length = 1116 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1025 tgccgttggcgtcgatgtcga 1005
>ref|XM_861181.1| PREDICTED: Canis familiaris similar to heat shock protein 2, transcript variant 2 (LOC480355), mRNA Length = 2429 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1487 tgccgttggcgtcgatgtcga 1467
>ref|XM_537479.2| PREDICTED: Canis familiaris similar to heat shock protein 2, transcript variant 1 (LOC480355), mRNA Length = 2638 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1696 tgccgttggcgtcgatgtcga 1676
>gb|AF447048.1| Mycobacterium asiaticum heat shock protein 70 gene, partial cds Length = 343 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 202 tgccgttggcgtcgatgtcga 182
>gb|AF442127.1| Mycobacterium gordonae heat shock protein 70 gene, partial cds Length = 361 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 220 tgccgttggcgtcgatgtcga 200
>gb|AF442123.1| Mycobacterium avium heat shock protein 70-like gene, partial sequence Length = 365 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 178 tgccgttggcgtcgatgtcga 158
>gb|AY063758.1| Mycobacterium intracellulare heat shock protein 70 (dnaK) gene, partial cds Length = 372 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 161 tgccgttggcgtcgatgtcga 141
>gb|AY063745.1| Mycobacterium scrofulaceum heat shock protein 70 (dnaK) gene, partial cds Length = 280 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 173 tgccgttggcgtcgatgtcga 153
>emb|CR383684.7| Zebrafish DNA sequence from clone DKEYP-69E1 in linkage group 3, complete sequence Length = 111124 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 109780 ccgttggcgtcgatgtcgaaggtca 109804 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 102949 ccgttggcgtcgatgtcgaaggtca 102973
>ref|XM_775012.1| PREDICTED: Strongylocentrotus purpuratus similar to Heat shock 70 kDa protein 1 (HSP70.1) (HSP70-1/HSP70-2) (LOC574663), mRNA Length = 339 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 109 tgccgttggcgtcgatgtcga 89
>ref|XM_789909.1| PREDICTED: Strongylocentrotus purpuratus similar to Heat shock 70 kDa protein 1L (Heat shock 70 kDa protein 1-like) (Heat shock 70 kDa protein 1-Hom) (HSP70-Hom) (LOC590300), partial mRNA Length = 884 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 585 tgccgttggcgtcgatgtcga 565
>ref|XM_784982.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock 70kD protein 1A (LOC585145), partial mRNA Length = 493 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 223 tgccgttggcgtcgatgtcga 203
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 3300655 tgccgttggcgtcgatgtcga 3300635
>ref|XM_788217.1| PREDICTED: Strongylocentrotus purpuratus similar to Heat shock 70 kDa protein 1 (HSP70.1) (HSP70-1/HSP70-2) (LOC588537), mRNA Length = 1872 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1459 tgccgttggcgtcgatgtcga 1439
>gb|CP000283.1| Rhodopseudomonas palustris BisB5, complete genome Length = 4892717 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 457334 tgccgttggcgtcgatgtcga 457354
>ref|XM_788368.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock 70kD protein 1B (LOC588698), partial mRNA Length = 1531 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1271 tgccgttggcgtcgatgtcga 1251
>ref|XM_785752.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock 70kD protein 1A (LOC585948), mRNA Length = 636 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 226 tgccgttggcgtcgatgtcga 206
>emb|BX323451.12| Zebrafish DNA sequence from clone DKEY-49H9 in linkage group 8, complete sequence Length = 211489 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 113427 ccgttggcgtcgatgtcgaaggtca 113451
>ref|XM_781142.1| PREDICTED: Strongylocentrotus purpuratus similar to Heat shock 70 kDa protein 1 (HSP70.1) (HSP70-1/HSP70-2) (LOC581126), mRNA Length = 1626 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1276 tgccgttggcgtcgatgtcga 1256
>ref|XM_775284.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock 70kD protein 1-like (LOC574882), mRNA Length = 1836 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1426 tgccgttggcgtcgatgtcga 1406
>ref|XM_775213.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock 70kD protein 1A (LOC574817), mRNA Length = 456 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 226 tgccgttggcgtcgatgtcga 206
