ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd26j06
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1dbj|AK102345.1| Oryza sativa (japonica cultivar-group) cDNA clon... 206 7e-50
2dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 103 7e-19
3dbj|AP006058.3| Oryza sativa (japonica cultivar-group) genomic D... 103 7e-19
4emb|CT009732.8| Mouse DNA sequence from clone RP23-72O20 on chro... 46 0.15
5gb|AC009206.21| Drosophila melanogaster clone BACR15A11, complet... 42 2.3
6gb|AC140286.3| Mus musculus BAC clone RP24-573E14 from chromosom... 42 2.3
7gb|AC164411.4| Mus musculus chromosome 1, clone RP23-60E6, compl... 42 2.3
8gb|AC087116.13| Mus Musculus Strain C57BL6/J Chromosome 15~RP23-... 42 2.3
9gb|AC153118.4| Monodelphis domestica clone VMRC6-501L16, complet... 42 2.3
10gb|AC119268.12| Mus musculus chromosome 5, clone RP24-324M10, co... 42 2.3
11gb|AE003788.5| Drosophila melanogaster chromosome 2R, section 1 ... 42 2.3
12gb|AC102666.13| Mus musculus chromosome 1, clone RP23-444A8, com... 42 2.3
13emb|AL672009.19| Zebrafish DNA sequence from clone BUSM1-137H13 ... 42 2.3
14gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold 42 2.3
15ref|NM_001030006.1| Homo sapiens adaptor-related protein complex... 40 9.2
16ref|NM_001282.2| Homo sapiens adaptor-related protein complex 2,... 40 9.2
17gb|AC137610.2| Oryza sativa (japonica cultivar-group) chromosome... 40 9.2
18gb|AC119615.7| Rattus norvegicus 10 NOVECTOR CH230-502G21 (Child... 40 9.2
19gb|AC117218.3| Mus musculus BAC clone RP23-344B4 from 15, comple... 40 9.2
20ref|NM_080583.1| Rattus norvegicus adaptor-related protein compl... 40 9.2
21gb|BC103481.1| Rattus norvegicus adaptor-related protein complex... 40 9.2
22gb|AC130731.2| Oryza sativa (japonica cultivar-group) chromosome... 40 9.2
23ref|XM_501016.1| Yarrowia lipolytica CLIB122, YALI0B17424g predi... 40 9.2
24emb|AL390788.15| Human DNA sequence from clone RP11-384P5 on chr... 40 9.2
25gb|AY341427.1| Homo sapiens beta adaptin subunit mRNA, complete ... 40 9.2
26emb|AL137066.15| Human DNA sequence from clone RP11-10I9 on chro... 40 9.2
27emb|AL078595.12|HSDJ399J4 Human DNA sequence from clone RP3-399J... 40 9.2
28emb|AL009048.1|HS433G13 Human DNA sequence from clone RP3-433G13... 40 9.2
29emb|CR388002.6| Zebrafish DNA sequence from clone DKEY-75M8 in l... 40 9.2
30emb|AL607024.17| Mouse DNA sequence from clone RP23-194P5 on chr... 40 9.2
31emb|AL603711.6| Mouse DNA sequence from clone RP23-381B19 on chr... 40 9.2
32gb|AC007110.3| Homo sapiens chromosome 6, clone hRPK.472_J_18, c... 40 9.2
33emb|CR860139.1| Pongo pygmaeus mRNA; cDNA DKFZp469O1619 (from cl... 40 9.2
34gb|AC096509.9| Homo sapiens X BAC RP11-454K24 (Roswell Park Canc... 40 9.2
35gb|AC124036.5| Mus Musculus Strain C57BL6/J chromosome 11 BAC Cl... 40 9.2
36gb|AC117420.4| Homo sapiens 3 BAC RP11-145A16 (Roswell Park Canc... 40 9.2
37ref|NM_027915.3| Mus musculus adaptor-related protein complex 2,... 40 9.2
38ref|NM_001035854.2| Mus musculus adaptor-related protein complex... 40 9.2
39emb|BX511162.8| Zebrafish DNA sequence from clone DKEY-240B22 in... 40 9.2
40emb|CR749392.1| Homo sapiens mRNA; cDNA DKFZp781K0743 (from clon... 40 9.2
41emb|CR599737.1| full-length cDNA clone CS0DF027YO06 of Fetal bra... 40 9.2
42gb|AC015849.5| Homo sapiens chromosome 17, clone RP11-362K1, com... 40 9.2
43gb|AC122543.1| Genomic sequence for Brassica oleracea, clone B21... 40 9.2
44gb|AC060226.39| Homo sapiens 12 BAC RP11-101P14 (Roswell Park Ca... 40 9.2
45dbj|AK138434.1| Mus musculus adult male hypothalamus cDNA, RIKEN... 40 9.2
46gb|AC007538.5| Homo sapiens Xq28 PAC RPCI6-224C24 (Roswell Park ... 40 9.2
47gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold 40 9.2
48dbj|AB169049.1| Macaca fascicularis testis cDNA, clone: QtsA-168... 40 9.2
49gb|BC013699.1| Mus musculus adaptor-related protein complex 2, b... 40 9.2
50gb|BC012150.1|BC012150 Homo sapiens, clone IMAGE:4558274, mRNA, ... 40 9.2
51dbj|AK004975.1| Mus musculus adult male liver cDNA, RIKEN full-l... 40 9.2
52gb|BC030349.1| Mus musculus adaptor-related protein complex 2, b... 40 9.2
53ref|XM_623652.1| PREDICTED: Apis mellifera similar to plasma mem... 40 9.2
54dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 40 9.2
55gb|AC116482.11| Mus musculus chromosome 8, clone RP23-423D8, com... 40 9.2
56gb|AC124040.3| Oryctolagus cuniculus clone LB1-18E1, complete se... 40 9.2
57gb|AC079902.15| Homo sapiens X BAC RP11-352L18 (Roswell Park Can... 40 9.2
58gb|AC006464.3| Homo sapiens BAC clone RP11-436C12 from 2, comple... 40 9.2
59gb|CP000084.1| Candidatus Pelagibacter ubique HTCC1062, complete... 40 9.2
60emb|AJ535360.1|AMI535360 Alexandrium minutum 28S rRNA gene, stra... 40 9.2
61gb|AC006237.1|AC006237 Homo sapiens chromosome 17, clone hRPC.16... 40 9.2
62dbj|AP000797.6| Homo sapiens genomic DNA, chromosome 11 clone:CM... 40 9.2
63dbj|AB017651.2| Homo sapiens genomic DNA, chromosome 11q23.2, cl... 40 9.2
64gb|AC153592.3| Mus musculus 6 BAC RP23-20C15 (Roswell Park Cance... 40 9.2
65gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome 40 9.2
66gb|AC125525.3| Mus musculus BAC clone RP24-395H10 from 1, comple... 40 9.2
67emb|CT573021.3| Pig DNA sequence from clone XX-BE155F1 on chromo... 40 9.2
68gb|BC006201.2| Homo sapiens adaptor-related protein complex 2, b... 40 9.2
69emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB1... 40 9.2
70gb|AC144818.4| Mus musculus BAC clone RP23-97O1 from chromosome ... 40 9.2
71emb|AL807402.1|CNS08CA6 Mus musculus chromosome 11 region in the... 40 9.2
72emb|AL669895.9| Mouse DNA sequence from clone RP23-31N7 on chrom... 40 9.2
73gb|M77246.1|RATBCCAPB R.norvegicus beta-chain clathrin associate... 40 9.2
74gb|M34176.1|RATBADPTA Rat beta adaptin mRNA, complete cds 40 9.2
75emb|X64467.1|HSALADG H.sapiens ALAD gene for porphobilinogen syn... 40 9.2
76gb|M34175.1|HUMBADPTA Human beta adaptin mRNA, complete cds 40 9.2 
>dbj|AK102345.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033091B21, full
            insert sequence
          Length = 3488

