ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd26g22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA 555 e-155
2emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA 422 e-115
3emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid tr... 414 e-113
4gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein ... 147 2e-32
5gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) g... 139 6e-30
6gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein ... 135 1e-28
7emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non sp... 90 5e-15
8gb|AF007540.1|AF007540 Smittium culisetae 18S ribosomal RNA gene... 76 8e-11
9gb|AY818951.1| Plantago rugelii 18S ribosomal RNA (rrn18) gene, ... 70 5e-09
10gb|AY850007.1| Cerrena unicolor 18S ribosomal RNA gene, partial ... 70 5e-09
11gb|AY856456.1| Uncultured Glomus isolate 3 18S ribosomal RNA gen... 70 5e-09
12gb|AY856455.1| Uncultured Glomus isolate 2 18S ribosomal RNA gen... 70 5e-09
13gb|AY654887.1| Fibulorhizoctonia sp. LA082103L 18S ribosomal RNA... 70 5e-09
14gb|AY692319.1| Amphibiocystidium ranae strain 2-04 18S ribosomal... 70 5e-09
15gb|AY550245.1| Amphibiocystidium ranae 18S ribosomal RNA gene, i... 70 5e-09
16gb|AY572312.1| Aristolochia grandiflora 18S ribosomal RNA gene, ... 70 5e-09
17gb|AY572311.1| Cinnamosma madagascariensis 18S ribosomal RNA gen... 70 5e-09
18gb|AY572310.1| Pseudowintera axillaris 18S ribosomal RNA gene, p... 70 5e-09
19gb|AY572309.1| Gymnotheca involucrata 18S ribosomal RNA gene, pa... 70 5e-09
20gb|AY572308.1| Gymnotheca chinensis 18S ribosomal RNA gene, part... 70 5e-09
21gb|AY572307.1| Drimys winteri 18S ribosomal RNA gene, partial se... 70 5e-09
22gb|AY572306.1| Aristolochia gigantea 18S ribosomal RNA gene, par... 70 5e-09
23gb|AY572305.1| Houttuynia cordata 18S ribosomal RNA gene, partia... 70 5e-09
24gb|AY572304.1| Anemopsis californica 18S ribosomal RNA gene, par... 70 5e-09
25gb|AY572303.1| Saururus chinensis 18S ribosomal RNA gene, partia... 70 5e-09
26gb|AY572301.1| Sarcorhachis sydowii 18S ribosomal RNA gene, part... 70 5e-09
27gb|AY572300.1| Zippelia begoniifolia 18S ribosomal RNA gene, par... 70 5e-09
28gb|AY572299.1| Piper arborescens 18S ribosomal RNA gene, partial... 70 5e-09
29gb|AY572298.1| Piper aduncum 18S ribosomal RNA gene, partial seq... 70 5e-09
30gb|AY572297.1| Piper umbellatum 18S ribosomal RNA gene, partial ... 70 5e-09
31gb|AY572296.1| Piper excelsum 18S ribosomal RNA gene, partial se... 70 5e-09
32gb|AY572295.1| Piper hispidum 18S ribosomal RNA gene, partial se... 70 5e-09
33gb|AY665533.1| Yemma signatus 18S ribosomal RNA gene, partial se... 70 5e-09
34gb|AY665532.1| Phaenacantha bicolor 18S ribosomal RNA gene, part... 70 5e-09
35gb|AY665531.1| Panaorus albomaculatus 18S ribosomal RNA gene, pa... 70 5e-09
36gb|AY665530.1| Oxycarenus brunneus 18S ribosomal RNA gene, parti... 70 5e-09
37gb|AY665529.1| Macropes exilis 18S ribosomal RNA gene, partial s... 70 5e-09
38gb|AY665527.1| Geocoris pallidipennis 18S ribosomal RNA gene, pa... 70 5e-09
39gb|AY665526.1| Cymus tumescens 18S ribosomal RNA gene, partial s... 70 5e-09
40gb|AY206425.1| Caulerpa cupressoides 18S ribosomal RNA gene, par... 70 5e-09
41gb|AY206424.1| Caulerpa cupressoides 18S ribosomal RNA gene, par... 70 5e-09
42gb|AY652582.1| Trichoplax sp. H3 18S ribosomal RNA gene, partial... 70 5e-09
43gb|AY652581.1| Trichoplax sp. H8 18S ribosomal RNA gene, partial... 70 5e-09
44gb|AY652580.1| Trichoplax sp. H4 18S ribosomal RNA gene, partial... 70 5e-09
45gb|AY652579.1| Trichoplax sp. H7 18S ribosomal RNA gene, partial... 70 5e-09
46gb|AY652578.1| Trichoplax sp. H1 18S ribosomal RNA gene, partial... 70 5e-09
47gb|AY652577.1| Trichoplax sp. H2 18S ribosomal RNA gene, partial... 70 5e-09
48gb|AF084235.1| Stephanoeca diplocostata 18S ribosomal RNA gene, ... 70 5e-09
49gb|AF084234.1| Diaphanoeca grandis 18S ribosomal RNA gene, parti... 70 5e-09
50gb|AF084233.1| Acanthoeca spectabilis 18S ribosomal RNA gene, pa... 70 5e-09
51gb|AF084230.1| Monosiga ovata 18S ribosomal RNA gene, partial se... 70 5e-09
52gb|AF528564.1| Peronospora corydalis from Corydalis speciosa Max... 70 5e-09
53gb|AF528563.1| Peronospora corydalis from Corydalis speciosa Max... 70 5e-09
54gb|AF528562.1| Peronospora corydalis from Corydalis ochotensis T... 70 5e-09
55gb|AF528561.1| Peronospora corydalis from Corydalis ochotensis T... 70 5e-09
56gb|AF528560.1| Peronospora farinosa from Spinacia oleracea 18S r... 70 5e-09
57gb|AF528559.1| Peronospora farinosa from Spinacia oleracea 18S r... 70 5e-09
58gb|AF528558.1| Peronospora farinosa from Chenopodium ficifolium ... 70 5e-09
59gb|AF528556.1| Peronospora farinosa from Chenopodium album L. 18... 70 5e-09
60gb|AY261369.1| Beauveria felina strain CBS 250.34 18S ribosomal ... 70 5e-09
61gb|AY261368.1| Beauveria felina strain CBS 173.71 18S ribosomal ... 70 5e-09
62gb|AY261367.1| Beauveria felina strain HL-51-ALSP16-I003 18S rib... 70 5e-09
63gb|AY249900.1| Bionectria pityrodes strain CBS 246.78 18S riboso... 70 5e-09
64gb|AY249899.1| Bionectria pityrodes strain CBS 102033 18S riboso... 70 5e-09
65gb|AY249898.1| Bionectria pityrodes 18S ribosomal RNA gene, comp... 70 5e-09
66gb|AY313034.2| Bullera nakhonratchasimensis 18S ribosomal RNA ge... 70 5e-09
67gb|AY037173.1| Oxya chinensis 18S ribosomal RNA gene, complete s... 70 5e-09
68gb|AY839843.1| Diehliomyces microsporus 18S ribosomal RNA gene, ... 70 5e-09
69gb|AY839830.1| Inonotus baumii 18S ribosomal RNA gene, partial s... 70 5e-09
70gb|AY839829.1| Inonotus linteus 18S ribosomal RNA gene, partial ... 70 5e-09
71gb|AY839828.1| Inonotus linteus strain ASI26082 18S ribosomal RN... 70 5e-09
72gb|AY672801.1| Euphausia superba small subunit ribosomal RNA gen... 70 5e-09
73gb|AY672802.1| Fragilariopsis cylindrus small subunit ribosomal ... 70 5e-09
74gb|AY422222.1| Uncultured phototrophic eukaryote clone Nccln9shd... 70 5e-09
75gb|AY422221.1| Uncultured phototrophic eukaryote clone NCcln5shd... 70 5e-09
76gb|AY422220.1| Uncultured phototrophic eukaryote clone NCcln6shd... 70 5e-09
77gb|AY422219.1| Uncultured phototrophic eukaryote clone NCcln1shd... 70 5e-09
78gb|AY422218.1| Uncultured phototrophic eukaryote clone NCcln2shd... 70 5e-09
79gb|AY422217.1| Uncultured phototrophic eukaryote clone NCcln10sh... 70 5e-09
80gb|AY422216.1| Uncultured phototrophic eukaryote clone NCcln4shd... 70 5e-09
81gb|DQ092918.1| Anamika angustilamellata isolate AFTOL-ID 543 18S... 70 5e-09
82gb|AY465354.1| Bangia sp. WELT A23126 18S ribosomal RNA gene, pa... 70 5e-09
83gb|AY465355.1| Bangia sp. WELT A25775 18S ribosomal RNA gene, pa... 70 5e-09
84gb|AY289649.1| Nypa fruticans 18S ribosomal RNA gene, partial se... 70 5e-09
85gb|AY289648.1| Aegiceras corniculatum 18S ribosomal RNA gene, pa... 70 5e-09
86gb|AY289647.1| Barringtonia racemosa 18S ribosomal RNA gene, par... 70 5e-09
87gb|AY289646.1| Scyphiphora hydrophyllacea 18S ribosomal RNA gene... 70 5e-09
88gb|AY289645.1| Cerbera manghas 18S ribosomal RNA gene, partial s... 70 5e-09
89gb|AY289644.1| Clerodendrum inerme 18S ribosomal RNA gene, parti... 70 5e-09
90gb|AY289643.1| Dolichandrone spathacea 18S ribosomal RNA gene, p... 70 5e-09
91gb|AY289642.1| Acanthus ebracteatus 18S ribosomal RNA gene, part... 70 5e-09
92gb|AY289641.1| Avicennia marina 18S ribosomal RNA gene, partial ... 70 5e-09
93gb|AY289640.1| Aegialitis annulata 18S ribosomal RNA gene, parti... 70 5e-09
94gb|AY289639.1| Pemphis acidula 18S ribosomal RNA gene, partial s... 70 5e-09
95gb|AY289638.1| Sonneratia ovata 18S ribosomal RNA gene, partial ... 70 5e-09
96gb|AY289637.1| Lumnitzera littorea 18S ribosomal RNA gene, parti... 70 5e-09
97gb|AY289636.1| Conocarpus erectus 18S ribosomal RNA gene, partia... 70 5e-09
98gb|AY289635.1| Laguncularia racemosa 18S ribosomal RNA gene, par... 70 5e-09
99gb|AY289634.1| Xylocarpus granatum 18S ribosomal RNA gene, parti... 70 5e-09
100gb|AY289633.1| Heritiera littoralis 18S ribosomal RNA gene, part... 70 5e-09
101gb|AY289632.1| Thespesia populnea 18S ribosomal RNA gene, partia... 70 5e-09
