Clone Name | rbasd26j17 |
---|---|
Clone Library Name | barley_pub |
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 244 bits (123), Expect = 3e-61 Identities = 291/347 (83%) Strand = Plus / Minus Query: 231 ttgagaaatcttgccgggctgaagggcgcaagatcaacgatcttggcctgcccatcgagg 290 |||||||| ||||| |||||||| ||||| ||||| ||||||||||| | || |||||| Sbjct: 2978646 ttgagaaaccttgctgggctgaacggcgcgagatcgacgatcttggcatcgccgtcgagg 2978587 Query: 291 atgagctcggcgagtgctgcaccggtaactggagcattgaggatcccccagcagctgtgc 350 |||||||| ||||| || |||||||| |||||||||||||||||||||||||||||||| Sbjct: 2978586 atgagctctgcgagagcggcaccggtggctggagcattgaggatcccccagcagctgtgc 2978527 Query: 351 ccggttgcaacgtagcatcccttcaccccgggcatttccccaatgaccggcagcccgtca 410 ||||| || || ||||| |||||||| || ||||| ||||| || ||||||| |||||| Sbjct: 2978526 ccggtggcgacatagcaacccttcactccaggcatctccccgatcaccggcaaaccgtca 2978467 Query: 411 tcggtgcacgggaggtagcaggcctgttccgcgactacctctgcgccctcctctgtcttg 470 ||||||||||| |||||||| ||||| ||||| || ||||| ||||| ||||| |||| Sbjct: 2978466 tcggtgcacggcaggtagcaagcctgctccgccaccacctccgcgccttcctccctcttc 2978407 Query: 471 agctggctggacaccctcccagcaatcttatgaagcattgcaatggagtcaggctccccg 530 ||||||| ||| |||||||| || ||||| || ||||| ||||| ||||| ||||| ||| Sbjct: 2978406 agctggccggaaaccctcccggcgatcttgtgcagcatcgcaattgagtccggctcaccg 2978347 Query: 531 gcaatcgttgccggatcatctggaacttgctcgtccttgctcattcc 577 | ||||| |||| ||||| || || | ||| |||||| ||||||| Sbjct: 2978346 gtgatcgtctccgggtcatcgggcacctcctcatccttggtcattcc 2978300
>dbj|AP005409.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0024L18 Length = 150128 Score = 244 bits (123), Expect = 3e-61 Identities = 291/347 (83%) Strand = Plus / Minus Query: 231 ttgagaaatcttgccgggctgaagggcgcaagatcaacgatcttggcctgcccatcgagg 290 |||||||| ||||| |||||||| ||||| ||||| ||||||||||| | || |||||| Sbjct: 24701 ttgagaaaccttgctgggctgaacggcgcgagatcgacgatcttggcatcgccgtcgagg 24642 Query: 291 atgagctcggcgagtgctgcaccggtaactggagcattgaggatcccccagcagctgtgc 350 |||||||| ||||| || |||||||| |||||||||||||||||||||||||||||||| Sbjct: 24641 atgagctctgcgagagcggcaccggtggctggagcattgaggatcccccagcagctgtgc 24582 Query: 351 ccggttgcaacgtagcatcccttcaccccgggcatttccccaatgaccggcagcccgtca 410 ||||| || || ||||| |||||||| || ||||| ||||| || ||||||| |||||| Sbjct: 24581 ccggtggcgacatagcaacccttcactccaggcatctccccgatcaccggcaaaccgtca 24522 Query: 411 tcggtgcacgggaggtagcaggcctgttccgcgactacctctgcgccctcctctgtcttg 470 ||||||||||| |||||||| ||||| ||||| || ||||| ||||| ||||| |||| Sbjct: 24521 tcggtgcacggcaggtagcaagcctgctccgccaccacctccgcgccttcctccctcttc 24462 Query: 471 agctggctggacaccctcccagcaatcttatgaagcattgcaatggagtcaggctccccg 530 ||||||| ||| |||||||| || ||||| || ||||| ||||| ||||| ||||| ||| Sbjct: 24461 agctggccggaaaccctcccggcgatcttgtgcagcatcgcaattgagtccggctcaccg 24402 Query: 531 gcaatcgttgccggatcatctggaacttgctcgtccttgctcattcc 577 | ||||| |||| ||||| || || | ||| |||||| ||||||| Sbjct: 24401 gtgatcgtctccgggtcatcgggcacctcctcatccttggtcattcc 24355