 Score =  206 bits (104), Expect = 7e-50
 Identities = 293/356 (82%)
 Strand = Plus / Minus

                                                                        
Query: 130  ttttgagtgtaaagtaataactggcaaccatcgtcagctactgccactacgcttgatttg 189
            |||||| |||||||||  | |||||| |||||||| || ||||| ||||| | |||||| 
Sbjct: 3256 ttttgactgtaaagtaccagctggcatccatcgtcggccactgctactacacctgattta 3197

                                                                        
Query: 190  gcatcgacagcaacacaggaaactcgagcacagctgaagcactgtgtgcttgtaagtttt 249
            ||||| |||||||| || || |||||  ||| | | || || ||||| |  | |||||||
Sbjct: 3196 gcatcaacagcaacgcacgagactcgtccactgttaaaacattgtgtaccagcaagtttt 3137

                                                                        
Query: 250  ctcccagaagataattcccacatatacaagaaacctccatgtgttccagcaaatccatgg 309
            ||||||||||| ||||||||    ||||||| |||||||||||||||||| |||||||||
Sbjct: 3136 ctcccagaagacaattcccatgcgtacaagagacctccatgtgttccagcgaatccatgg 3077

                                                                        
Query: 310  ttaccacaggcatctacagaagtagcccttggatcaaaaatatttcccattaaaacttta 369
            ||||||||  ||||||| | ||||||||||||||| |||||| ||||||| | ||   | 
Sbjct: 3076 ttaccacaaacatctactgcagtagcccttggatccaaaatagttcccataataagagtc 3017