102gb|AY289631.1| Hibiscus tiliaceus 18S ribosomal RNA gene, partia... 70 5e-09
103gb|AY289630.1| Cynometra iripa 18S ribosomal RNA gene, partial s... 70 5e-09
104gb|AY289629.1| Pongamia pinnata 18S ribosomal RNA gene, partial ... 70 5e-09
105gb|AY289628.1| Excoecaria agallocha 18S ribosomal RNA gene, part... 70 5e-09
106gb|AY289627.1| Rhizophora stylosa 18S ribosomal RNA gene, partia... 70 5e-09
107gb|AY289626.1| Bruguiera sexangula 18S ribosomal RNA gene, parti... 70 5e-09
108gb|AY289625.1| Kandelia candel 18S ribosomal RNA gene, partial s... 70 5e-09
109gb|AY289624.1| Ceriops tagal 18S ribosomal RNA gene, partial seq... 70 5e-09
110gb|AY823528.1| Jatropha curcas 18S ribosomal RNA gene, partial s... 70 5e-09
111gb|AY734450.1| Haliclona oculata 18S ribosomal RNA gene, complet... 70 5e-09
112gb|AY734449.1| Dysidea sp. 23-XI-02-2-001 N27 18S ribosomal RNA ... 70 5e-09
113gb|AY734448.1| Ircinia felix 18S ribosomal RNA gene, complete se... 70 5e-09
114gb|AY734447.1| Calyx podatypa 18S ribosomal RNA gene, complete s... 70 5e-09
115gb|AY734444.1| Haliclona sp. sp5 18S ribosomal RNA gene, complet... 70 5e-09
116gb|AY734443.1| Agelas conifera 18S ribosomal RNA gene, complete ... 70 5e-09
117gb|AY734442.1| Pseudaxinella lunaecharta 18S ribosomal RNA gene,... 70 5e-09
118gb|AY734440.1| Spheciospongia vesparium 18S ribosomal RNA gene, ... 70 5e-09
119gb|AY734439.1| Cinachyrella sp. sp11 18S ribosomal RNA gene, com... 70 5e-09
120gb|AY734438.1| Cinachyrella sp. 24-XI-02-3-2 N28 18S ribosomal R... 70 5e-09
121gb|AY734437.1| Cinachyrella sp. 22-XI-02-1-13 N25 18S ribosomal ... 70 5e-09
122gb|AF005243.2| Blattella germanica 18S ribosomal RNA gene, parti... 70 5e-09
123gb|AF280078.1| Phalansterium solitarium 18S ribosomal RNA gene, ... 70 5e-09
124gb|DQ227859.1| Porphyra yezoensis isolate NS007 small subunit ri... 70 5e-09
125gb|DQ227858.1| Porphyra yezoensis isolate NS006 small subunit ri... 70 5e-09
126gb|DQ227857.1| Porphyra yezoensis isolate NS005 small subunit ri... 70 5e-09
127gb|DQ227856.1| Porphyra yezoensis isolate NS004 small subunit ri... 70 5e-09
128gb|DQ227855.1| Porphyra yezoensis isolate NS003 small subunit ri... 70 5e-09
129gb|DQ227854.1| Porphyra yezoensis isolate NS002 small subunit ri... 70 5e-09
130gb|DQ227853.1| Porphyra yezoensis isolate NS001 small subunit ri... 70 5e-09
131gb|DQ234257.1| Chaetomium globosum 18S ribosomal RNA gene, parti... 70 5e-09
132gb|DQ234563.1| Platygloea disciformis isolate AFTOL-ID 710 18S s... 70 5e-09
133gb|DQ234543.1| Bensingtonia yuccicola isolate AFTOL-ID 857 18S s... 70 5e-09
134gb|DQ234542.1| Auricularia sp. PBM2295 18S small subunit ribosom... 70 5e-09
135gb|AY755703.1| Ephedra pachyclada voucher (S) C-7844 18S ribosom... 70 5e-09
136gb|AY755701.1| Ephedra campylopoda voucher (S) C-7605 18S riboso... 70 5e-09
137gb|AY755700.1| Ephedra ciliata voucher (S) C-591 18S ribosomal R... 70 5e-09
138gb|AY755699.1| Ephedra foliata voucher (S) C-7808 18S ribosomal ... 70 5e-09
139gb|AY755698.1| Ephedra alata voucher (S) C-303 18S ribosomal RNA... 70 5e-09
140gb|AY755697.1| Ephedra altissima voucher (S) C-7688 18S ribosoma... 70 5e-09
141gb|AY755696.1| Ephedra altissima voucher (S) C-628 18S ribosomal... 70 5e-09
142gb|AY755695.1| Ephedra aphylla voucher (S) C-7791 18S ribosomal ... 70 5e-09
143gb|AY755694.1| Ephedra equisetina voucher (S) C-465-2 18S riboso... 70 5e-09
144gb|AY755693.1| Ephedra distachya voucher (S) 03-684 18S ribosoma... 70 5e-09
145gb|AY755692.1| Ephedra tweediana voucher (UC) 66-0742 18S riboso... 70 5e-09
146gb|AY755691.1| Ephedra chilensis voucher (UC) 49-0542 18S riboso... 70 5e-09
147gb|AY755689.1| Ephedra rupestris voucher (UC) 87-1368 18S riboso... 70 5e-09
148gb|AY755688.1| Ephedra nevadensis voucher (UC) 66-1033 18S ribos... 70 5e-09
149gb|AY755687.1| Ephedra trifurca voucher (Mo) 04630447 18S riboso... 70 5e-09
150gb|AY755686.1| Ephedra distachya voucher (S) 04-481 18S ribosoma... 70 5e-09
151gb|AY755685.1| Ephedra gerardiana voucher (O) 74-460 18S ribosom... 70 5e-09
152gb|AY755684.1| Ephedra torreyana voucher (S) 04-487 18S ribosoma... 70 5e-09
153gb|AY755683.1| Ephedra intermedia voucher (S) 04-483 18S ribosom... 70 5e-09
154gb|AY755682.1| Ephedra antisyphilitica voucher (S) 04-488 18S ri... 70 5e-09
155gb|AY755681.1| Ephedra minuta voucher (S) 04-486 18S ribosomal R... 70 5e-09
156gb|AY755680.1| Ephedra minuta voucher (S) 04-485 18S ribosomal R... 70 5e-09
157gb|AY755679.1| Ephedra chilensis voucher (E) E00130260 18S ribos... 70 5e-09
158gb|AY755678.1| Ephedra gerardiana voucher (E) E00130259 18S ribo... 70 5e-09
159gb|AY755676.1| Ephedra californica voucher (O) 68-154 18S riboso... 70 5e-09
160gb|AY755675.1| Ephedra sinica voucher (S) CRetoh 18S ribosomal R... 70 5e-09
161gb|AY755674.1| Ephedra frustillata voucher (K) 10218 18S ribosom... 70 5e-09
162gb|AY755672.1| Ephedra monosperma voucher (K) 10142 18S ribosoma... 70 5e-09
163gb|AY755671.1| Ephedra gerardiana voucher (K) 10141 18S ribosoma... 70 5e-09
164gb|AY755670.1| Ephedra andina voucher (K) 10140 18S ribosomal RN... 70 5e-09
165gb|AY755669.1| Ephedra frustillata voucher (S) 04-482 18S riboso... 70 5e-09
166gb|AY755668.1| Ephedra minuta voucher (S) 03-930 18S ribosomal R... 70 5e-09
167gb|AY755667.1| Ephedra intermedia voucher (S) 03-925 18S ribosom... 70 5e-09
168gb|AY755666.1| Ephedra equisetina voucher (S) 03-928 18S ribosom... 70 5e-09
169gb|AY755665.1| Ephedra likiangensis voucher (S) 03-926 18S ribos... 70 5e-09
170gb|AY755664.1| Gnetum montanum voucher (E) E00130261 18S ribosom... 70 5e-09
171gb|AY755663.1| Gnetum indicum voucher (E) E00130257 18S ribosoma... 70 5e-09
172gb|AY755662.1| Gnetum parvifolium voucher (S) CRetoh 18S ribosom... 70 5e-09
173gb|AY755661.1| Gnetum costatum voucher (K) 10219 18S ribosomal R... 70 5e-09
174gb|AY755660.1| Gnetum gnemon voucher (S) 03-926 18S ribosomal RN... 70 5e-09
175gb|AY744286.1| Uncultured Leptosphaeriaceae clone Arch3573.1 18S... 70 5e-09
176gb|AY744285.1| Uncultured mycorrhiza (Archaeosporaceae) clone Ar... 70 5e-09
177gb|AY744279.1| Uncultured glomeraceous AM fungus clone Glom3538.... 70 5e-09
178gb|AY744278.1| Uncultured glomeraceous AM fungus clone Glom3524.... 70 5e-09
179gb|AY744277.1| Uncultured glomeraceous AM fungus clone Glom3523.... 70 5e-09
180gb|AY803753.1| Trechispora sp. PBM418 isolate AFTOL-ID 678 18S r... 70 5e-09
181gb|AY803752.1| Tilletiaria anomala isolate AFTOL-ID 865 18S ribo... 70 5e-09
182gb|AY676694.1| Syneta adamsi 18S ribosomal RNA gene, partial seq... 70 5e-09
183gb|AY676693.1| Polyoptilis sp. Sa02 18S ribosomal RNA gene, part... 70 5e-09
184gb|AY676692.1| Sagra sp. Sa04 18S ribosomal RNA gene, partial se... 70 5e-09
185gb|AY676691.1| Sagra sp. Sa03 18S ribosomal RNA gene, partial se... 70 5e-09
186gb|AY676688.1| Lamprosoma sp. LP01 18S ribosomal RNA gene, parti... 70 5e-09
187gb|AY676686.1| Lema trilineata 18S ribosomal RNA gene, partial s... 70 5e-09
188gb|AY676685.1| Ornithia sp. ORN01 18S ribosomal RNA gene, partia... 70 5e-09
189gb|AY773761.1| Uncultured rhizosphere basidiomycete isolate Root... 70 5e-09
190gb|AY773760.1| Uncultured rhizosphere ascomycete isolate Root.24... 70 5e-09
191gb|AY773759.1| Uncultured rhizosphere ascomycete isolate Root.23... 70 5e-09
192gb|AY773758.1| Uncultured rhizosphere ascomycete isolate Root.23... 70 5e-09
193gb|AY773757.1| Uncultured rhizosphere ascomycete isolate Root.23... 70 5e-09
194gb|AY773754.1| Uncultured rhizosphere ascomycete isolate Root.23... 70 5e-09
195gb|AY773752.1| Uncultured rhizosphere ascomycete isolate Root.22... 70 5e-09
196gb|AY773750.1| Uncultured rhizosphere ascomycete isolate Root.22... 70 5e-09
197gb|AY773749.1| Uncultured rhizosphere basidiomycete isolate Root... 70 5e-09
198gb|AY773748.1| Uncultured rhizosphere basidiomycete isolate Root... 70 5e-09
199gb|AY773746.1| Uncultured rhizosphere ascomycete isolate Root.21... 70 5e-09
200gb|AY773745.1| Uncultured rhizosphere zygomycete isolate Root.21... 70 5e-09
201gb|AY773744.1| Uncultured rhizosphere basidiomycete isolate Root... 70 5e-09