>ref|XM_775058.1| PREDICTED: Strongylocentrotus purpuratus similar to heat shock 70kD protein 1B (LOC574693), mRNA Length = 2169 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1759 tgccgttggcgtcgatgtcga 1739
>ref|XM_774884.1| PREDICTED: Strongylocentrotus purpuratus similar to Heat shock 70 kDa protein 1A (Heat shock 70 kDa protein 3) (HSP70.3) (Hsp68) (LOC574568), mRNA Length = 1446 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 979 tgccgttggcgtcgatgtcga 959
>emb|Y14649.1|RLDNAKJ Rhizobium leguminosarum dnaK gene and partial dnaJ gene Length = 2934 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1661 tgccgttggcgtcgatgtcga 1641
>emb|X78415.1|ZMHSP705 Z.mays (cv DH5xDH7) hsp70-5 mRNA for heat shock protein 70 Length = 842 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 183 tgccgttggcgtcgatgtcga 163
>emb|X77209.1|RNHSP703 R.norvegicus Hsp70-3 gene Length = 3913 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 2837 ccgttggcgtcgatgtcgaaggtca 2813
>emb|X77458.1|SCDNAJ S.coelicolor dnaK, grpE and dnaJ genes Length = 5611 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 3235 tgccgttggcgtcgatgtcga 3215
>gb|CP000088.1| Thermobifida fusca YX, complete genome Length = 3642249 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 222912 tgccgttggcgtcgatgtcga 222892
>emb|X58406.1|MTDNAGRP M.tuberculosis dnaK, grpE, and dnaJ genes Length = 4644 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1526 tgccgttggcgtcgatgtcga 1506
>emb|X59437.1|MPHSP70 M.paratuberculosis gene for 70 kD heat shock protein Length = 2179 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1562 tgccgttggcgtcgatgtcga 1542
>gb|CP000089.1| Dechloromonas aromatica RCB, complete genome Length = 4501104 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1000657 tgccgttggcgtcgatgtcga 1000677
>emb|BX927156.1| Corynebacterium glutamicum ATCC 13032, IS fingerprint type 4-5, complete genome; segment 9/10 Length = 349115 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 164749 tgccgttggcgtcgatgtcga 164769
>emb|BX842573.1| Mycobacterium tuberculosis H37Rv complete genome; segment 2/13 Length = 342416 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 79296 tgccgttggcgtcgatgtcga 79276
>emb|BX640449.1| Bordetella bronchiseptica strain RB50, complete genome; segment 13/16 Length = 348074 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 4949 tgccgttggcgtcgatgtcga 4969
>emb|BX640433.1| Bordetella parapertussis strain 12822, complete genome; segment 11/14 Length = 349305 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 291067 tgccgttggcgtcgatgtcga 291087
>emb|BX640418.1| Bordetella pertussis strain Tohama I, complete genome; segment 8/12 Length = 349346 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 216525 tgccgttggcgtcgatgtcga 216545
>emb|BX248335.1| Mycobacterium bovis subsp. bovis AF2122/97 complete genome; segment 2/14 Length = 324050 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 79232 tgccgttggcgtcgatgtcga 79212
>gb|CP000142.2| Pelobacter carbinolicus DSM 2380, complete genome Length = 3665893 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 129962 tgccgttggcgtcgatgtcga 129982
>emb|AL939117.1|SCO939117 Streptomyces coelicolor A3(2) complete genome; segment 14/29 Length = 309050 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 133384 tgccgttggcgtcgatgtcga 133404
>emb|AL939113.1|SCO939113 Streptomyces coelicolor A3(2) complete genome; segment 10/29 Length = 310550 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 196 gccgccgccgaggaggccggcgagg 220 ||||||||||||||||||| ||||| Sbjct: 93382 gccgccgccgaggaggccgccgagg 93358
>emb|AL939108.1|SCO939108 Streptomyces coelicolor A3(2) complete genome; segment 5/29 Length = 339650 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 201 cgccgaggaggccggcgaggg 221 ||||||||||||||||||||| Sbjct: 118610 cgccgaggaggccggcgaggg 118590
>emb|AL731626.4|OSJN00271 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0002J11, complete sequence Length = 143582 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 193 ggcgccgccgccgaggaggccggcg 217 |||| |||||||||||||||||||| Sbjct: 29027 ggcggcgccgccgaggaggccggcg 29003
