ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd26h06
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|BT017901.1| Zea mays clone EL01N0516D04.c mRNA sequence 54 2e-04
2gb|AY104239.1| Zea mays PCO127742 mRNA sequence 54 2e-04
3emb|BX537348.8| Zebrafish DNA sequence from clone CH211-218O21 i... 40 2.5
4emb|AL732556.7| Mouse DNA sequence from clone RP24-144L11 on chr... 40 2.5
5gb|AC106728.6| Homo sapiens 3 BAC RP11-319J24 (Roswell Park Canc... 40 2.5
6gb|AC150651.3| Bos taurus BAC CH240-451E16 (Children's Hospital... 38 9.9
7gb|AC124412.3| Mus musculus BAC clone RP24-274J3 from chromosome... 38 9.9
8gb|AC127353.3| Mus musculus BAC clone RP23-81P21 from chromosome... 38 9.9
9gb|AC006458.2| Homo sapiens BAC clone GS1-228E12 from 7, complet... 38 9.9
10gb|AC113106.9| Mus musculus chromosome 9, clone RP23-325C1, comp... 38 9.9
11emb|AL365215.23| Human DNA sequence from clone RP11-416D8 on chr... 38 9.9
12emb|BX842648.2| Bdellovibrio bacteriovorus complete genome, stra... 38 9.9
13emb|AL645747.11| Mouse DNA sequence from clone RP23-436D9 on chr... 38 9.9
14emb|BX647299.1|HSM807443 Homo sapiens mRNA; cDNA DKFZp781L0441 (... 38 9.9
15dbj|AK123415.1| Homo sapiens cDNA FLJ41421 fis, clone BRHIP2002664 38 9.9
16gb|AC141556.5| Homo sapiens 12 BAC RP11-386N23 (Roswell Park Can... 38 9.9
17gb|AE004595.1| Pseudomonas aeruginosa PAO1, section 156 of 529 o... 38 9.9
18gb|AC107027.9| Homo sapiens 3 BAC RP11-517B11 (Roswell Park Canc... 38 9.9
19emb|AL929215.18| Mouse DNA sequence from clone RP23-8L8 on chrom... 38 9.9

>gb|BT017901.1| Zea mays clone EL01N0516D04.c mRNA sequence
          Length = 1108

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                            
Query: 156 ctaccgttgnagtcagtngctacaaaacagggc 188
           ||||||||| ||||||| |||||||||||||||
Sbjct: 862 ctaccgttgtagtcagtcgctacaaaacagggc 830



to top

>gb|AY104239.1| Zea mays PCO127742 mRNA sequence
          Length = 1484

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 31/33 (93%)
 Strand = Plus / Minus

                                             
Query: 156  ctaccgttgnagtcagtngctacaaaacagggc 188
            ||||||||| ||||||| |||||||||||||||
Sbjct: 1180 ctaccgttgtagtcagtcgctacaaaacagggc 1148



to top

>emb|BX537348.8| Zebrafish DNA sequence from clone CH211-218O21 in linkage group 8,
              complete sequence
          Length = 207282

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 1      aaactgaattacaacacaaa 20
              ||||||||||||||||||||
Sbjct: 159259 aaactgaattacaacacaaa 159278



to top

>emb|AL732556.7| Mouse DNA sequence from clone RP24-144L11 on chromosome 4 Contains the
             Tnc gene for tenascin C, the 5' end of a novel gene and a
             novel gene, complete sequence
          Length = 148021

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 178   caaaacagggcaccgttgac 197
             ||||||||||||||||||||
Sbjct: 46067 caaaacagggcaccgttgac 46086



to top

>gb|AC106728.6| Homo sapiens 3 BAC RP11-319J24 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 193623

 Score = 40.1 bits (20), Expect = 2.5
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 15    cacaaaggtccacatacacg 34
             ||||||||||||||||||||
Sbjct: 51217 cacaaaggtccacatacacg 51198



to top

>gb|AC150651.3| Bos taurus  BAC CH240-451E16 (Children's Hospital Oakland Research
             Institute Bovine BAC Library (male)) complete sequence
          Length = 174648

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 52    tcagttcttcagttttcag 70
             |||||||||||||||||||
Sbjct: 54153 tcagttcttcagttttcag 54171



to top

>gb|AC124412.3| Mus musculus BAC clone RP24-274J3 from chromosome 9, complete sequence
          Length = 175945