202gb|AY773743.1| Uncultured rhizosphere basidiomycete isolate Root... 70 5e-09
203gb|AY773740.1| Uncultured rhizosphere basidiomycete isolate Root... 70 5e-09
204gb|AY773739.1| Uncultured rhizosphere basidiomycete isolate Root... 70 5e-09
205gb|AY773737.1| Uncultured rhizosphere basidiomycete isolate Root... 70 5e-09
206gb|AY773734.1| Uncultured rhizosphere ascomycete isolate Root.18... 70 5e-09
207gb|AY773733.1| Uncultured rhizosphere ascomycete isolate Root.18... 70 5e-09
208gb|AY773732.1| Uncultured rhizosphere ascomycete isolate Root.18... 70 5e-09
209gb|AY773731.1| Uncultured rhizosphere basidiomycete isolate Root... 70 5e-09
210gb|AY773730.1| Uncultured rhizosphere ascomycete isolate Root.18... 70 5e-09
211gb|AY773729.1| Uncultured rhizosphere ascomycete isolate Root.18... 70 5e-09
212gb|AY773728.1| Uncultured rhizosphere basidiomycete isolate Root... 70 5e-09
213gb|AY773727.1| Uncultured rhizosphere basidiomycete isolate Root... 70 5e-09
214gb|AY773726.1| Uncultured rhizosphere ascomycete isolate Root.17... 70 5e-09
215gb|AY773725.1| Uncultured rhizosphere ascomycete isolate Root.17... 70 5e-09
216gb|AY773723.1| Uncultured rhizosphere zygomycete isolate Root.16... 70 5e-09
217gb|AY773721.1| Uncultured rhizosphere ascomycete isolate Root.14... 70 5e-09
218gb|AY773720.1| Uncultured rhizosphere ascomycete isolate Root.14... 70 5e-09
219gb|AY773718.1| Uncultured rhizosphere zygomycete isolate Root.14... 70 5e-09
220gb|AY773717.1| Uncultured soil basidiomycete isolate Root.14.08 ... 70 5e-09
221gb|AY773716.1| Uncultured rhizosphere ascomycete isolate Root.14... 70 5e-09
222gb|AY773810.1| Uncultured soil ascomycete isolate Soil.24.19 18S... 70 5e-09
223gb|AY773809.1| Uncultured soil ascomycete isolate Soil.24.11 18S... 70 5e-09
224gb|AY773808.1| Uncultured soil ascomycete isolate Soil.23.20 18S... 70 5e-09
225gb|AY773807.1| Uncultured soil zygomycete isolate Soil.22.07 18S... 70 5e-09
226gb|AY773806.1| Uncultured soil ascomycete isolate Soil.20.18 18S... 70 5e-09
227gb|AY773805.1| Uncultured soil ascomycete isolate Soil.20.04 18S... 70 5e-09
228gb|AY773804.1| Uncultured soil ascomycete isolate Soil.20.02 18S... 70 5e-09
229gb|AY773803.1| Uncultured soil ascomycete isolate Soil.19.19 18S... 70 5e-09
230gb|AY773802.1| Uncultured soil ascomycete isolate Soil.19.18 18S... 70 5e-09
231gb|AY773801.1| Uncultured soil basidiomycete isolate Soil.19.15 ... 70 5e-09
232gb|AY773800.1| Uncultured soil ascomycete isolate Soil.19.14 18S... 70 5e-09
233gb|AY773798.1| Uncultured soil ascomycete isolate Soil.18.16 18S... 70 5e-09
234gb|AY773797.1| Uncultured soil ascomycete isolate Soil.18.14 18S... 70 5e-09
235gb|AY773796.1| Uncultured soil ascomycete isolate Soil.18.09 18S... 70 5e-09
236gb|AY773795.1| Uncultured soil ascomycete isolate Soil.18.08 18S... 70 5e-09
237gb|AY773794.1| Uncultured soil ascomycete isolate Soil.18.05 18S... 70 5e-09
238gb|AY773792.1| Uncultured soil basidiomycete isolate Soil.17.19 ... 70 5e-09
239gb|AY773791.1| Uncultured soil ascomycete isolate Soil.17.18 18S... 70 5e-09
240gb|AY773790.1| Uncultured soil ascomycete isolate Soil.17.16 18S... 70 5e-09
241gb|AY773789.1| Uncultured soil ascomycete isolate Soil.17.14 18S... 70 5e-09
242gb|AY773787.1| Uncultured soil ascomycete isolate Soil.17.03 18S... 70 5e-09
243gb|AY773786.1| Uncultured soil basidiomycete isolate Soil.16.19 ... 70 5e-09
244gb|AY773785.1| Uncultured soil ascomycete isolate Soil.16.09 18S... 70 5e-09
245gb|AY773784.1| Uncultured soil ascomycete isolate Soil.16.06 18S... 70 5e-09
246gb|AY773781.1| Uncultured soil ascomycete isolate Soil.15.19 18S... 70 5e-09
247gb|AY773780.1| Uncultured soil basidiomycete isolate Soil.15.14 ... 70 5e-09
248gb|AY773779.1| Uncultured soil ascomycete isolate Soil.15.13 18S... 70 5e-09
249gb|AY773778.1| Uncultured soil basidiomycete isolate Soil.15.06 ... 70 5e-09
250gb|AY773777.1| Uncultured soil basidiomycete isolate Soil.15.02 ... 70 5e-09
251gb|AY773776.1| Uncultured soil ascomycete isolate Soil.14.16 18S... 70 5e-09
252gb|AY773774.1| Uncultured soil basidiomycete isolate Soil.14.11 ... 70 5e-09
253gb|AY773773.1| Uncultured soil ascomycete isolate Soil.14.07 18S... 70 5e-09
254gb|AY773772.1| Uncultured soil basidiomycete isolate Soil.14.06 ... 70 5e-09
255gb|AY773771.1| Uncultured soil zygomycete isolate Soil.14.03 18S... 70 5e-09
256gb|AY773770.1| Uncultured soil basidiomycete isolate Soil.14.02 ... 70 5e-09
257gb|AY773769.1| Uncultured soil ascomycete isolate Soil.13.17 18S... 70 5e-09
258gb|AY773768.1| Uncultured soil ascomycete isolate Soil.13.10 18S... 70 5e-09
259gb|AY773767.1| Uncultured soil basidiomycete isolate Soil.13.06 ... 70 5e-09
260gb|AY773766.1| Uncultured soil basidiomycete isolate Soil.13.03 ... 70 5e-09
261gb|AY773764.1| Uncultured soil ascomycete isolate Soil.11.14 18S... 70 5e-09
262gb|AY773344.1| Melipona quinquefasciata 18S small subunit riboso... 70 5e-09
263gb|AY773343.1| Melipona subnitida 18S small subunit ribosomal RN... 70 5e-09
264gb|AY422078.1| Paradoxia multiseta 18S small subunit ribosomal R... 70 5e-09
265gb|AY422077.1| Picochlorum sp. UTEX 2491 18S small subunit ribos... 70 5e-09
266gb|AY422076.1| Picochlorum sp. UTEX 2378 18S small subunit ribos... 70 5e-09
267gb|AY422075.1| Picochlorum oculatum 18S small subunit ribosomal ... 70 5e-09
268gb|AY422074.1| Gloeotila contorta 18S small subunit ribosomal RN... 70 5e-09
269gb|AY422073.1| Picochlorum oklahomensis 18S small subunit riboso... 70 5e-09
270gb|AY787216.1| Agaricus bisporus isolate AFTOL-ID 448 18S riboso... 70 5e-09
271gb|AY787215.1| Hypholoma sublateritium isolate AFTOL-ID 597 18S ... 70 5e-09
272gb|AY787214.1| Marasmius alliaceus isolate AFTOL-ID 556 18S ribo... 70 5e-09
273gb|AY425322.1| Uncultured prasinophyte clone BL010625.18 small s... 70 5e-09
274gb|AY425321.1| Prasinophyte sp. RCC 391 small subunit ribosomal ... 70 5e-09
275gb|AY425320.1| Micromonas pusilla small subunit ribosomal RNA ge... 70 5e-09
276gb|AY425319.1| Uncultured prasinophyte clone RA000412.97 small s... 70 5e-09
277gb|AY425318.1| Uncultured prasinophyte clone BL000921.10 small s... 70 5e-09
278gb|AY425317.1| Uncultured prasinophyte clone RA000412.37 small s... 70 5e-09
279gb|AY425316.1| Micromonas pusilla small subunit ribosomal RNA ge... 70 5e-09
280gb|AY425315.1| Bathycoccus prasinos small subunit ribosomal RNA ... 70 5e-09
281gb|AY425314.1| Bathycoccus prasinos small subunit ribosomal RNA ... 70 5e-09
282gb|AY425313.1| Ostreococcus sp. RCC 501 small subunit ribosomal ... 70 5e-09
283gb|AY425312.1| Uncultured prasinophyte clone RA000412.150 small ... 70 5e-09
284gb|AY425311.1| Ostreococcus sp. RCC 393 small subunit ribosomal ... 70 5e-09
285gb|AY425310.1| Ostreococcus sp. RCC 143 small subunit ribosomal ... 70 5e-09
286gb|AY425309.1| Uncultured prasinophyte clone RA010412.39 small s... 70 5e-09
287gb|AY425308.1| Ostreococcus sp. RCC 356 clone 1 small subunit ri... 70 5e-09
288gb|AY425307.1| Ostreococcus sp. RCC 344 small subunit ribosomal ... 70 5e-09
289gb|AY425306.1| Nephroselmis pyriformis small subunit ribosomal R... 70 5e-09
290gb|AY425305.1| Pycnococcus provasolii small subunit ribosomal RN... 70 5e-09
291gb|AY425303.1| Uncultured prasinophyte clone RA001219.46 small s... 70 5e-09
292gb|AY425302.1| Prasinophyte sp. RCC 287 small subunit ribosomal ... 70 5e-09
293gb|AY425301.1| Uncultured prasinophyte clone BL010625.2 small su... 70 5e-09
294gb|AY425300.1| Uncultured prasinophyte clone BL010625.1 small su... 70 5e-09
295gb|AY425299.1| Tetraselmis sp. RCC 500 small subunit ribosomal R... 70 5e-09
296gb|AY786053.1| Megacollybia platyphylla isolate AFTOL-ID 560 18S... 70 5e-09
297gb|AY789928.1| Rhodotorula sp. RG2005 18S ribosomal RNA gene, pa... 70 5e-09
298gb|AY732223.1| Sabellaria cementarium 18S ribosomal RNA gene, pa... 70 5e-09
299gb|AY839573.1| Pholoe baltica 18S ribosomal RNA gene, partial se... 70 5e-09
300gb|AY839568.1| Dysponetus caecus 18S ribosomal RNA gene, partial... 70 5e-09