>emb|AL731638.3|OSJN00283 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0116K07, complete sequence Length = 130779 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 193 ggcgccgccgccgaggaggccggcg 217 |||| |||||||||||||||||||| Sbjct: 128554 ggcggcgccgccgaggaggccggcg 128530
>emb|AL596125.27| Mouse DNA sequence from clone RP23-5O23 on chromosome 11 Contains the Chd3 gene for chromodomain helicase DNA binding protein 3, five novel genes, the 3' end of the gene for a novel protein similar to dynein and four CpG islands, complete sequence Length = 165212 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 187 gaggagggcgccgccgccgaggagg 211 ||||||| ||||||||||||||||| Sbjct: 26856 gaggaggacgccgccgccgaggagg 26832
>emb|AL583925.1|MLEPRTN9 Mycobacterium leprae strain TN complete genome; segment 9/10 Length = 308950 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 281960 tgccgttggcgtcgatgtcga 281980
>emb|AJ535194.1|PFR535194 Propionibacterium freudenreichii subsp. shermanii dnaK1 gene for putative heat shock protein 70_1 Length = 1830 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1363 tgccgttggcgtcgatgtcga 1343
>emb|AJ297379.1|OCU297379 Oryctolagus cuniculus partial hsp70-1 gene for heat shock protein 70 Length = 164 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 121 tgccgttggcgtcgatgtcga 101
>emb|AJ277379.1|TTU277379 Triticum turgidum subsp. durum mRNA for protein disulfide isomerase (Pdi gene), clone pPDICW1V Length = 1659 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 190 gagggcgccgccgccgaggaggccg 214 |||| |||||||||||||||||||| Sbjct: 80 gaggccgccgccgccgaggaggccg 104
>emb|AJ277377.1|TTU277377 Triticum turgidum subsp. durum Pdi gene for protein disulfide isomerase, exons 1-10, clone pPDIGW1VT Length = 3476 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 190 gagggcgccgccgccgaggaggccg 214 |||| |||||||||||||||||||| Sbjct: 80 gaggccgccgccgccgaggaggccg 104
>emb|AJ271444.1|CVI271444 Crassostrea virginica mRNA for heat shock protein 70 (hsp70 gene) Length = 2255 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1595 tgccgttggcgtcgatgtcga 1575
>emb|AJ001727.1|REDNAK Ralstonia sp. CH34 dnaK gene Length = 2509 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1892 tgccgttggcgtcgatgtcga 1872
>gb|AY923043.1| Bradyrhizobium japonicum strain DSM 30131 Hsp70 class chaperone (dnaK) gene, partial cds Length = 598 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 185 tgccgttggcgtcgatgtcga 165
>gb|AY923038.1| Bradyrhizobium sp. LMTR 21 Hsp70 class chaperone (dnaK) gene, partial cds Length = 598 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 185 tgccgttggcgtcgatgtcga 165
>gb|AY923037.1| Bradyrhizobium sp. LMTR 19 Hsp70 class chaperone (dnaK) gene, partial cds Length = 598 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 185 tgccgttggcgtcgatgtcga 165
>gb|AY923036.1| Bradyrhizobium sp. LMTR 14 Hsp70 class chaperone (dnaK) gene, partial cds Length = 598 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 185 tgccgttggcgtcgatgtcga 165
>gb|AY923035.1| Bradyrhizobium sp. LMTR 3 Hsp70 class chaperone (dnaK) gene, partial cds Length = 598 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 185 tgccgttggcgtcgatgtcga 165
>gb|AC104581.22| Homo sapiens chromosome 17, clone RP11-1099M24, complete sequence Length = 187718 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 187 gaggagggcgccgccgccgaggagg 211 ||||||| ||||||||||||||||| Sbjct: 47915 gaggaggacgccgccgccgaggagg 47939
>gb|AY914601.1| Zea mays heat shock protein 70 mRNA, partial cds Length = 1284 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 644 tgccgttggcgtcgatgtcga 624
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 351712 tgccgttggcgtcgatgtcga 351692
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 2111674 tgccgttggcgtcgatgtcga 2111654
>gb|CP000240.1| Synechococcus sp. JA-2-3B'a(2-13), complete genome Length = 3046682 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 2878039 tgccgttggcgtcgatgtcga 2878019
>gb|AE005675.1| Caulobacter crescentus CB15 section 1 of 359 of the complete genome Length = 10171 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 9596 tgccgttggcgtcgatgtcga 9576
>gb|AE011784.1| Xanthomonas axonopodis pv. citri str. 306, section 162 of 469 of the complete genome Length = 13803 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 3341 tgccgttggcgtcgatgtcga 3321