>dbj|AK105193.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-107-D11, full insert sequence Length = 1364 Score = 244 bits (123), Expect = 3e-61 Identities = 291/347 (83%) Strand = Plus / Minus Query: 231 ttgagaaatcttgccgggctgaagggcgcaagatcaacgatcttggcctgcccatcgagg 290 |||||||| ||||| |||||||| ||||| ||||| ||||||||||| | || |||||| Sbjct: 1175 ttgagaaaccttgctgggctgaacggcgcgagatcgacgatcttggcatcgccgtcgagg 1116 Query: 291 atgagctcggcgagtgctgcaccggtaactggagcattgaggatcccccagcagctgtgc 350 |||||||| ||||| || |||||||| |||||||||||||||||||||||||||||||| Sbjct: 1115 atgagctctgcgagagcggcaccggtggctggagcattgaggatcccccagcagctgtgc 1056 Query: 351 ccggttgcaacgtagcatcccttcaccccgggcatttccccaatgaccggcagcccgtca 410 ||||| || || ||||| |||||||| || ||||| ||||| || ||||||| |||||| Sbjct: 1055 ccggtggcgacatagcaacccttcactccaggcatctccccgatcaccggcaaaccgtca 996 Query: 411 tcggtgcacgggaggtagcaggcctgttccgcgactacctctgcgccctcctctgtcttg 470 ||||||||||| |||||||| ||||| ||||| || ||||| ||||| ||||| |||| Sbjct: 995 tcggtgcacggcaggtagcaagcctgctccgccaccacctccgcgccttcctccctcttc 936 Query: 471 agctggctggacaccctcccagcaatcttatgaagcattgcaatggagtcaggctccccg 530 ||||||| ||| |||||||| || ||||| || ||||| ||||| ||||| ||||| ||| Sbjct: 935 agctggccggaaaccctcccggcgatcttgtgcagcatcgcaattgagtccggctcaccg 876 Query: 531 gcaatcgttgccggatcatctggaacttgctcgtccttgctcattcc 577 | ||||| |||| ||||| || || | ||| |||||| ||||||| Sbjct: 875 gtgatcgtctccgggtcatcgggcacctcctcatccttggtcattcc 829
>gb|AY105159.1| Zea mays PCO075778 mRNA sequence Length = 604 Score = 230 bits (116), Expect = 4e-57 Identities = 287/344 (83%) Strand = Plus / Plus Query: 231 ttgagaaatcttgccgggctgaagggcgcaagatcaacgatcttggcctgcccatcgagg 290 |||||||| |||||||||||||| ||| | |||||||||||||||| || || || ||| Sbjct: 182 ttgagaaaccttgccgggctgaaaggctcgagatcaacgatcttggacttgccgtccagg 241 Query: 291 atgagctcggcgagtgctgcaccggtaactggagcattgaggatcccccagcagctgtgc 350 |||||||||||||| ||||| ||||| | ||| |||||||||| |||||||||||||| Sbjct: 242 atgagctcggcgagggctgcgccggtggccggaccattgaggataccccagcagctgtgg 301 Query: 351 ccggttgcaacgtagcatcccttcaccccgggcatttccccaatgaccggcagcccgtca 410 || || || || ||||| || ||||| || || || ||||| ||||||||||||||||| Sbjct: 302 cccgtggccacatagcaccctttcacgcctggtatctccccgatgaccggcagcccgtcg 361 Query: 411 tcggtgcacgggaggtagcaggcctgttccgcgactacctctgcgccctcctctgtcttg 470 |||||||||| |||||||| ||||| |||||||| ||||| ||||||||||| |||| Sbjct: 362 gcggtgcacggcaggtagcacgcctgctccgcgaccacctcagcgccctcctccttcttc 421 Query: 471 agctggctggacaccctcccagcaatcttatgaagcattgcaatggagtcaggctccccg 530 |||||||||||||| | || || |||||||| ||||||||||| ||||| ||||| || Sbjct: 422 agctggctggacactttgcctgcgatcttatgcagcattgcaatcgagtctggctcgcct 481 Query: 531 gcaatcgttgccggatcatctggaacttgctcgtccttgctcat 574 | |||||||| || |||||||| | ||||||||||||||| Sbjct: 482 actatcgttgctgggtcatctggcgggttctcgtccttgctcat 525
>gb|BT017394.1| Zea mays clone EL01N0327H09.c mRNA sequence Length = 711 Score = 228 bits (115), Expect = 2e-56 Identities = 271/323 (83%) Strand = Plus / Minus Query: 231 ttgagaaatcttgccgggctgaagggcgcaagatcaacgatcttggcctgcccatcgagg 290 |||||||| |||||||||||||| ||| | |||||||||||||||| || || || ||| Sbjct: 652 ttgagaaaccttgccgggctgaaaggctcgagatcaacgatcttggacttgccgtccagg 593 Query: 291 atgagctcggcgagtgctgcaccggtaactggagcattgaggatcccccagcagctgtgc 350 |||||||||||||| ||||| ||||| | ||| |||||||||| |||||||||||||| Sbjct: 592 atgagctcggcgagggctgcgccggtggccggaccattgaggataccccagcagctgtgg 533 Query: 351 