301gb|DQ079770.1| Typhlatya pearsei voucher MLP85_1 18S ribosomal R... 70 5e-09
302gb|DQ079769.1| Stenopus hispidus voucher MLP119 18S ribosomal RN... 70 5e-09
303gb|DQ079768.1| Sergio mericeae voucher KC1865 18S ribosomal RNA ... 70 5e-09
304gb|DQ079767.1| Scyllarus arctus voucher KC2159 18S ribosomal RNA... 70 5e-09
305gb|DQ079765.1| Panulirus regius voucher KC2167 18S ribosomal RNA... 70 5e-09
306gb|DQ079763.1| Pachygrapsus marmoratus voucher KCpama 18S riboso... 70 5e-09
307gb|DQ079762.1| Nephrops norvegicus voucher KC2163 18S ribosomal ... 70 5e-09
308gb|DQ079761.1| Nephropsis aculeata voucher KC2117 18S ribosomal ... 70 5e-09
309gb|DQ079760.1| Nematoscelis sp. KCnesp 18S ribosomal RNA gene, p... 70 5e-09
310gb|DQ079759.1| Necora puber voucher KC2161 18S ribosomal RNA gen... 70 5e-09
311gb|DQ079758.1| Maja squinado voucher KC2168 18S ribosomal RNA ge... 70 5e-09
312gb|DQ079757.1| Necora puber voucher KCmapu 18S ribosomal RNA gen... 70 5e-09
313gb|DQ079751.1| Lepidophthalmus louisianensis voucher KC1852 18S ... 70 5e-09
314gb|DQ079750.1| Geothelphusa sp. MLP125 18S ribosomal RNA gene, p... 70 5e-09
315gb|DQ079749.1| Homarus gammarus voucher KC2162 18S ribosomal RNA... 70 5e-09
316gb|DQ079748.1| Euphausia eximia voucher KCeuex 18S ribosomal RNA... 70 5e-09
317gb|DQ079745.1| Cherax glaber voucher KCchgl 18S ribosomal RNA ge... 70 5e-09
318gb|DQ079744.1| Carcinus maenas voucher KCcama 18S ribosomal RNA ... 70 5e-09
319gb|DQ079743.1| Cancer pagurus voucher KC2158 18S ribosomal RNA g... 70 5e-09
320gb|DQ079742.1| Cambaroides japonicus voucher KC695 18S ribosomal... 70 5e-09
321gb|DQ079741.1| Callichirus major voucher KC1864 18S ribosomal RN... 70 5e-09
322gb|DQ079740.1| Callianassa subterranea voucher KCcasu 18S riboso... 70 5e-09
323gb|DQ079739.1| Biffarius arenosus voucher BaV3 18S ribosomal RNA... 70 5e-09
324gb|DQ079738.1| Atyoida bisulcata voucher KC2138 18S ribosomal RN... 70 5e-09
325gb|DQ079737.1| Astacopsis gouldi voucher KC1883 18S ribosomal RN... 70 5e-09
326gb|DQ079736.1| Acanthacaris caeca voucher KC1877 18S ribosomal R... 70 5e-09
327gb|AY742885.1| Graptostethus sp. HL-2004 18S ribosomal RNA gene,... 70 5e-09
328gb|AY742883.1| Cletus trigonus 18S ribosomal RNA gene, partial s... 70 5e-09
329gb|AY627329.1| Anoplocnemis binotata 18S ribosomal RNA gene, par... 70 5e-09
330gb|AY627323.1| Cletus punctiger 18S ribosomal RNA gene, partial ... 70 5e-09
331gb|AY627320.1| Leptocorisa sp. HL-2004 18S ribosomal RNA gene, p... 70 5e-09
332gb|AY627314.1| Aponsila montana 18S ribosomal RNA gene, partial ... 70 5e-09
333gb|AY627313.1| Megacopta cribraria 18S ribosomal RNA gene, parti... 70 5e-09
334gb|AY627312.1| Tessaratoma papillosa 18S ribosomal RNA gene, par... 70 5e-09
335gb|DQ002501.1| Tetraplatia volitans 18S small subunit ribosomal ... 70 5e-09
336gb|AY543588.1| Shiraia bambusicola isolate TFC Pa2003 18S riboso... 70 5e-09
337gb|AY584679.1| Lobaria scrobiculata isolate AFTOL-ID 128 18S rib... 70 5e-09
338gb|AY584674.1| Megalospora tuberculosa isolate AFTOL-ID 107 18S ... 70 5e-09
339gb|AY584673.1| Gyalideopsis vulgaris isolate AFTOL-ID 105 18S ri... 70 5e-09
340gb|AY584667.1| Acarosporina microspora isolate AFTOL-ID 78 18S r... 70 5e-09
341gb|AY584666.1| Ostropa barbara isolate AFTOL-ID 77 18S ribosomal... 70 5e-09
342gb|AY584662.1| Lithothelium septemseptatum isolate AFTOL-ID 12 1... 70 5e-09
343gb|AY584661.1| Menegazzia terebrata isolate AFTOL-ID 10 18S ribo... 70 5e-09
344gb|AY584659.1| Parmotrema tinctorum isolate AFTOL-ID 7 18S ribos... 70 5e-09
345gb|AY584658.1| Canoparmelia caroliniana isolate AFTOL-ID 6 18S r... 70 5e-09
346gb|AY604526.1| Endoconidioma populi strain UAMH 10297 18S riboso... 70 5e-09
347gb|AY781664.1| Chlamydomonas incerta 18S ribosomal RNA gene, par... 70 5e-09
348gb|AY781663.1| Chlamydomonas globosa 18S ribosomal RNA gene, par... 70 5e-09
349gb|AY781662.1| Schizochlamys gelatinosa 18S ribosomal RNA gene, ... 70 5e-09
350gb|AY766363.1| Bangiopsis sp. DM-Brazil-2004 18S ribosomal RNA g... 70 5e-09
351gb|AY766362.1| Porphyra drewiana 18S ribosomal RNA gene, complet... 70 5e-09
352gb|AY766361.1| Porphyra capensis 18S ribosomal RNA gene, complet... 70 5e-09
353gb|AY766360.1| Porphyra spiralis var. spiralis 18S ribosomal RNA... 70 5e-09
354gb|AY766359.1| Porphyra acanthophora var. brasiliensis 18S ribos... 70 5e-09
355gb|AY766358.1| Porphyra sp. Baleia 18S ribosomal RNA gene, compl... 70 5e-09
356gb|AY766357.1| Porphyra sp. Piaui 18S ribosomal RNA gene, comple... 70 5e-09
357gb|AY218384.1| Laetiporus sulphureus 18S ribosomal RNA gene, par... 70 5e-09
358gb|AY218383.1| Grifola frondosa 18S ribosomal RNA gene, partial ... 70 5e-09
359gb|AY218382.1| Sparassis sp. TENN50289/ss31 18S ribosomal RNA ge... 70 5e-09
360gb|AY218380.1| Sparassis spathulata strain zw-clarku004/ss11 18S... 70 5e-09
361gb|AY218379.1| Sparassis crispa strain zw-clarku003/ss9 18S ribo... 70 5e-09
362gb|AY218378.1| Sparassis spathulata strain zw-clarku002/ss8 18S ... 70 5e-09
363gb|AY218377.1| Sparassis spathulata strain zw-clarku001/ss7 18S ... 70 5e-09
364gb|AY218375.1| Sparassis crispa strain MBUH-SAVOLAINEN/ss4 18S r... 70 5e-09
365gb|AY218374.1| Sparassis crispa strain YCD2470/ss2 18S ribosomal... 70 5e-09
366gb|AY218373.1| Sparassis crispa strain YCD2145/ss1 18S ribosomal... 70 5e-09
367gb|AY773276.1| Thraustochytriidae sp. FJN-10 18S ribosomal RNA g... 70 5e-09
368gb|AY634164.1| Uncultured ectomycorrhiza (Pyronemataceae) 1.1.a ... 70 5e-09
369gb|AY771612.1| Ampulloclitocybe clavipes isolate AFTOL-ID 542 18... 70 5e-09
370gb|AY771611.1| Basidioradulum radula isolate AFTOL-ID 451 18S ri... 70 5e-09
371gb|AY771610.1| Calocera cornea isolate AFTOL-ID 438 18S ribosoma... 70 5e-09
372gb|AY771609.1| Clitocybe candicans isolate AFTOL-ID 541 18S ribo... 70 5e-09
373gb|AY771608.1| Clitocybe subditopoda isolate AFTOL-ID 533 18S ri... 70 5e-09
374gb|AY771607.1| Clitopilus prunulus isolate AFTOL-ID 522 18S ribo... 70 5e-09
375gb|AY771606.1| Collybia tuberosa isolate AFTOL-ID 557 18S riboso... 70 5e-09
376gb|AY771605.1| Cortinarius iodes isolate AFTOL-ID 285 18S riboso... 70 5e-09
377gb|AY771603.1| Dacryopinax spathularia isolate AFTOL-ID 454 18S ... 70 5e-09
378gb|AY771602.1| Macrolepiota dolichaula isolate AFTOL-ID 481 18S ... 70 5e-09
379gb|AY771601.1| Phallus hadriani isolate AFTOL-ID 683 18S ribosom... 70 5e-09
380gb|AY771600.1| Polyozellus multiplex isolate AFTOL-ID 677 18S ri... 70 5e-09
381gb|AY771599.1| Rickenella fibula isolate AFTOL-ID 486 18S riboso... 70 5e-09
382gb|AY454432.1| Phaeophila dendroides isolate WA1.15D small subun... 70 5e-09
383gb|AY454431.1| Phaeophila dendroides isolate WA2.4a1 small subun... 70 5e-09
384gb|AY454430.1| Phaeophila dendroides isolate FR1.2a2 small subun... 70 5e-09
385gb|AY454429.1| Phaeophila dendroides isolate MA2.4a1 small subun... 70 5e-09
386gb|AY454428.1| Ochlochaete hystrix isolate MA1.8d1 small subunit... 70 5e-09
387gb|AY454427.1| Ochlochaete hystrix isolate MA1.08d2 small subuni... 70 5e-09
388gb|AY454426.1| Ruthnielsenia tenuis isolate Ma2.6a1 small subuni... 70 5e-09
389gb|AY454425.1| Ruthnielsenia tenuis isolate WA2.22b3 small subun... 70 5e-09
390gb|AY766081.1| Tremellodendron sp. PBM2324 isolate AFTOL-ID 699 ... 70 5e-09
391gb|AY648095.1| Cetradonia linearis 18S ribosomal RNA gene, parti... 70 5e-09
392gb|AY607868.1| Trichocolea tomentosa 18S ribosomal RNA gene, par... 70 5e-09
393gb|AY607867.1| Scapania nemorosa 18S ribosomal RNA gene, partial... 70 5e-09
394gb|AY607865.1| Porella pinnata 18S ribosomal RNA gene, partial s... 70 5e-09
395gb|AY607863.1| Petalophyllum ralfsii 18S ribosomal RNA gene, par... 70 5e-09
396gb|AY607862.1| Odontoschisma denudatum 18S ribosomal RNA gene, p... 70 5e-09
397gb|AY607861.1| Metzgeria sp. Davis 361 18S ribosomal RNA gene, p... 70 5e-09
398gb|AY607860.1| Marsupidium latifolium 18S ribosomal RNA gene, pa... 70 5e-09
399gb|AY607859.1| Lepidozia reptans 18S ribosomal RNA gene, partial... 70 5e-09
400gb|AY607858.1| Jubula pennsylvanica 18S ribosomal RNA gene, part... 70 5e-09