>gb|AE012248.1| Xanthomonas campestris pv. campestris str. ATCC 33913, section 156 of 460 of the complete genome Length = 10786 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1551 tgccgttggcgtcgatgtcga 1531
>dbj|AB211147.1| Gluconobacter oxydans dnaK, dnaJ genes for DnaK, DnaJ, complete cds Length = 4162 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 2104 tgccgttggcgtcgatgtcga 2084
>gb|L46700.1|STMDNAK Streptomyces coelicolor DnaK (dnaK), GrpE (grpE), DnaJ (dnaJ), and heat shock protein (hspR) genes, complete cds Length = 4648 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1559 tgccgttggcgtcgatgtcga 1539
>gb|AF451887.1| Actinomadura spadix strain JCM 3146 HSP70 gene, partial cds Length = 1854 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1363 tgccgttggcgtcgatgtcga 1343
>dbj|AK134269.1| Mus musculus 13 days embryo forelimb cDNA, RIKEN full-length enriched library, clone:5930424B19 product:hypothetical protein, full insert sequence Length = 2201 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 657 ccgttggcgtcgatgtcgaaggtca 681
>gb|AF397036.1| Mus musculus strain B10.A(2R) heat shock protein Hsc70t (Hsc70t) gene, partial cds; and small ribonuclear protein G7b (G7b) gene, viral envelope protein G7e (G7e) gene, valyl-tRNA-synthetase G7a/Bat6 (G7a) gene, G7c (G7c) gene, G7d (G7d) gene, and DNA mismatch repair protein Msh5 (Msh5) gene, complete cds Length = 72790 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 918 ccgttggcgtcgatgtcgaaggtca 894
>gb|AF397035.1| Mus musculus strain B10.A(1R) heat shock protein Hsc70t (Hsc70t) gene, partial cds; and small ribonuclear protein G7b (G7b) gene, viral envelope protein G7e (G7e) gene, valyl-tRNA-synthetase G7a/Bat6 (G7a) gene, G7c (G7c) gene, G7d (G7d) gene, and DNA mismatch repair protein Msh5 (Msh5) gene, complete cds Length = 78679 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 380 ccgttggcgtcgatgtcgaaggtca 356
>gb|L78815.1|MSGB1970CS Mycobacterium leprae cosmid B1970 DNA sequence Length = 39399 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 20622 tgccgttggcgtcgatgtcga 20602
>gb|CP000249.1| Frankia sp. CcI3, complete genome Length = 5433628 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 374 ccgttggcgtcgatgtcgacg 394 ||||||||||||||||||||| Sbjct: 4424791 ccgttggcgtcgatgtcgacg 4424811 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 2545684 tgccgttggcgtcgatgtcga 2545704
>ref|XM_683601.1| PREDICTED: Danio rerio similar to Hsp70 protein (LOC560210), mRNA Length = 2246 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 1539 ccgttggcgtcgatgtcgaaggtca 1515
>ref|XM_702504.1| PREDICTED: Danio rerio similar to Hsp70 protein, transcript variant 2 (LOC559123), mRNA Length = 1961 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 1367 ccgttggcgtcgatgtcgaaggtca 1343
>ref|XM_679567.1| PREDICTED: Danio rerio similar to Hsp70 protein, transcript variant 1 (LOC559123), mRNA Length = 2051 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 1457 ccgttggcgtcgatgtcgaaggtca 1433
>gb|M95576.1|MSGDNAJHSP Mycobacterium leprae heat shock protein 70, hsp70A2 (dnaK) and DNA J heatshock protein (dnaJ) genes, complete cds Length = 4189 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1702 tgccgttggcgtcgatgtcga 1682
>gb|S76750.1| 70K gene [Mycobacterium avium, ATCC25291, Genomic, 150 nt] Length = 150 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 68 tgccgttggcgtcgatgtcga 48
>gb|AF252852.1| Prevotella loescheii DnaK (dnaK) gene, complete cds; and unknown genes Length = 6414 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 2567 tgccgttggcgtcgatgtcga 2547
>gb|AE017285.1| Desulfovibrio vulgaris subsp. vulgaris str. Hildenborough, complete genome Length = 3570858 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 897844 tgccgttggcgtcgatgtcga 897864
>gb|AE016820.2| Ashbya gossypii (= Eremothecium gossypii) ATCC 10895 chromosome VII, complete sequence Length = 1476513 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 186 cgaggagggcgccgccgccgaggag 210 ||||||| ||||||||||||||||| Sbjct: 190943 cgaggagagcgccgccgccgaggag 190967