ccggttgcaacgtagcatcccttcaccccgggcatttccccaatgaccggcagcccgtca 410 || || || || ||||| || ||||| || || || ||||| ||||||||||||||||| Sbjct: 532 cccgtggccacatagcaccctttcacgcctggtatctccccgatgaccggcagcccgtcg 473 Query: 411 tcggtgcacgggaggtagcaggcctgttccgcgactacctctgcgccctcctctgtcttg 470 |||||||||| |||||||| ||||| |||||||| ||||| ||||||||||| |||| Sbjct: 472 gcggtgcacggcaggtagcacgcctgctccgcgaccacctcagcgccctcctccttcttc 413 Query: 471 agctggctggacaccctcccagcaatcttatgaagcattgcaatggagtcaggctccccg 530 |||||||||||||| | || || |||||||| ||||||||||| ||||| ||||| || Sbjct: 412 agctggctggacactttgcctgcgatcttatgcagcattgcaatcgagtctggctcgcct 353 Query: 531 gcaatcgttgccggatcatctgg 553 | |||||||| || |||||||| Sbjct: 352 actatcgttgctgggtcatctgg 330
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 135 bits (68), Expect = 2e-28 Identities = 170/204 (83%) Strand = Plus / Plus Query: 287 gaggatgagctcggcgagtgctgcaccggtaactggagcattgaggatcccccagcagct 346 |||||||||||| ||||| || || ||||| | ||||| |||||||| ||||| | || Sbjct: 23298054 gaggatgagctccgcgagcgcagcgccggtggccggagcgttgaggattccccacccgcc 23298113 Query: 347 gtgcccggttgcaacgtagcatcccttcaccccgggcatttccccaatgaccggcagccc 406 ||||||||| || |||||||| ||||||||||| ||||| || || || ||||||| ||| Sbjct: 23298114 gtgcccggtggcgacgtagcaacccttcaccccaggcatctctccgatcaccggcaaccc 23298173 Query: 407 gtcatcggtgcacgggaggtagcaggcctgttccgcgactacctctgcgccctcctctgt 466 |||| ||||||||| | |||||| ||||| ||||| || ||||| ||||| ||||| | Sbjct: 23298174 gtcactggtgcacggcatgtagcaagcctgctccgccaccacctccgcgccttcctccct 23298233 Query: 467 cttgagctggctggacaccctccc 490 ||| |||||||||||||||||||| Sbjct: 23298234 cttcagctggctggacaccctccc 23298257
>dbj|AP003333.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, BAC clone:B1103C09 Length = 163996 Score = 135 bits (68), Expect = 2e-28 Identities = 170/204 (83%) Strand = Plus / Plus Query: 287 gaggatgagctcggcgagtgctgcaccggtaactggagcattgaggatcccccagcagct 346 |||||||||||| ||||| || || ||||| | ||||| |||||||| ||||| | || Sbjct: 23752 gaggatgagctccgcgagcgcagcgccggtggccggagcgttgaggattccccacccgcc 23811 Query: 347 gtgcccggttgcaacgtagcatcccttcaccccgggcatttccccaatgaccggcagccc 406 ||||||||| || |||||||| ||||||||||| ||||| || || || ||||||| ||| Sbjct: 23812 gtgcccggtggcgacgtagcaacccttcaccccaggcatctctccgatcaccggcaaccc 23871 Query: 407 gtcatcggtgcacgggaggtagcaggcctgttccgcgactacctctgcgccctcctctgt 466 |||| ||||||||| | |||||| ||||| ||||| || ||||| ||||| ||||| | Sbjct: 23872 gtcactggtgcacggcatgtagcaagcctgctccgccaccacctccgcgccttcctccct 23931 Query: 467 cttgagctggctggacaccctccc 490 ||| |||||||||||||||||||| Sbjct: 23932 cttcagctggctggacaccctccc 23955
>dbj|AP003253.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0451D05 Length = 148381 Score = 135 bits (68), Expect = 2e-28 Identities = 170/204 (83%) Strand = Plus / Plus Query: 287 gaggatgagctcggcgagtgctgcaccggtaactggagcattgaggatcccccagcagct 346 |||||||||||| ||||| || || ||||| | ||||| |||||||| ||||| | || Sbjct: 84796 gaggatgagctccgcgagcgcagcgccggtggccggagcgttgaggattccccacccgcc 84855 Query: 347 gtgcccggttgcaacgtagcatcccttcaccccgggcatttccccaatgaccggcagccc 406 ||||||||| || |||||||| ||||||||||| ||||| || || || ||||||| ||| Sbjct: 84856 gtgcccggtggcgacgtagcaacccttcaccccaggcatctctccgatcaccggcaaccc 84915 Query: 407 gtcatcggtgcacgggaggtagcaggcctgttccgcgactacctctgcgccctcctctgt 466 |||| ||||||||| | |||||| ||||| ||||| || ||||| ||||| ||||| | Sbjct: 84916 gtcactggtgcacggcatgtagcaagcctgctccgccaccacctccgcgccttcctccct 84975 Query: 467 cttgagctggctggacaccctccc 490 ||| |||||||||||||||||||| Sbjct: 84976 cttcagctggctggacaccctccc 84999