401gb|AY607857.1| Isotachis lyallii 18S ribosomal RNA gene, partial... 70 5e-09
402gb|AY607856.1| Herbertus sakurai 18S ribosomal RNA gene, partial... 70 5e-09
403gb|AY607855.1| Haplomitrium gibbsiae 18S ribosomal RNA gene, par... 70 5e-09
404gb|AY607854.1| Haplomitrium blumei 18S ribosomal RNA gene, parti... 70 5e-09
405gb|AY607853.1| Gackstroemia weindorferi 18S ribosomal RNA gene, ... 70 5e-09
406gb|AY607852.1| Dumortiera hirsuta 18S ribosomal RNA gene, partia... 70 5e-09
407gb|AY607851.1| Dendrohypopterygium arbuscula 18S ribosomal RNA g... 70 5e-09
408gb|AY607850.1| Ceratolejeunea coarina 18S ribosomal RNA gene, pa... 70 5e-09
409gb|AY607849.1| Calypogeia muelleriana 18S ribosomal RNA gene, pa... 70 5e-09
410gb|AY743957.1| Stenopus hispidus 18S ribosomal RNA gene, complet... 70 5e-09
411gb|AY743955.1| Panulirus argus 18S ribosomal RNA gene, complete ... 70 5e-09
412gb|AY743953.1| Libinia emarginata 18S ribosomal RNA gene, comple... 70 5e-09
413gb|AY743949.1| Emerita talpoida 18S ribosomal RNA gene, complete... 70 5e-09
414gb|AY743947.1| Gonodactylus viridus 18S ribosomal RNA gene, comp... 70 5e-09
415gb|AY743946.1| Heteromysis sp. CCB-2004 18S ribosomal RNA gene, ... 70 5e-09
416gb|AY743945.1| Homarus americanus 18S ribosomal RNA gene, comple... 70 5e-09
417gb|AY743943.1| Limnoria sp. CCB-2004 18S ribosomal RNA gene, com... 70 5e-09
418gb|AY743942.1| Ocypode quadrata 18S ribosomal RNA gene, complete... 70 5e-09
419gb|AY752975.1| Cortinarius sodagnitus isolate AFTOL-ID 811 18S r... 70 5e-09
420gb|AY752974.1| Callistosporium sp. PBM2341 isolate AFTOL-ID 978 ... 70 5e-09
421gb|AY752973.1| Cyphellostereum laeve isolate AFTOL-ID 983 18S ri... 70 5e-09
422gb|AY752972.1| Hebeloma velutipes isolate AFTOL-ID 980 18S ribos... 70 5e-09
423gb|AY752971.1| Hydnellum geogenium isolate AFTOL-ID 680 18S ribo... 70 5e-09
424gb|AY752970.1| Phaeomarasmius proximans isolate AFTOL-ID 979 18S... 70 5e-09
425gb|AY752969.1| Chrysomphalina grossula isolate AFTOL-ID 981 18S ... 70 5e-09
426gb|AY752968.1| Gomphus clavatus isolate AFTOL-ID 725 18S ribosom... 70 5e-09
427gb|AY752967.1| Inocybe cookei isolate AFTOL-ID 520 18S ribosomal... 70 5e-09
428gb|AY752966.1| Rhodocollybia maculata isolate AFTOL-ID 540 18S r... 70 5e-09
429gb|AY752965.1| Hygrocybe conica isolate AFTOL-ID 729 18S ribosom... 70 5e-09
430gb|AF008957.1| Luffa quinquefida 18S ribosomal RNA gene, complet... 70 5e-09
431gb|AF008956.1| Marah macrocarpus 18S ribosomal RNA gene, complet... 70 5e-09
432gb|AF008955.1| Corallocarpus bainesii 18S ribosomal RNA gene, co... 70 5e-09
433gb|AF008954.1| Coriaria arborea 18S ribosomal RNA gene, complete... 70 5e-09
434gb|AF008953.1| Octomeles sumatrana 18S ribosomal RNA gene, compl... 70 5e-09
435gb|AF008951.1| Hillebrandia sandwichensis 18S ribosomal RNA gene... 70 5e-09
436gb|AF008950.1| Begonia oxyloba 18S ribosomal RNA gene, complete ... 70 5e-09
437gb|AF008949.1| Begonia glabra 18S ribosomal RNA gene, complete s... 70 5e-09
438gb|AF008948.1| Begonia boisiana 18S ribosomal RNA gene, complete... 70 5e-09
439gb|AY630560.1| Clematoscenea sp. KY-2004 18S ribosomal RNA gene,... 70 5e-09
440gb|AY630559.1| Psococerastis nubila voucher KY218 18S ribosomal ... 70 5e-09
441gb|AY630558.1| Metylophorus novaescotiae voucher Menov.2.3.2001.... 70 5e-09
442gb|AY630557.1| Podopterocus sp. KY-2004 18S ribosomal RNA gene, ... 70 5e-09
443gb|AY630556.1| Sigmatoneura kolbei voucher KY181 18S ribosomal R... 70 5e-09
444gb|AY630555.1| Psocus sp. KY-2004 18S ribosomal RNA gene, partia... 70 5e-09
445gb|AY630554.1| Trichadenotecnum sp. KPJ-2003 18S ribosomal RNA g... 70 5e-09
446gb|AY630553.1| Ptycta sp. KY-2002 18S ribosomal RNA gene, partia... 70 5e-09
447gb|AY630552.1| Ptyctini sp. KY180 18S ribosomal RNA gene, partia... 70 5e-09
448gb|AY630551.1| Atrichadenotecnum sp. KY-2004 18S ribosomal RNA g... 70 5e-09
449gb|AY630550.1| Loensia moesta voucher Lomoe.8.31.2001.2 18S ribo... 70 5e-09
450gb|AY630549.1| Loensia variegata voucher KY179 18S ribosomal RNA... 70 5e-09
451gb|AY630548.1| Blastopsocus lithinus voucher Bllit.8.31.2001.11 ... 70 5e-09
452gb|AY630547.1| Blaste quieta voucher Blqui.2.3.2001.5 18S riboso... 70 5e-09
453gb|AY630546.1| Amphigerontia jezoensis voucher KY213 18S ribosom... 70 5e-09
454gb|AY630545.1| Hemipsocus chloroticus voucher Hechl.5.16.2002.6 ... 70 5e-09
455gb|AY630544.1| Hemipsocus sp. KY-2004c 18S ribosomal RNA gene, p... 70 5e-09
456gb|AY630543.1| Hemipsocus sp. KY-2004b 18S ribosomal RNA gene, p... 70 5e-09
457gb|AY630542.1| Hemipsocus sp. KY-2004a 18S ribosomal RNA gene, p... 70 5e-09
458gb|AY630541.1| Psilopsocus malayanus voucher KY195 18S ribosomal... 70 5e-09
459gb|AY630540.1| Lichenomima sp. KY-2004 18S ribosomal RNA gene, p... 70 5e-09
460gb|AY630539.1| Epipsocus sp. KY-2004 18S ribosomal RNA gene, par... 70 5e-09
461gb|AY630538.1| Goja sp. KY-2004 18S ribosomal RNA gene, partial ... 70 5e-09
462gb|AY630537.1| Bertkauia crosbyana voucher Becro.8.31.2001.14 18... 70 5e-09
463gb|AY630536.1| Trichopsocus dalii voucher KY248 18S ribosomal RN... 70 5e-09
464gb|AY630535.1| Zelandopsocus sp. KY-2004 18S ribosomal RNA gene,... 70 5e-09
465gb|AY630534.1| Australopsocus sp. KY-2004 18S ribosomal RNA gene... 70 5e-09
466gb|AY630533.1| Aaroniella sp. KY-2004 18S ribosomal RNA gene, pa... 70 5e-09
467gb|AY630532.1| Aaroniella badonneli voucher Aabad.8.31.2001.8 18... 70 5e-09
468gb|AY630531.1| Philotarsopsis ornatus voucher Prsp.12.4.2003.6 1... 70 5e-09
469gb|AY630530.1| Philotarsus kwakiutl voucher Phkwa.11.17.2003.10 ... 70 5e-09
470gb|AY630529.1| Haplophallus sp. KY-2002 18S ribosomal RNA gene, ... 70 5e-09
471gb|AY630528.1| Haplophallus wongae voucher Hawon.12.4.2003.5 18S... 70 5e-09
472gb|AY630527.1| Pseudocaecilius citricola voucher Pccit.11.17.200... 70 5e-09
473gb|AY630526.1| Allocaecilius sinensis voucher KY232 18S ribosoma... 70 5e-09
474gb|AY630525.1| Mepleres suzukii voucher KY242 18S ribosomal RNA ... 70 5e-09
475gb|AY630524.1| Ophiodopelma glyptocephalum voucher KY234 18S rib... 70 5e-09
476gb|AY630523.1| Phallocaecilius hirsutus voucher KY217 18S riboso... 70 5e-09
477gb|AY630522.1| Lobocaecilius monicus voucher Lomon.12.4.2003.10 ... 70 5e-09
478gb|AY630521.1| Heterocaecilius solocipennis voucher Hcsol.12.4.2... 70 5e-09
479gb|AY630520.1| Heterocaecilius fuscus voucher KY237 18S ribosoma... 70 5e-09
480gb|AY630519.1| Calopsocus furcata voucher KY199 18S ribosomal RN... 70 5e-09
481gb|AY630517.1| Kilauella sp. KY-2004 18S ribosomal RNA gene, par... 70 5e-09
482gb|AY630516.1| Mesopsocus hongkongensis voucher KY224 18S riboso... 70 5e-09
483gb|AY630515.1| Mesopsocus unipunctatus voucher Meuni.12.4.2003.4... 70 5e-09
484gb|AY630514.1| Eolachesilla chilensis voucher KY214 18S ribosoma... 70 5e-09
485gb|AY630513.1| Idatenopsocus orientalis voucher KY203 18S riboso... 70 5e-09
486gb|AY630512.1| Ectopsocus meridionalis voucher Epmer.2.3.2001.4 ... 70 5e-09
487gb|AY630511.1| Ectopsocopsis cryptomeriae voucher Etcry.11.17.20... 70 5e-09
488gb|AY630510.1| Ectopsocus sp. KY-2004 18S ribosomal RNA gene, pa... 70 5e-09
489gb|AY630509.1| Anomopsocus amabalis voucher Anama.11.17.2003.9 1... 70 5e-09
490gb|AY630508.1| Peripsocus madidus voucher Pemad.8.31.2001.7 18S ... 70 5e-09
491gb|AY630507.1| Peripsocus subfasciatus voucher Pesub.2.3.2001.2 ... 70 5e-09
492gb|AY630506.1| Kaestneriella sp. KY-2004 18S ribosomal RNA gene,... 70 5e-09
493gb|AY630505.1| Lachesilla pacifica voucher Tecon.11.17.2003.1 18... 70 5e-09
494gb|AY630504.1| Lachesilla anna voucher Laann.1.16.2001.2 18S rib... 70 5e-09
495gb|AY630503.1| Lachesilla forcepeta voucher Lafor.8.31.2001.10 1... 70 5e-09
496gb|AY630502.1| Lachesilla sp. KY-2004 18S ribosomal RNA gene, pa... 70 5e-09
497gb|AY630480.1| Archipsocus recens voucher KY206 18S ribosomal RN... 70 5e-09
498gb|AY630479.1| Archipsocopsis sp. KY-2004 18S ribosomal RNA gene... 70 5e-09
499gb|AY630478.1| Archipsocus sp. KY-2004 18S ribosomal RNA gene, p... 70 5e-09
500gb|AY630456.1| Prionoglaris sp. KY-2004 18S ribosomal RNA gene, ... 70 5e-09