                                                                        
Query: 370  ttgttggccagcaaagctagcctccatcgagcattatgctcttttgctcgaaggtcatgt 429
            || || ||||||| ||||||||||||||| |||||||| || ||||||||||| |||  |
Sbjct: 3016 ttatttgccagcagagctagcctccatcgtgcattatgttcctttgctcgaagatcactt 2957

                                                                    
Query: 430  tggtactcagctactgaagcagaagataccataatccaaaccgctatatcttttcc 485
            || ||||| |||||||||||||| || | || ||||||||  ||| ||||||||||
Sbjct: 2956 tgatactccgctactgaagcagacgaaatcagaatccaaattgctgtatcttttcc 2901



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 111/138 (80%)
 Strand = Plus / Minus

                                                                        
Query: 535  actgtgatctcttgtaatcttctctctatgtcatcaactgaagcatgaataacatcctcc 594
            ||||| ||||||  ||| |||||||||||||||  ||| |||||| |||| | |||||||
Sbjct: 2854 actgtaatctctcttaaccttctctctatgtcactaaccgaagcaagaatgatatcctcc 2795

                                                                        
Query: 595  tgtaaactacagaggcctagaggaagaatctggaagacgatgttccctggagctgcaaaa 654
            || ||||||||     |||  ||  |||||||||| || ||| | |||||||||| ||||
Sbjct: 2794 tgcaaactacacgatactactggccgaatctggaaaacaatgattcctggagctgtaaaa 2735

                              
Query: 655  gttgacaaaagtgttcgc 672
            |||| || ||||||||||
Sbjct: 2734 gttgccagaagtgttcgc 2717
to top
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9,
              complete sequence
          Length = 22696651

 Score =  103 bits (52), Expect = 7e-19
 Identities = 85/96 (88%)
 Strand = Plus / Plus

                                                                          
Query: 243    aagttttctcccagaagataattcccacatatacaagaaacctccatgtgttccagcaaa 302
              |||||||||||||||||| ||||||||    ||||||| |||||||||||||||||| ||
Sbjct: 233734 aagttttctcccagaagacaattcccatgcgtacaagagacctccatgtgttccagcgaa 233793

                                                  
Query: 303    tccatggttaccacaggcatctacagaagtagccct 338
              |||||||||||||||  ||||||| | |||||||||
Sbjct: 233794 tccatggttaccacaaacatctactgcagtagccct 233829



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 94/110 (85%)
 Strand = Plus / Plus

                                                                          
Query: 376    gccagcaaagctagcctccatcgagcattatgctcttttgctcgaaggtcatgttggtac 435
              ||||||| ||||||||||||||| |||||||| || ||||||||||| |||  ||| |||
Sbjct: 235415 gccagcagagctagcctccatcgtgcattatgttcctttgctcgaagatcactttgatac 235474

                                                                
Query: 436    tcagctactgaagcagaagataccataatccaaaccgctatatcttttcc 485
              || |||||||||||||| || | || ||||||||  ||| ||||||||||
Sbjct: 235475 tccgctactgaagcagacgaaatcagaatccaaattgctgtatcttttcc 235524



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 111/138 (80%)
 Strand = Plus / Plus

                                                                          
Query: 535    actgtgatctcttgtaatcttctctctatgtcatcaactgaagcatgaataacatcctcc 594
              ||||| ||||||  ||| |||||||||||||||  ||| |||||| |||| | |||||||
Sbjct: 235571 actgtaatctctcttaaccttctctctatgtcactaaccgaagcaagaatgatatcctcc 235630

                                                                          
Query: 595    tgtaaactacagaggcctagaggaagaatctggaagacgatgttccctggagctgcaaaa 654
              || ||||||||     |||  ||  |||||||||| || ||| | |||||||||| ||||
Sbjct: 235631 tgcaaactacacgatactactggccgaatctggaaaacaatgattcctggagctgtaaaa 235690

                                
Query: 655    gttgacaaaagtgttcgc 672
              |||| || ||||||||||
Sbjct: 235691 gttgccagaagtgttcgc 235708
to top
>dbj|AP006058.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC
              clone:OSJNBa0066B16
          Length = 190143

 Score =  103 bits (52), Expect = 7e-19
 Identities = 85/96 (88%)
 Strand = Plus / Plus

                                                                          
Query: 243    aagttttctcccagaagataattcccacatatacaagaaacctccatgtgttccagcaaa 302
              |||||||||||||||||| ||||||||    ||||||| |||||||||||||||||| ||
Sbjct: 129232 aagttttctcccagaagacaattcccatgcgtacaagagacctccatgtgttccagcgaa 129291

                                                  
Query: 303    tccatggttaccacaggcatctacagaagtagccct 338
              |||||||||||||||  ||||||| | |||||||||
Sbjct: 129292 tccatggttaccacaaacatctactgcagtagccct 129327