>gb|CP000050.1| Xanthomonas campestris pv. campestris str. 8004, complete genome Length = 5148708 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 3320018 tgccgttggcgtcgatgtcga 3320038
>gb|CP000116.1| Thiobacillus denitrificans ATCC 25259, complete genome Length = 2909809 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1623860 tgccgttggcgtcgatgtcga 1623840
>gb|AE002098.2| Neisseria meningitidis MC58, complete genome Length = 2272360 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 583039 tgccgttggcgtcgatgtcga 583059
>emb|BX511232.6| Zebrafish DNA sequence from clone CH211-11K18 in linkage group 3, complete sequence Length = 171843 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 6644 ccgttggcgtcgatgtcgaaggtca 6620 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 656 ccgttggcgtcgatgtcgaaggtca 680
>gb|AF302775.2|AF302775 Xanthomonas campestris pv. campestris HrcA (hrcA) gene, complete cds; GrpE (grpE), DnaK (dnaK), and DnaJ (dnaJ) genes, complete cds; and pyridoxine kinase (pdxK) gene, partial cds Length = 6401 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 3439 tgccgttggcgtcgatgtcga 3419
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 193 ggcgccgccgccgaggaggccggcg 217 |||| |||||||||||||||||||| Sbjct: 25246887 ggcggcgccgccgaggaggccggcg 25246863 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 186 cgaggagggcgccgccgccg 205 |||||||||||||||||||| Sbjct: 33591611 cgaggagggcgccgccgccg 33591630 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 194 gcgccgccgccgaggaggcc 213 |||||||||||||||||||| Sbjct: 19127676 gcgccgccgccgaggaggcc 19127695 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 195 cgccgccgccgaggaggccg 214 |||||||||||||||||||| Sbjct: 4983269 cgccgccgccgaggaggccg 4983250 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Minus Query: 195 cgccgccgccgaggaggccg 214 |||||||||||||||||||| Sbjct: 4824091 cgccgccgccgaggaggccg 4824072
>gb|M55224.1|CCRDNAK Caulobacter crescentus heat shock protein (dnaK) gene, complete cds; and heat shock protein (dnaJ) gene, partial cds Length = 3051 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1855 tgccgttggcgtcgatgtcga 1835
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete sequence Length = 29737217 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 22455012 tgccgttggcgtcgatgtcga 22455032 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 193 ggcgccgccgccgaggaggcc 213 ||||||||||||||||||||| Sbjct: 18668162 ggcgccgccgccgaggaggcc 18668182
>gb|AF254578.1|AF254578 Mycobacterium avium subsp. paratuberculosis 70 kDa heat shock chaperonin protein gene, complete cds Length = 1931 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1384 tgccgttggcgtcgatgtcga 1364
>gb|AF318605.1|AF318605 Heterodera glycines heat shock protein 70 mRNA, complete cds Length = 2029 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1479 tgccgttggcgtcgatgtcga 1459
>gb|AF210640.1|AF210640 Danio rerio Hsp70 gene, complete cds Length = 2770 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 2123 ccgttggcgtcgatgtcgaaggtca 2099
>dbj|BA000036.3| Corynebacterium glutamicum ATCC 13032 DNA, complete genome Length = 3309401 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 2985030 tgccgttggcgtcgatgtcga 2985050
>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome Length = 9025608 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 8631628 tgccgttggcgtcgatgtcga 8631608 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 5480413 tgccgttggcgtcgatgtcga 5480393 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 194 gcgccgccgccgaggaggccg 214 ||||||||||||||||||||| Sbjct: 4822038 gcgccgccgccgaggaggccg 4822018 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 196 gccgccgccgaggaggccggc 216 ||||||||||||||||||||| Sbjct: 2832560 gccgccgccgaggaggccggc 2832580 Score = 40.1 bits (20), Expect = 7.6 Identities = 20/20 (100%) Strand = Plus / Plus Query: 192 gggcgccgccgccgaggagg 211 |||||||||||||||||||| Sbjct: 1594613 gggcgccgccgccgaggagg 1594632
>gb|DQ286711.1| Eisenia fetida HSp70 mRNA, partial cds Length = 397 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 173 tgccgttggcgtcgatgtcga 153
>gb|CP000251.1| Anaeromyxobacter dehalogenans 2CP-C, complete genome Length = 5013479 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 190 gagggcgccgccgccgaggaggccg 214 |||| |||||||||||||||||||| Sbjct: 1241136 gaggacgccgccgccgaggaggccg 1241160