>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA
          Length = 724

 Score =  555 bits (280), Expect = e-155
 Identities = 287/288 (99%), Gaps = 1/288 (0%)
 Strand = Plus / Minus

                                                                       
Query: 1   cccatggtacaacgtacagcaaactcccgtatgtgtctcctcaaagggagtgaacaaaca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 662 cccatggtacaacgtacagcaaactcccgtatgtgtctcctcaaagggagtgaacaaaca 603

                                                                       
Query: 61  atcaaacactgatacaaaaccgatacaacagtgagcggccatgtagagctggctcagcgt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 602 atcaaacactgatacaaaaccgatacaacagtgagcggccatgtagagctggctcagcgt 543

                                                                       
Query: 121 acgtcctcccctctctctctcatggagatcataacagaggatttattcatgtatatgtat 180
           |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 542 acgtcctccc-tctctctctcatggagatcataacagaggatttattcatgtatatgtat 484

                                                                       
Query: 181 atatgtgtatgtgacctcaacctaccaagcgtcgatcgctggagatatggggagcacgtg 240
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 483 atatgtgtatgtgacctcaacctaccaagcgtcgatcgctggagatatggggagcacgtg 424

                                                           
Query: 241 ttcgatcagtggatcttagagcagtcgacactggcgctgatcgtgtag 288
           ||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 423 ttcgatcagtggatcttagagcagtcgacactggcgctgatcgtgtag 376



to top

>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA
          Length = 732

 Score =  422 bits (213), Expect = e-115
 Identities = 225/229 (98%)
 Strand = Plus / Minus

                                                                       
Query: 1   cccatggtacaacgtacagcaaactcccgtatgtgtctcctcaaagggagtgaacaaaca 60
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 678 cccatggtacaacgtacagcaaactcccgtatgtgtctcctcaaagggagtgaacaaaca 619

                                                                       
Query: 61  atcaaacactgatacaaaaccgatacaacagtgagcggccatgtagagctggctcagcgt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 618 atcaaacactgatacaaaaccgatacaacagtgagcggccatgtagagctggctcagcgt 559

                                                                       
Query: 121 acgtcctcccctctctctctcatggagatcataacagaggatttattcatgtatatgtat 180
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 558 acgtcctcccctctctctcccatggagatcataacagaggatttattcatgtatatgtat 499

                                                            
Query: 181 atatgtgtatgtgacctcaacctaccaagcgtcgatcgctggagatatg 229
           ||||| ||||||||||||||||| |||||||||||||||||||| ||||
Sbjct: 498 atatgcgtatgtgacctcaaccttccaagcgtcgatcgctggaggtatg 450



 Score = 89.7 bits (45), Expect = 5e-15
 Identities = 48/49 (97%)
 Strand = Plus / Minus

                                                            
Query: 240 gttcgatcagtggatcttagagcagtcgacactggcgctgatcgtgtag 288
           |||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 427 gttcgatcagtggatcttggagcagtcgacactggcgctgatcgtgtag 379



to top

>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor
          Length = 627

 Score =  414 bits (209), Expect = e-113
 Identities = 224/229 (97%)
 Strand = Plus / Minus

                                                                       
Query: 1   cccatggtacaacgtacagcaaactcccgtatgtgtctcctcaaagggagtgaacaaaca 60
           ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
Sbjct: 607 cccatggtacaacgtacagcaaactcccgtatgtgtctccttaaagggagtgaacaaaca 548

                                                                       
Query: 61  atcaaacactgatacaaaaccgatacaacagtgagcggccatgtagagctggctcagcgt 120
           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 547 atcaaacactgatacaaaaccgatacaacagtgagcggccatgtagagctggctcagcgt 488

                                                                       
Query: 121 acgtcctcccctctctctctcatggagatcataacagaggatttattcatgtatatgtat 180
           ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||
Sbjct: 487 acgtcctcccctctctctcccatggagatcataacagaggatttattcatgtatatgtat 428

                                                            
Query: 181 atatgtgtatgtgacctcaacctaccaagcgtcgatcgctggagatatg 229
           ||||| ||||||||||||||||| |||||||||||||||||||| ||||
Sbjct: 427 atatgcgtatgtgacctcaacctgccaagcgtcgatcgctggaggtatg 379



 Score = 89.7 bits (45), Expect = 5e-15
 Identities = 48/49 (97%)
 Strand = Plus / Minus

                                                            
Query: 240 gttcgatcagtggatcttagagcagtcgacactggcgctgatcgtgtag 288
           |||||||||||||||||| ||||||||||||||||||||||||||||||
Sbjct: 356 gttcgatcagtggatcttggagcagtcgacactggcgctgatcgtgtag 308



to top

>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA,
           complete cds
          Length = 737

 Score =  147 bits (74), Expect = 2e-32
 Identities = 156/182 (85%), Gaps = 6/182 (3%)
 Strand = Plus / Minus

                                                                       
Query: 3   catggtacaacgtacagcaaactcccgtatgtgtctcctcaaagggagtgaacaaacaat 62
           |||||||||| ||||| ||||||||||| | ||    |||||||||||||||| ||||||
Sbjct: 673 catggtacaaagtacaacaaactcccgtctctg----ctcaaagggagtgaacgaacaat 618

                                                                       
Query: 63  caaacactgatacaaaaccgatacaacagtgagcggccatgtagagctggctcagcgtac 122
           ||||| |||||||||||  ||||||||||||  |||| ||| |||||||||||  |||||
Sbjct: 617 caaacgctgatacaaaatagatacaacagtggccggctatgcagagctggctcgacgtac 558