 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 94/110 (85%)
 Strand = Plus / Plus

                                                                          
Query: 376    gccagcaaagctagcctccatcgagcattatgctcttttgctcgaaggtcatgttggtac 435
              ||||||| ||||||||||||||| |||||||| || ||||||||||| |||  ||| |||
Sbjct: 130913 gccagcagagctagcctccatcgtgcattatgttcctttgctcgaagatcactttgatac 130972

                                                                
Query: 436    tcagctactgaagcagaagataccataatccaaaccgctatatcttttcc 485
              || |||||||||||||| || | || ||||||||  ||| ||||||||||
Sbjct: 130973 tccgctactgaagcagacgaaatcagaatccaaattgctgtatcttttcc 131022



 Score = 60.0 bits (30), Expect = 1e-05
 Identities = 111/138 (80%)
 Strand = Plus / Plus

                                                                          
Query: 535    actgtgatctcttgtaatcttctctctatgtcatcaactgaagcatgaataacatcctcc 594
              ||||| ||||||  ||| |||||||||||||||  ||| |||||| |||| | |||||||
Sbjct: 131069 actgtaatctctcttaaccttctctctatgtcactaaccgaagcaagaatgatatcctcc 131128

                                                                          
Query: 595    tgtaaactacagaggcctagaggaagaatctggaagacgatgttccctggagctgcaaaa 654
              || ||||||||     |||  ||  |||||||||| || ||| | |||||||||| ||||
Sbjct: 131129 tgcaaactacacgatactactggccgaatctggaaaacaatgattcctggagctgtaaaa 131188

                                
Query: 655    gttgacaaaagtgttcgc 672
              |||| || ||||||||||
Sbjct: 131189 gttgccagaagtgttcgc 131206
to top
>emb|CT009732.8| Mouse DNA sequence from clone RP23-72O20 on chromosome 9, complete
              sequence
          Length = 239257

 Score = 46.1 bits (23), Expect = 0.15
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 341    gatcaaaaatatttcccattaaa 363
              |||||||||||||||||||||||
Sbjct: 146594 gatcaaaaatatttcccattaaa 146616
to top
>gb|AC009206.21| Drosophila melanogaster clone BACR15A11, complete sequence
          Length = 195221

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 345    aaaaatatttcccattaaaacttta 369
              |||||||| ||||||||||||||||
Sbjct: 111824 aaaaatatatcccattaaaacttta 111848
to top
>gb|AC140286.3| Mus musculus BAC clone RP24-573E14 from chromosome 5, complete sequence
          Length = 164620

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 50     tgcagaggacagctgtaaatt 70
              |||||||||||||||||||||
Sbjct: 163608 tgcagaggacagctgtaaatt 163588
to top
>gb|AC164411.4| Mus musculus chromosome 1, clone RP23-60E6, complete sequence
          Length = 228155

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 346    aaaatatttcccattaaaactttat 370
              ||||||||||||||||||| |||||
Sbjct: 223322 aaaatatttcccattaaaattttat 223346
to top
>gb|AC087116.13| Mus Musculus Strain C57BL6/J Chromosome 15~RP23-336B1, complete sequence
          Length = 218476

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 525    catgtcactcactgtgatctc 545
              |||||||||||||||||||||
Sbjct: 126776 catgtcactcactgtgatctc 126756
to top
>gb|AC153118.4| Monodelphis domestica clone VMRC6-501L16, complete sequence
          Length = 61064

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 345  aaaaatatttcccattaaaacttta 369
            |||||||||||| ||||||||||||
Sbjct: 7824 aaaaatatttcctattaaaacttta 7800
to top
>gb|AC119268.12| Mus musculus chromosome 5, clone RP24-324M10, complete sequence
          Length = 201518

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 50     tgcagaggacagctgtaaatt 70
              |||||||||||||||||||||
Sbjct: 100052 tgcagaggacagctgtaaatt 100032
to top
>gb|AE003788.5| Drosophila melanogaster chromosome 2R, section 1 of 73 of the complete
              sequence
          Length = 585533

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 345    aaaaatatttcccattaaaacttta 369
              |||||||| ||||||||||||||||
Sbjct: 174083 aaaaatatatcccattaaaacttta 174059
to top
>gb|AC102666.13| Mus musculus chromosome 1, clone RP23-444A8, complete sequence
          Length = 169085

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 346   aaaatatttcccattaaaactttat 370
             ||||||||||||||||||| |||||
Sbjct: 70333 aaaatatttcccattaaaattttat 70309
to top
>emb|AL672009.19| Zebrafish DNA sequence from clone BUSM1-137H13 in linkage group 1,
             complete sequence
          Length = 67888

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 230   actgtgtgcttgtaagttttctccc 254
             ||||| |||||||||||||||||||
Sbjct: 23588 actgtatgcttgtaagttttctccc 23612
to top
>gb|DP000021.1| Monodelphis domestica target 1 genomic scaffold
          Length = 1833844