>gb|AC112676.8| Mus musculus chromosome 9, clone RP23-174F7, complete sequence Length = 230293 Score = 46.1 bits (23), Expect = 0.13 Identities = 23/23 (100%) Strand = Plus / Plus Query: 329 gaggatcccccagcagctgtgcc 351 ||||||||||||||||||||||| Sbjct: 190376 gaggatcccccagcagctgtgcc 190398
>dbj|AP002833.3| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-688I9, complete sequence Length = 175562 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 453 gcgccctcctctgtcttgagc 473 ||||||||||||||||||||| Sbjct: 118037 gcgccctcctctgtcttgagc 118017
>gb|BC068332.1| Danio rerio zgc:85626, mRNA (cDNA clone MGC:85626 IMAGE:6525318), complete cds Length = 1888 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 agtgttgaaggtttatttat 59 |||||||||||||||||||| Sbjct: 1565 agtgttgaaggtttatttat 1546
>ref|XM_656096.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN3584.2), mRNA Length = 1464 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gaggatgagctcggcgagtg 306 |||||||||||||||||||| Sbjct: 129 gaggatgagctcggcgagtg 148
>gb|AC184077.2| Populus trichocarpa clone Pop1-53L15, complete sequence Length = 28233 Score = 40.1 bits (20), Expect = 7.8 Identities = 47/56 (83%) Strand = Plus / Minus Query: 336 ccccagcagctgtgcccggttgcaacgtagcatcccttcaccccgggcatttcccc 391 ||||| ||| ||||||| || ||||| || || |||||||||||||| || ||||| Sbjct: 16855 ccccaacagttgtgcccagtggcaacataacaacccttcaccccgggaatctcccc 16800
>emb|AL772148.6| Zebrafish DNA sequence from clone CH211-153C20 in linkage group 24 Contains part of a novel gene similar to human DECR2 (peroxisomal 2,4-dienoyl CoA reductase 2), a novel gene similar to human KIAA0665, a novel gene similar to human KIAA0683, a novel gene similar to human KIAA0590, part of a novel gene and three CpG islands, complete sequence Length = 161218 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 40 agtgttgaaggtttatttat 59 |||||||||||||||||||| Sbjct: 153628 agtgttgaaggtttatttat 153647
>emb|BX897741.9| Zebrafish DNA sequence from clone DKEY-273O13 in linkage group 5, complete sequence Length = 168673 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 220 tcttcttgttgttgagaaat 239 |||||||||||||||||||| Sbjct: 22893 tcttcttgttgttgagaaat 22874
>gb|AC104450.2| Homo sapiens chromosome 3 clone RP11-493K19, complete sequence Length = 217337 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 469 tgagctggctggacaccctc 488 |||||||||||||||||||| Sbjct: 86896 tgagctggctggacaccctc 86915
>gb|AF291662.1| Aspergillus nidulans Kex2-like dibasic endoprotease ANPC gene, complete cds Length = 4688 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 287 gaggatgagctcggcgagtg 306 |||||||||||||||||||| Sbjct: 3889 gaggatgagctcggcgagtg 3908