                                                                       
Query: 123 gtcctcccctctctctctcatggagatcataacagaggatttattcatgtatatgtatat 182
           || ||  ||| |||||| ||||||||||||| ||||| |||||||||||||||||| |||
Sbjct: 557 gtact--cctgtctctcacatggagatcatatcagagcatttattcatgtatatgtgtat 500

             
Query: 183 at 184
           ||
Sbjct: 499 at 498



 Score = 50.1 bits (25), Expect = 0.004
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                    
Query: 242 tcgatcagtggatcttagagcagtc 266
           |||||||||||||||||||||||||
Sbjct: 412 tcgatcagtggatcttagagcagtc 388



to top

>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds
          Length = 3448

 Score =  139 bits (70), Expect = 6e-30
 Identities = 127/145 (87%), Gaps = 2/145 (1%)
 Strand = Plus / Minus

                                                                        
Query: 40   ctcaaagggagtgaacaaacaatcaaacactgatacaaaaccgatacaacagtgagcggc 99
            |||||||||||||||| ||||||||||| |||||||||||  ||||||||||||  ||||
Sbjct: 3436 ctcaaagggagtgaacgaacaatcaaacgctgatacaaaatagatacaacagtggccggc 3377

                                                                        
Query: 100  catgtagagctggctcagcgtacgtcctcccctctctctctcatggagatcataacagag 159
             ||| |||||||||||  ||||||| ||  ||| |||||| ||||||||||||| |||||
Sbjct: 3376 tatgcagagctggctcgacgtacgtact--cctgtctctcacatggagatcatatcagag 3319

                                     
Query: 160  gatttattcatgtatatgtatatat 184
             |||||||||||||||||| |||||
Sbjct: 3318 catttattcatgtatatgtgtatat 3294



 Score = 50.1 bits (25), Expect = 0.004
 Identities = 25/25 (100%)
 Strand = Plus / Minus

                                     
Query: 242  tcgatcagtggatcttagagcagtc 266
            |||||||||||||||||||||||||
Sbjct: 3208 tcgatcagtggatcttagagcagtc 3184



to top

>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA,
           complete cds
          Length = 730

 Score =  135 bits (68), Expect = 1e-28
 Identities = 134/155 (86%), Gaps = 2/155 (1%)
 Strand = Plus / Minus

                                                                       
Query: 40  ctcaaagggagtgaacaaacaatcaaacactgatacaaaaccgatacaacagtgagcggc 99
           |||||||||||||||| ||||||||||| |||||||||||  ||||||||||||  | ||
Sbjct: 645 ctcaaagggagtgaacgaacaatcaaacgctgatacaaaatagatacaacagtggccagc 586

                                                                       
Query: 100 catgtagagctggctcagcgtacgtcctcccctctctctctcatggagatcataacagag 159
            ||| | |||||||||   |||||| ||||  | |||||| ||||||||||||| |||||
Sbjct: 585 tatgcaaagctggctcgatgtacgtactcc--tatctctcacatggagatcatatcagag 528

                                              
Query: 160 gatttattcatgtatatgtatatatgtgtatgtga 194
            |||||||||||||||||||||||||||| |||||
Sbjct: 527 catttattcatgtatatgtatatatgtgtgtgtga 493



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 242 tcgatcagtggatcttagagcagtcgacactggcgctgatcgtgtag 288
           ||||||||||||||||||||||||| ||    |||||||||||||||
Sbjct: 431 tcgatcagtggatcttagagcagtccacggatgcgctgatcgtgtag 385



to top

>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid
           transfer protein precursor
          Length = 496

 Score = 89.7 bits (45), Expect = 5e-15
 Identities = 57/61 (93%)
 Strand = Plus / Minus

                                                                       
Query: 134 tctctctcatggagatcataacagaggatttattcatgtatatgtatatatgtgtatgtg 193
           |||||| ||||||||||||| ||||| |||||||||||||||||||||||||||| ||||
Sbjct: 494 tctctcacatggagatcatatcagagcatttattcatgtatatgtatatatgtgtgtgtg 435

            
Query: 194 a 194
           |
Sbjct: 434 a 434



 Score = 54.0 bits (27), Expect = 3e-04
 Identities = 42/47 (89%)
 Strand = Plus / Minus

                                                          
Query: 242 tcgatcagtggatcttagagcagtcgacactggcgctgatcgtgtag 288
           ||||||||||||||||||||||||| ||    |||||||||||||||
Sbjct: 372 tcgatcagtggatcttagagcagtccacggatgcgctgatcgtgtag 326



to top

>gb|AF007540.1|AF007540 Smittium culisetae 18S ribosomal RNA gene, partial sequence
          Length = 1816

 Score = 75.8 bits (38), Expect = 8e-11
 Identities = 38/38 (100%)
 Strand = Plus / Minus

                                                  
Query: 280  atcgtgtagcgcgcgtgcggcccagaacatctaagggc 317
            ||||||||||||||||||||||||||||||||||||||
Sbjct: 1513 atcgtgtagcgcgcgtgcggcccagaacatctaagggc 1476



to top

>gb|AY818951.1| Plantago rugelii 18S ribosomal RNA (rrn18) gene, partial sequence
          Length = 1182

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 909 gtgtagcgcgcgtgcggcccagaacatctaagggc 875



to top

>gb|AY850007.1| Cerrena unicolor 18S ribosomal RNA gene, partial sequence
          Length = 1775

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1455 gtgtagcgcgcgtgcggcccagaacatctaagggc 1421



to top

>gb|AY856456.1| Uncultured Glomus isolate 3 18S ribosomal RNA gene, partial
           sequence; and internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence
          Length = 930

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 214 gtgtagcgcgcgtgcggcccagaacatctaagggc 180



to top

>gb|AY856455.1| Uncultured Glomus isolate 2 18S ribosomal RNA gene, partial
           sequence; and internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence
          Length = 930

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 210 gtgtagcgcgcgtgcggcccagaacatctaagggc 176



to top

>gb|AY654887.1| Fibulorhizoctonia sp. LA082103L 18S ribosomal RNA gene, partial
            sequence
          Length = 1773

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1464 gtgtagcgcgcgtgcggcccagaacatctaagggc 1430



to top

>gb|AY692319.1| Amphibiocystidium ranae strain 2-04 18S ribosomal RNA gene, complete
            sequence
          Length = 1767

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1440 gtgtagcgcgcgtgcggcccagaacatctaagggc 1406



to top

>gb|AY550245.1| Amphibiocystidium ranae 18S ribosomal RNA gene, internal transcribed
            spacer 1, 5.8S ribosomal RNA gene, internal transcribed
            spacer 2, and 28S ribosomal RNA gene, complete sequence
          Length = 3028

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1443 gtgtagcgcgcgtgcggcccagaacatctaagggc 1409



to top

>gb|AY572312.1| Aristolochia grandiflora 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1434 gtgtagcgcgcgtgcggcccagaacatctaagggc 1400



to top

>gb|AY572311.1| Cinnamosma madagascariensis 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1708

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1434 gtgtagcgcgcgtgcggcccagaacatctaagggc 1400



to top

>gb|AY572310.1| Pseudowintera axillaris 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1709

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1435 gtgtagcgcgcgtgcggcccagaacatctaagggc 1401



to top

>gb|AY572309.1| Gymnotheca involucrata 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1708

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1434 gtgtagcgcgcgtgcggcccagaacatctaagggc 1400



to top

>gb|AY572308.1| Gymnotheca chinensis 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1699

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1434 gtgtagcgcgcgtgcggcccagaacatctaagggc 1400



to top

>gb|AY572307.1| Drimys winteri 18S ribosomal RNA gene, partial sequence; chloroplast
          Length = 1705

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1432 gtgtagcgcgcgtgcggcccagaacatctaagggc 1398



to top

>gb|AY572306.1| Aristolochia gigantea 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1708

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1434 gtgtagcgcgcgtgcggcccagaacatctaagggc 1400



to top

>gb|AY572305.1| Houttuynia cordata 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1707

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1434 gtgtagcgcgcgtgcggcccagaacatctaagggc 1400



to top

>gb|AY572304.1| Anemopsis californica 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1702

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1433 gtgtagcgcgcgtgcggcccagaacatctaagggc 1399



to top

>gb|AY572303.1| Saururus chinensis 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1708

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1434 gtgtagcgcgcgtgcggcccagaacatctaagggc 1400



to top

>gb|AY572301.1| Sarcorhachis sydowii 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1707

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1433 gtgtagcgcgcgtgcggcccagaacatctaagggc 1399



to top

>gb|AY572300.1| Zippelia begoniifolia 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1696

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1433 gtgtagcgcgcgtgcggcccagaacatctaagggc 1399



to top

>gb|AY572299.1| Piper arborescens 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1708

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1434 gtgtagcgcgcgtgcggcccagaacatctaagggc 1400



to top

>gb|AY572298.1| Piper aduncum 18S ribosomal RNA gene, partial sequence; chloroplast
          Length = 1707

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1433 gtgtagcgcgcgtgcggcccagaacatctaagggc 1399



to top

>gb|AY572297.1| Piper umbellatum 18S ribosomal RNA gene, partial sequence;
            chloroplast
          Length = 1697

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1433 gtgtagcgcgcgtgcggcccagaacatctaagggc 1399



to top

>gb|AY572296.1| Piper excelsum 18S ribosomal RNA gene, partial sequence; chloroplast
          Length = 1707

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1433 gtgtagcgcgcgtgcggcccagaacatctaagggc 1399



to top

>gb|AY572295.1| Piper hispidum 18S ribosomal RNA gene, partial sequence; chloroplast
          Length = 1697

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1433 gtgtagcgcgcgtgcggcccagaacatctaagggc 1399



to top

>gb|AY665533.1| Yemma signatus 18S ribosomal RNA gene, partial sequence
          Length = 738

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 442 gtgtagcgcgcgtgcggcccagaacatctaagggc 408



to top

>gb|AY665532.1| Phaenacantha bicolor 18S ribosomal RNA gene, partial sequence
          Length = 740

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 442 gtgtagcgcgcgtgcggcccagaacatctaagggc 408



to top

>gb|AY665531.1| Panaorus albomaculatus 18S ribosomal RNA gene, partial sequence
          Length = 737