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 345    aaaaatatttcccattaaaacttta 369
              |||||||||||| ||||||||||||
Sbjct: 216126 aaaaatatttcctattaaaacttta 216102
to top
>ref|NM_001030006.1| Homo sapiens adaptor-related protein complex 2, beta 1 subunit
            (AP2B1), transcript variant 1, mRNA
          Length = 5772

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3334 tacaccctcttttgagtgta 3353
to top
>ref|NM_001282.2| Homo sapiens adaptor-related protein complex 2, beta 1 subunit
            (AP2B1), transcript variant 2, mRNA
          Length = 5730

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3292 tacaccctcttttgagtgta 3311
to top
>gb|AC137610.2| Oryza sativa (japonica cultivar-group) chromosome 5 BAC clone
              OSJNBa0018H09, complete sequence
          Length = 155329

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 285    tccatgtgttccagcaaatc 304
              ||||||||||||||||||||
Sbjct: 153099 tccatgtgttccagcaaatc 153118
to top
>gb|AC119615.7| Rattus norvegicus 10 NOVECTOR CH230-502G21 (Children's Hospital Oakland
              Research Institute) complete sequence
          Length = 156223

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 121    tacaccctcttttgagtgta 140
              ||||||||||||||||||||
Sbjct: 106707 tacaccctcttttgagtgta 106688
to top
>gb|AC117218.3| Mus musculus BAC clone RP23-344B4 from 15, complete sequence
          Length = 179858

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 29     atagataactgttagctgaa 48
              ||||||||||||||||||||
Sbjct: 129749 atagataactgttagctgaa 129768
to top
>ref|NM_080583.1| Rattus norvegicus adaptor-related protein complex 2, beta 1 subunit
            (Ap2b1), mRNA
          Length = 5413

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3262 tacaccctcttttgagtgta 3281
to top
>gb|BC103481.1| Rattus norvegicus adaptor-related protein complex 2, beta 1 subunit,
            mRNA (cDNA clone MGC:124574 IMAGE:7929959), complete cds
          Length = 5394

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3231 tacaccctcttttgagtgta 3250
to top
>gb|AC130731.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0692E03,
             complete sequence
          Length = 74462

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 285   tccatgtgttccagcaaatc 304
             ||||||||||||||||||||
Sbjct: 24092 tccatgtgttccagcaaatc 24111
to top
>ref|XM_501016.1| Yarrowia lipolytica CLIB122, YALI0B17424g predicted mRNA
          Length = 708

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 641 ctggagctgcaaaagttgacaaaa 664
           ||||||||| ||||||||||||||
Sbjct: 313 ctggagctgaaaaagttgacaaaa 336
to top
>emb|AL390788.15| Human DNA sequence from clone RP11-384P5 on chromosome 9, complete
              sequence
          Length = 136968

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 266    cccacatatacaagaaacct 285
              ||||||||||||||||||||
Sbjct: 115926 cccacatatacaagaaacct 115945
to top
>gb|AY341427.1| Homo sapiens beta adaptin subunit mRNA, complete cds; alternatively
            spliced
          Length = 3457

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3327 tacaccctcttttgagtgta 3346
to top
>emb|AL137066.15| Human DNA sequence from clone RP11-10I9 on chromosome 9 Contains the 5'
             end of the gene for a novel protein similar to spermatid
             WD-repeat protein (FLJ90410, FLJ35921), the gene for a
             novel protein similar to B-box and SPRY-domain containing
             protein (BSPRY) (FLJ20150), a novel gene (FLJ39748), a
             novel gene, the ALAD gene for aminolevulinate delta-
             dehydratase (ALADH), the POLE3 gene for the polymerase
             (DNA directed) epsilon 3 (p17 subunit) (p17, YBL1, Ybl1,
             CHRAC17, CHARAC17), the 5' end of the RGS3 gene for the
             regulator of G-protein signalling 3 (C2PA, RGP3, FLJ20370,
             PDZ-RGS3) and six CpG islands, complete sequence
          Length = 137718

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 526   atgtcactcactgtgatctc 545
             ||||||||||||||||||||
Sbjct: 71441 atgtcactcactgtgatctc 71422
to top
>emb|AL078595.12|HSDJ399J4 Human DNA sequence from clone RP3-399J4 on chromosome 6q15-16.3 Contains
              a cytochrome B pseudogene and a ribosomal protein (RPL7A)
              pseudogene, complete sequence
          Length = 124280

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 243    aagttttctcccagaagata 262
              ||||||||||||||||||||
Sbjct: 112534 aagttttctcccagaagata 112515
to top
>emb|AL009048.1|HS433G13 Human DNA sequence from clone RP3-433G13 on chromosome Xq26.3-28
             Contains a SMT3 suppressor of mif two 3 homolog 1 (yeast)
             (SMT3H1) pseudogene, complete sequence
          Length = 58790