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 28    atacacggtattcatactttaca 50
             |||| ||||||||||||||||||
Sbjct: 86013 atactcggtattcatactttaca 86035



to top

>gb|AC127353.3| Mus musculus BAC clone RP23-81P21 from chromosome 18, complete sequence
          Length = 225658

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 2      aactgaattacaacacaaa 20
              |||||||||||||||||||
Sbjct: 167283 aactgaattacaacacaaa 167265



to top

>gb|AC006458.2| Homo sapiens BAC clone GS1-228E12 from 7, complete sequence
          Length = 121336

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 2     aactgaattacaacacaaa 20
             |||||||||||||||||||
Sbjct: 60749 aactgaattacaacacaaa 60767



to top

>gb|AC113106.9| Mus musculus chromosome 9, clone RP23-325C1, complete sequence
          Length = 191609

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 28     atacacggtattcatactttaca 50
              |||| ||||||||||||||||||
Sbjct: 160422 atactcggtattcatactttaca 160444



to top

>emb|AL365215.23| Human DNA sequence from clone RP11-416D8 on chromosome 10 Contains the
             5' end of the RSU1 gene for Ras suppressor protein 1, the
             3' end of the CUBN gene for cubilin (intrinsic
             factor-cobalamin receptor) and a CpG island, complete
             sequence
          Length = 184703

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 48    acattcagttcttcagttt 66
             |||||||||||||||||||
Sbjct: 37227 acattcagttcttcagttt 37209



to top

>emb|BX842648.2| Bdellovibrio bacteriovorus complete genome, strain HD100; segment 3/11
          Length = 346416

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                     
Query: 53     cagttcttcagttttcagtgcgg 75
              |||||||||||||| ||||||||
Sbjct: 310412 cagttcttcagtttgcagtgcgg 310434



to top

>emb|AL645747.11| Mouse DNA sequence from clone RP23-436D9 on chromosome 11 Contains a
             novel gene and a signal transducing adaptor molecule (SH3
             domain and ITAM motif) 1 (Stam) pseudogene, complete
             sequence
          Length = 172052

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 50    attcagttcttcagttttc 68
             |||||||||||||||||||
Sbjct: 93842 attcagttcttcagttttc 93860



to top

>emb|BX647299.1|HSM807443 Homo sapiens mRNA; cDNA DKFZp781L0441 (from clone DKFZp781L0441)
          Length = 1950

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 53   cagttcttcagttttcagt 71
            |||||||||||||||||||
Sbjct: 1208 cagttcttcagttttcagt 1226



to top

>dbj|AK123415.1| Homo sapiens cDNA FLJ41421 fis, clone BRHIP2002664
          Length = 2184

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 53  cagttcttcagttttcagt 71
           |||||||||||||||||||
Sbjct: 144 cagttcttcagttttcagt 162



to top

>gb|AC141556.5| Homo sapiens 12 BAC RP11-386N23 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 85712

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 45    tttacattcagttcttcag 63
             |||||||||||||||||||
Sbjct: 65950 tttacattcagttcttcag 65932



to top

>gb|AE004595.1| Pseudomonas aeruginosa PAO1, section 156 of 529 of the complete
            genome
          Length = 10448

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 181  aacagggcaccgttgacga 199
            |||||||||||||||||||
Sbjct: 1065 aacagggcaccgttgacga 1083



to top

>gb|AC107027.9| Homo sapiens 3 BAC RP11-517B11 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 171562

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                 
Query: 53     cagttcttcagttttcagt 71
              |||||||||||||||||||
Sbjct: 125947 cagttcttcagttttcagt 125965



to top

>emb|AL929215.18| Mouse DNA sequence from clone RP23-8L8 on chromosome 2, complete
             sequence
          Length = 159804

 Score = 38.2 bits (19), Expect = 9.9
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 51    ttcagttcttcagttttca 69
             |||||||||||||||||||
Sbjct: 58866 ttcagttcttcagttttca 58848


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,206,504
Number of Sequences: 3902068
Number of extensions: 1206504
Number of successful extensions: 89443
Number of sequences better than 10.0: 19
Number of HSP's better than 10.0 without gapping: 19
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 89412
Number of HSP's gapped (non-prelim): 31
length of query: 199
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 177
effective length of database: 17,147,199,772
effective search space: 3035054359644
effective search space used: 3035054359644
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)
to top