>gb|AF286875.1|AF286875 Oryzias latipes HSP70-1 protein gene, complete cds Length = 3415 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 2399 tgccgttggcgtcgatgtcga 2379
>gb|AY161283.1| Heterodera glycines heat shock protein 70 A gene, complete cds Length = 2917 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 2187 tgccgttggcgtcgatgtcga 2167
>dbj|BA000045.2| Gloeobacter violaceus PCC 7421 DNA, complete genome Length = 4659019 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 4485907 tgccgttggcgtcgatgtcga 4485887
>dbj|BA000035.2| Corynebacterium efficiens YS-314 DNA, complete genome Length = 3147090 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 2797713 tgccgttggcgtcgatgtcga 2797733
>dbj|BA000012.4| Mesorhizobium loti MAFF303099 DNA, complete genome Length = 7036071 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 3773273 tgccgttggcgtcgatgtcga 3773293
>ref|NM_211454.1| Eremothecium gossypii AGL275Wp (AGL275W), mRNA Length = 2265 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Plus Query: 186 cgaggagggcgccgccgccgaggag 210 ||||||| ||||||||||||||||| Sbjct: 2010 cgaggagagcgccgccgccgaggag 2034
>emb|AL646052.1| Ralstonia solanacearum GMI1000 chromosome complete sequence Length = 3716413 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Plus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 2838515 tgccgttggcgtcgatgtcga 2838535
>gb|AY752744.1| Rhizobium leguminosarum strain ATCC 10004 DnaK gene, complete cds Length = 1917 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1432 tgccgttggcgtcgatgtcga 1412
>gb|AY752741.1| Mesorhizobium loti strain ATCC 33669 DnaK gene, complete cds Length = 1917 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1432 tgccgttggcgtcgatgtcga 1412
>gb|AY752740.1| Mesorhizobium ciceri strain ATCC 51585 DnaK gene, complete cds Length = 1917 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1432 tgccgttggcgtcgatgtcga 1412
>gb|AY752737.1| Agrobacterium rhizogenes strain ATCC 11325 DnaK gene, complete cds Length = 1920 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1432 tgccgttggcgtcgatgtcga 1412
>gb|AY109330.1| Zea mays CL45_1 mRNA sequence Length = 3772 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 2743 tgccgttggcgtcgatgtcga 2723
>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome Length = 2702173 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 926655 tgccgttggcgtcgatgtcga 926635
>gb|AF145251.1|AF145251 Rhodothermus marinus heat shock protein DnaK (dnaK) gene, complete cds Length = 3046 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 1957 tgccgttggcgtcgatgtcga 1937
>gb|AY328388.1| Bradyrhizobium sp. Da3.1 DnaK (dnaK) gene, partial cds Length = 603 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 182 tgccgttggcgtcgatgtcga 162
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 42.1 bits (21), Expect = 1.9 Identities = 21/21 (100%) Strand = Plus / Minus Query: 372 tgccgttggcgtcgatgtcga 392 ||||||||||||||||||||| Sbjct: 2131574 tgccgttggcgtcgatgtcga 2131554
>gb|BC108294.1| Rattus norvegicus heat shock 70kD protein 1-like (mapped), mRNA (cDNA clone MGC:112562 IMAGE:7111250), complete cds Length = 2288 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 1480 ccgttggcgtcgatgtcgaaggtca 1456
>gb|BC108297.1| Rattus norvegicus heat shock 70kD protein 1-like (mapped), mRNA (cDNA clone MGC:114222 IMAGE:7115041), complete cds Length = 2434 Score = 42.1 bits (21), Expect = 1.9 Identities = 24/25 (96%) Strand = Plus / Minus Query: 374 ccgttggcgtcgatgtcgacggtca 398 ||||||||||||||||||| ||||| Sbjct: 1618 ccgttggcgtcgatgtcgaaggtca 1594 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,478,136 Number of Sequences: 3902068 Number of extensions: 3478136 Number of successful extensions: 72850 Number of sequences better than 10.0: 347 Number of HSP's better than 10.0 without gapping: 357 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 67399 Number of HSP's gapped (non-prelim): 5448 length of query: 561 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 538 effective length of database: 17,143,297,704 effective search space: 9223094164752 effective search space used: 9223094164752 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)