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 336   ccttggatcaaaaatatttc 355
             ||||||||||||||||||||
Sbjct: 40490 ccttggatcaaaaatatttc 40471
to top
>emb|CR388002.6| Zebrafish DNA sequence from clone DKEY-75M8 in linkage group 1, complete
              sequence
          Length = 228120

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 443    ctgaagcagaagataccataatcc 466
              ||||||||| ||||||||||||||
Sbjct: 140158 ctgaagcagcagataccataatcc 140135
to top
>emb|AL607024.17| Mouse DNA sequence from clone RP23-194P5 on chromosome 11 Contains a
             novel gene, the Pafah1b1 gene for platelet-activating
             factor acetylhydrolase isoform 1b beta1 subunit, the 5'
             end of a novel gene and two CpG islands, complete sequence
          Length = 137908

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 592   tcctgtaaactacagaggcc 611
             ||||||||||||||||||||
Sbjct: 79908 tcctgtaaactacagaggcc 79889
to top
>emb|AL603711.6| Mouse DNA sequence from clone RP23-381B19 on chromosome 11 Contains
            the 3' end of the Slfn3 gene for schlafen 3, a novel
            gene, two schlafen (Slfn) pseudogenes, the Pex12 gene for
            peroxisomal biogenesis factor 12 and the Ap2b1 gene for
            adaptor-related protein complex 2 beta 1 subunit,
            complete sequence
          Length = 204523

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3304 tacaccctcttttgagtgta 3285
to top
>gb|AC007110.3| Homo sapiens chromosome 6, clone hRPK.472_J_18, complete sequence
          Length = 148336

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 243   aagttttctcccagaagata 262
             ||||||||||||||||||||
Sbjct: 95630 aagttttctcccagaagata 95649
to top
>emb|CR860139.1| Pongo pygmaeus mRNA; cDNA DKFZp469O1619 (from clone DKFZp469O1619)
          Length = 3352

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3286 tacaccctcttttgagtgta 3305
to top
>gb|AC096509.9| Homo sapiens X BAC RP11-454K24 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 106440

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 612    tagaggaagaatctggaaga 631
              ||||||||||||||||||||
Sbjct: 101540 tagaggaagaatctggaaga 101559
to top
>gb|AC124036.5| Mus Musculus Strain C57BL6/J chromosome 11 BAC Clone RP24-100D7, Complete
              Sequence, complete sequence
          Length = 228907

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 121    tacaccctcttttgagtgta 140
              ||||||||||||||||||||
Sbjct: 149038 tacaccctcttttgagtgta 149057
to top
>gb|AC117420.4| Homo sapiens 3 BAC RP11-145A16 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 36731

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 345  aaaaatatttcccattaaaa 364
            ||||||||||||||||||||
Sbjct: 3467 aaaaatatttcccattaaaa 3486
to top
>ref|NM_027915.3| Mus musculus adaptor-related protein complex 2, beta 1 subunit
            (Ap2b1), transcript variant 2, mRNA
          Length = 5369

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3246 tacaccctcttttgagtgta 3265
to top
>ref|NM_001035854.2| Mus musculus adaptor-related protein complex 2, beta 1 subunit
            (Ap2b1), transcript variant 1, mRNA
          Length = 5411

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3288 tacaccctcttttgagtgta 3307
to top
>emb|BX511162.8| Zebrafish DNA sequence from clone DKEY-240B22 in linkage group 1,
             complete sequence
          Length = 119612

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 443   ctgaagcagaagataccataatcc 466
             ||||||||| ||||||||||||||
Sbjct: 32161 ctgaagcagcagataccataatcc 32184
to top
>emb|CR749392.1| Homo sapiens mRNA; cDNA DKFZp781K0743 (from clone DKFZp781K0743)
          Length = 3487

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3317 tacaccctcttttgagtgta 3336
to top
>emb|CR599737.1| full-length cDNA clone CS0DF027YO06 of Fetal brain of Homo sapiens
            (human)
          Length = 1689

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 1611 tacaccctcttttgagtgta 1630
to top
>gb|AC015849.5| Homo sapiens chromosome 17, clone RP11-362K1, complete sequence
          Length = 205040

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 121    tacaccctcttttgagtgta 140
              ||||||||||||||||||||
Sbjct: 195248 tacaccctcttttgagtgta 195229
to top
>gb|AC122543.1| Genomic sequence for Brassica oleracea, clone B21H13, complete
            sequence
          Length = 101563

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 508  ccatcatctttttccgacat 527
            ||||||||||||||||||||
Sbjct: 9890 ccatcatctttttccgacat 9909
to top
>gb|AC060226.39| Homo sapiens 12 BAC RP11-101P14 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 132604