>ref|XM_681635.1| PREDICTED: Danio rerio similar to 2,4-dienoyl CoA reductase 2, peroxisomal, transcript variant 1 (LOC573514), mRNA Length = 1848 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 agtgttgaaggtttatttat 59 |||||||||||||||||||| Sbjct: 1583 agtgttgaaggtttatttat 1564
>ref|XM_703423.1| PREDICTED: Danio rerio similar to 2,4-dienoyl CoA reductase 2, peroxisomal, transcript variant 2 (LOC573514), mRNA Length = 1796 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 agtgttgaaggtttatttat 59 |||||||||||||||||||| Sbjct: 1531 agtgttgaaggtttatttat 1512
>ref|XM_681286.1| PREDICTED: Danio rerio similar to 2,4-dienoyl CoA reductase 2, peroxisomal, transcript variant 1 (LOC573411), mRNA Length = 1846 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 agtgttgaaggtttatttat 59 |||||||||||||||||||| Sbjct: 1581 agtgttgaaggtttatttat 1562
>ref|XM_703300.1| PREDICTED: Danio rerio similar to 2,4-dienoyl CoA reductase 2, peroxisomal, transcript variant 2 (LOC573411), mRNA Length = 1794 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 agtgttgaaggtttatttat 59 |||||||||||||||||||| Sbjct: 1529 agtgttgaaggtttatttat 1510
>ref|NM_213321.1| Danio rerio zgc:85626 (zgc:85626), mRNA Length = 1888 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 agtgttgaaggtttatttat 59 |||||||||||||||||||| Sbjct: 1565 agtgttgaaggtttatttat 1546
>gb|AC009490.10| Homo sapiens BAC clone RP11-355A23 from 2, complete sequence Length = 158692 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 222 ttcttgttgttgagaaatct 241 |||||||||||||||||||| Sbjct: 68733 ttcttgttgttgagaaatct 68714
>emb|BX322785.6| Zebrafish DNA sequence from clone DKEYP-78B1 in linkage group 24, complete sequence Length = 176602 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 agtgttgaaggtttatttat 59 |||||||||||||||||||| Sbjct: 37735 agtgttgaaggtttatttat 37716
>gb|AC151747.3| Ornithorhynchus anatinus chromosome UNK clone OABb-520P24, complete sequence Length = 142317 Score = 40.1 bits (20), Expect = 7.8 Identities = 23/24 (95%) Strand = Plus / Minus Query: 98 tacattatttgatttggtgtcccc 121 ||||||||||||||| |||||||| Sbjct: 3519 tacattatttgattttgtgtcccc 3496
>gb|AC004814.2|AC004814 Homo sapiens clone 3938P1, complete sequence Length = 83030 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Plus Query: 469 tgagctggctggacaccctc 488 |||||||||||||||||||| Sbjct: 8137 tgagctggctggacaccctc 8156
>emb|AL954147.12| Zebrafish DNA sequence from clone CH211-117H23 in linkage group 24, complete sequence Length = 188067 Score = 40.1 bits (20), Expect = 7.8 Identities = 20/20 (100%) Strand = Plus / Minus Query: 40 agtgttgaaggtttatttat 59 |||||||||||||||||||| Sbjct: 112391 agtgttgaaggtttatttat 112372 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,263,108 Number of Sequences: 3902068 Number of extensions: 4263108 Number of successful extensions: 71745 Number of sequences better than 10.0: 27 Number of HSP's better than 10.0 without gapping: 27 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 71653 Number of HSP's gapped (non-prelim): 91 length of query: 577 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 554 effective length of database: 17,143,297,704 effective search space: 9497386928016 effective search space used: 9497386928016 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)