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 477   atcttttcctgatgacatca 496
             ||||||||||||||||||||
Sbjct: 51932 atcttttcctgatgacatca 51951
to top
>dbj|AK138434.1| Mus musculus adult male hypothalamus cDNA, RIKEN full-length enriched
            library, clone:A230106K07 product:adaptor-related protein
            complex 2, beta 1 subunit, full insert sequence
          Length = 5406

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3289 tacaccctcttttgagtgta 3308
to top
>gb|AC007538.5| Homo sapiens Xq28 PAC RPCI6-224C24 (Roswell Park Cancer Institute Human
              PAC Library) complete sequence
          Length = 178544

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 336    ccttggatcaaaaatatttc 355
              ||||||||||||||||||||
Sbjct: 170463 ccttggatcaaaaatatttc 170482
to top
>gb|DP000006.1| Oryctolagus cuniculus target 1 genomic scaffold
          Length = 1889755

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 29     atagataactgttagctgaa 48
              ||||||||||||||||||||
Sbjct: 588415 atagataactgttagctgaa 588396
to top
>dbj|AB169049.1| Macaca fascicularis testis cDNA, clone: QtsA-16864, similar to human
            adaptor-related protein complex 2, beta 1 subunit(AP2B1),
            mRNA, RefSeq: NM_001282.1
          Length = 1322

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 1208 tacaccctcttttgagtgta 1227
to top
>gb|BC013699.1| Mus musculus adaptor-related protein complex 2, beta 1 subunit, mRNA
            (cDNA clone IMAGE:3710787), partial cds
          Length = 2800

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 2674 tacaccctcttttgagtgta 2693
to top
>gb|BC012150.1|BC012150 Homo sapiens, clone IMAGE:4558274, mRNA, partial cds
          Length = 2373

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 1962 tacaccctcttttgagtgta 1981
to top
>dbj|AK004975.1| Mus musculus adult male liver cDNA, RIKEN full-length enriched
            library, clone:1300012O03 product:adaptor-related protein
            complex 2, beta 1 subunit, full insert sequence
          Length = 3270

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3170 tacaccctcttttgagtgta 3189
to top
>gb|BC030349.1| Mus musculus adaptor-related protein complex 2, beta 1 subunit,
           mRNA (cDNA clone IMAGE:5101070), with apparent retained
           intron
          Length = 2758

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 121 tacaccctcttttgagtgta 140
           ||||||||||||||||||||
Sbjct: 615 tacaccctcttttgagtgta 634
to top
>ref|XM_623652.1| PREDICTED: Apis mellifera similar to plasma membrane calcium ATPase
            PMCA3 (LOC551261), partial mRNA
          Length = 3549

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 195  gacagcaacacaggaaactc 214
            ||||||||||||||||||||
Sbjct: 3112 gacagcaacacaggaaactc 3131
to top
>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 285      tccatgtgttccagcaaatc 304
                ||||||||||||||||||||
Sbjct: 11250845 tccatgtgttccagcaaatc 11250864
to top
>gb|AC116482.11| Mus musculus chromosome 8, clone RP23-423D8, complete sequence
          Length = 202027

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 352   tttcccattaaaactttatt 371
             ||||||||||||||||||||
Sbjct: 68149 tttcccattaaaactttatt 68130
to top
>gb|AC124040.3| Oryctolagus cuniculus clone LB1-18E1, complete sequence
          Length = 206755

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 29    atagataactgttagctgaa 48
             ||||||||||||||||||||
Sbjct: 51599 atagataactgttagctgaa 51580
to top
>gb|AC079902.15| Homo sapiens X BAC RP11-352L18 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 91428

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 236   tgcttgtaagttttctccca 255
             ||||||||||||||||||||
Sbjct: 74396 tgcttgtaagttttctccca 74377
to top
>gb|AC006464.3| Homo sapiens BAC clone RP11-436C12 from 2, complete sequence
          Length = 99908

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 258   agataattcccacatataca 277
             ||||||||||||||||||||
Sbjct: 43031 agataattcccacatataca 43012
to top
>gb|CP000084.1| Candidatus Pelagibacter ubique HTCC1062, complete genome
          Length = 1308759

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 339    tggatcaaaaatatttccca 358
              ||||||||||||||||||||
Sbjct: 469437 tggatcaaaaatatttccca 469456
to top
>emb|AJ535360.1|AMI535360 Alexandrium minutum 28S rRNA gene, strain AL9T
          Length = 660

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 404 tatgctcttttgctcgaagg 423
           ||||||||||||||||||||
Sbjct: 589 tatgctcttttgctcgaagg 608
to top
>gb|AC006237.1|AC006237 Homo sapiens chromosome 17, clone hRPC.161_P_9, complete sequence
          Length = 82166

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   tacaccctcttttgagtgta 140
             ||||||||||||||||||||
Sbjct: 64011 tacaccctcttttgagtgta 63992
to top
>dbj|AP000797.6| Homo sapiens genomic DNA, chromosome 11 clone:CMB9-36B5, complete
              sequence
          Length = 148490

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 478    tcttttcctgatgacatcag 497
              ||||||||||||||||||||
Sbjct: 135457 tcttttcctgatgacatcag 135438
to top
>dbj|AB017651.2| Homo sapiens genomic DNA, chromosome 11q23.2, clone:KB615C6, complete
             sequence
          Length = 131668

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 478   tcttttcctgatgacatcag 497
             ||||||||||||||||||||
Sbjct: 33406 tcttttcctgatgacatcag 33387
to top
>gb|AC153592.3| Mus musculus 6 BAC RP23-20C15 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 195726

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 578    catgaataacatcctcctgt 597
              ||||||||||||||||||||
Sbjct: 113000 catgaataacatcctcctgt 112981
to top
>gb|CP000155.1| Hahella chejuensis KCTC 2396, complete genome
          Length = 7215267

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 348     aatatttcccattaaaactt 367
               ||||||||||||||||||||
Sbjct: 6972963 aatatttcccattaaaactt 6972982
to top
>gb|AC125525.3| Mus musculus BAC clone RP24-395H10 from 1, complete sequence
          Length = 195904

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   tacaccctcttttgagtgta 140
             ||||||||||||||||||||
Sbjct: 68791 tacaccctcttttgagtgta 68772
to top
>emb|CT573021.3| Pig DNA sequence from clone XX-BE155F1 on chromosome 14, complete
             sequence
          Length = 118416

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 257   aagataattcccacatatac 276
             ||||||||||||||||||||
Sbjct: 80372 aagataattcccacatatac 80391
to top
>gb|BC006201.2| Homo sapiens adaptor-related protein complex 2, beta 1 subunit, mRNA
            (cDNA clone MGC:3632 IMAGE:3532472), complete cds
          Length = 3427

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3241 tacaccctcttttgagtgta 3260
to top
>emb|CR382128.1| Yarrowia lipolytica chromosome B of strain CLIB122 of Yarrowia lipolytica
          Length = 3066374

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 641     ctggagctgcaaaagttgacaaaa 664
               ||||||||| ||||||||||||||
Sbjct: 2285953 ctggagctgaaaaagttgacaaaa 2285930
to top
>gb|AC144818.4| Mus musculus BAC clone RP23-97O1 from chromosome 5, complete sequence
          Length = 213322

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 435   ctcagctactgaagcagaag 454
             ||||||||||||||||||||
Sbjct: 52609 ctcagctactgaagcagaag 52628
to top
>emb|AL807402.1|CNS08CA6 Mus musculus chromosome 11 region in the Om locus area (D11Mit37-Scya6)
             clone 437H9 of library RPCI-23 from chromosome 11 of
             strain C57Bl/6 of Mus musculus (mouse)
          Length = 205701

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 121   tacaccctcttttgagtgta 140
             ||||||||||||||||||||
Sbjct: 44751 tacaccctcttttgagtgta 44770
to top
>emb|AL669895.9| Mouse DNA sequence from clone RP23-31N7 on chromosome X, complete
              sequence
          Length = 197638

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 542    tctcttgtaatcttctctct 561
              ||||||||||||||||||||
Sbjct: 137976 tctcttgtaatcttctctct 137995
to top
>gb|M77246.1|RATBCCAPB R.norvegicus beta-chain clathrin associated protein complex AP-2
            mRNA, complete cds
          Length = 5413

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3262 tacaccctcttttgagtgta 3281
to top
>gb|M34176.1|RATBADPTA Rat beta adaptin mRNA, complete cds
          Length = 3477

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3152 tacaccctcttttgagtgta 3171
to top
>emb|X64467.1|HSALADG H.sapiens ALAD gene for porphobilinogen synthase
          Length = 15913

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 526  atgtcactcactgtgatctc 545
            ||||||||||||||||||||
Sbjct: 5298 atgtcactcactgtgatctc 5317
to top
>gb|M34175.1|HUMBADPTA Human beta adaptin mRNA, complete cds
          Length = 5701

 Score = 40.1 bits (20), Expect = 9.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 121  tacaccctcttttgagtgta 140
            ||||||||||||||||||||
Sbjct: 3280 tacaccctcttttgagtgta 3299


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,339,736
Number of Sequences: 3902068
Number of extensions: 6339736
Number of successful extensions: 123708
Number of sequences better than 10.0: 76
Number of HSP's better than 10.0 without gapping: 76
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 123443
Number of HSP's gapped (non-prelim): 262
length of query: 672
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 649
effective length of database: 17,143,297,704
effective search space: 11126000209896
effective search space used: 11126000209896
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top