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 443 gtgtagcgcgcgtgcggcccagaacatctaagggc 409



to top

>gb|AY665530.1| Oxycarenus brunneus 18S ribosomal RNA gene, partial sequence
          Length = 735

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 440 gtgtagcgcgcgtgcggcccagaacatctaagggc 406



to top

>gb|AY665529.1| Macropes exilis 18S ribosomal RNA gene, partial sequence
          Length = 741

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 444 gtgtagcgcgcgtgcggcccagaacatctaagggc 410



to top

>gb|AY665527.1| Geocoris pallidipennis 18S ribosomal RNA gene, partial sequence
          Length = 738

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 442 gtgtagcgcgcgtgcggcccagaacatctaagggc 408



to top

>gb|AY665526.1| Cymus tumescens 18S ribosomal RNA gene, partial sequence
          Length = 738

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 441 gtgtagcgcgcgtgcggcccagaacatctaagggc 407



to top

>gb|AY206425.1| Caulerpa cupressoides 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 28S ribosomal RNA gene, partial sequence
          Length = 981

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 57  gtgtagcgcgcgtgcggcccagaacatctaagggc 23



to top

>gb|AY206424.1| Caulerpa cupressoides 18S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 1, 5.8S ribosomal RNA gene
           and internal transcribed spacer 2, complete sequence;
           and 28S ribosomal RNA gene, partial sequence
          Length = 980

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 56  gtgtagcgcgcgtgcggcccagaacatctaagggc 22



to top

>gb|AY652582.1| Trichoplax sp. H3 18S ribosomal RNA gene, partial sequence
          Length = 442

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 268 gtgtagcgcgcgtgcggcccagaacatctaagggc 234



to top

>gb|AY652581.1| Trichoplax sp. H8 18S ribosomal RNA gene, partial sequence
          Length = 1781

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1464 gtgtagcgcgcgtgcggcccagaacatctaagggc 1430



to top

>gb|AY652580.1| Trichoplax sp. H4 18S ribosomal RNA gene, partial sequence
          Length = 1202

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 891 gtgtagcgcgcgtgcggcccagaacatctaagggc 857



to top

>gb|AY652579.1| Trichoplax sp. H7 18S ribosomal RNA gene, partial sequence
          Length = 1775

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1465 gtgtagcgcgcgtgcggcccagaacatctaagggc 1431



to top

>gb|AY652578.1| Trichoplax sp. H1 18S ribosomal RNA gene, partial sequence
          Length = 1742

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1427 gtgtagcgcgcgtgcggcccagaacatctaagggc 1393



to top

>gb|AY652577.1| Trichoplax sp. H2 18S ribosomal RNA gene, partial sequence
          Length = 1730

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1427 gtgtagcgcgcgtgcggcccagaacatctaagggc 1393



to top

>gb|AF084235.1| Stephanoeca diplocostata 18S ribosomal RNA gene, partial sequence
          Length = 1788

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1468 gtgtagcgcgcgtgcggcccagaacatctaagggc 1434



to top

>gb|AF084234.1| Diaphanoeca grandis 18S ribosomal RNA gene, partial sequence
          Length = 1794

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1464 gtgtagcgcgcgtgcggcccagaacatctaagggc 1430



to top

>gb|AF084233.1| Acanthoeca spectabilis 18S ribosomal RNA gene, partial sequence
          Length = 1740

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1448 gtgtagcgcgcgtgcggcccagaacatctaagggc 1414



to top

>gb|AF084230.1| Monosiga ovata 18S ribosomal RNA gene, partial sequence
          Length = 1765

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1439 gtgtagcgcgcgtgcggcccagaacatctaagggc 1405



to top

>gb|AF528564.1| Peronospora corydalis from Corydalis speciosa Max. 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1 and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 1202

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 72  gtgtagcgcgcgtgcggcccagaacatctaagggc 38



to top

>gb|AF528563.1| Peronospora corydalis from Corydalis speciosa Max. 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1 and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 1201

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 72  gtgtagcgcgcgtgcggcccagaacatctaagggc 38



to top

>gb|AF528562.1| Peronospora corydalis from Corydalis ochotensis Turcz. 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1 and 5.8S ribosomal RNA gene,
           complete sequence; and internal transcribed spacer 2,
           partial sequence
          Length = 1201

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 72  gtgtagcgcgcgtgcggcccagaacatctaagggc 38



to top

>gb|AF528561.1| Peronospora corydalis from Corydalis ochotensis Turcz. 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1 and 5.8S ribosomal RNA gene,
           complete sequence; and internal transcribed spacer 2,
           partial sequence
          Length = 1201

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 72  gtgtagcgcgcgtgcggcccagaacatctaagggc 38



to top

>gb|AF528560.1| Peronospora farinosa from Spinacia oleracea 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 1201

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 72  gtgtagcgcgcgtgcggcccagaacatctaagggc 38



to top

>gb|AF528559.1| Peronospora farinosa from Spinacia oleracea 18S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 1 and 5.8S
           ribosomal RNA gene, complete sequence; and internal
           transcribed spacer 2, partial sequence
          Length = 1201

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 72  gtgtagcgcgcgtgcggcccagaacatctaagggc 38



to top

>gb|AF528558.1| Peronospora farinosa from Chenopodium ficifolium Smith. 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1 and 5.8S ribosomal RNA gene,
           complete sequence; and internal transcribed spacer 2,
           partial sequence
          Length = 1197

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 72  gtgtagcgcgcgtgcggcccagaacatctaagggc 38



to top

>gb|AF528556.1| Peronospora farinosa from Chenopodium album L. 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1
           and 5.8S ribosomal RNA gene, complete sequence; and
           internal transcribed spacer 2, partial sequence
          Length = 1198

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 72  gtgtagcgcgcgtgcggcccagaacatctaagggc 38



to top

>gb|AY261369.1| Beauveria felina strain CBS 250.34 18S ribosomal RNA gene, internal
            transcribed spacer 1, 5.8S ribosomal RNA gene and
            internal transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 2286

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1430 gtgtagcgcgcgtgcggcccagaacatctaagggc 1396



to top

>gb|AY261368.1| Beauveria felina strain CBS 173.71 18S ribosomal RNA gene, internal
            transcribed spacer 1, 5.8S ribosomal RNA gene and
            internal transcribed spacer 2, complete sequence; and 28S
            ribosomal RNA gene, partial sequence
          Length = 2285

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1430 gtgtagcgcgcgtgcggcccagaacatctaagggc 1396



to top

>gb|AY261367.1| Beauveria felina strain HL-51-ALSP16-I003 18S ribosomal RNA gene,
            internal transcribed spacer 1, 5.8S ribosomal RNA gene
            and internal transcribed spacer 2, complete sequence; and
            28S ribosomal RNA gene, partial sequence
          Length = 2286

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1430 gtgtagcgcgcgtgcggcccagaacatctaagggc 1396



to top

>gb|AY249900.1| Bionectria pityrodes strain CBS 246.78 18S ribosomal RNA gene,
            complete sequence
          Length = 1728

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1430 gtgtagcgcgcgtgcggcccagaacatctaagggc 1396



to top

>gb|AY249899.1| Bionectria pityrodes strain CBS 102033 18S ribosomal RNA gene,
            complete sequence
          Length = 1728

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1430 gtgtagcgcgcgtgcggcccagaacatctaagggc 1396



to top

>gb|AY249898.1| Bionectria pityrodes 18S ribosomal RNA gene, complete sequence
          Length = 1728

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1430 gtgtagcgcgcgtgcggcccagaacatctaagggc 1396



to top

>gb|AY313034.2| Bullera nakhonratchasimensis 18S ribosomal RNA gene, partial
            sequence; internal transcribed spacer 1, 5.8S ribosomal
            RNA gene, and internal transcribed spacer 2, complete
            sequence; and 26S ribosomal RNA gene, partial sequence
          Length = 2270

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1452 gtgtagcgcgcgtgcggcccagaacatctaagggc 1418



to top

>gb|AY037173.1| Oxya chinensis 18S ribosomal RNA gene, complete sequence
          Length = 1888

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1580 gtgtagcgcgcgtgcggcccagaacatctaagggc 1546



to top

>gb|AY839843.1| Diehliomyces microsporus 18S ribosomal RNA gene, partial sequence
          Length = 1773

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1453 gtgtagcgcgcgtgcggcccagaacatctaagggc 1419



to top

>gb|AY839830.1| Inonotus baumii 18S ribosomal RNA gene, partial sequence
          Length = 1779

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1456 gtgtagcgcgcgtgcggcccagaacatctaagggc 1422



to top

>gb|AY839829.1| Inonotus linteus 18S ribosomal RNA gene, partial sequence
          Length = 1777

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1456 gtgtagcgcgcgtgcggcccagaacatctaagggc 1422



to top

>gb|AY839828.1| Inonotus linteus strain ASI26082 18S ribosomal RNA gene, partial
            sequence
          Length = 1777

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1456 gtgtagcgcgcgtgcggcccagaacatctaagggc 1422



to top

>gb|AY672801.1| Euphausia superba small subunit ribosomal RNA gene, partial sequence
          Length = 1806

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1506 gtgtagcgcgcgtgcggcccagaacatctaagggc 1472



to top

>gb|AY672802.1| Fragilariopsis cylindrus small subunit ribosomal RNA gene, partial
            sequence
          Length = 1744

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1446 gtgtagcgcgcgtgcggcccagaacatctaagggc 1412



to top

>gb|AY422222.1| Uncultured phototrophic eukaryote clone Nccln9shdApr2k 18S
           ribosomal RNA gene, partial sequence
          Length = 686

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 554 gtgtagcgcgcgtgcggcccagaacatctaagggc 520



to top

>gb|AY422221.1| Uncultured phototrophic eukaryote clone NCcln5shdApr2k 18S
           ribosomal RNA gene, partial sequence
          Length = 686

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 554 gtgtagcgcgcgtgcggcccagaacatctaagggc 520



to top

>gb|AY422220.1| Uncultured phototrophic eukaryote clone NCcln6shdApr2k 18S
           ribosomal RNA gene, partial sequence
          Length = 686

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 554 gtgtagcgcgcgtgcggcccagaacatctaagggc 520



to top

>gb|AY422219.1| Uncultured phototrophic eukaryote clone NCcln1shdApr2k 18S
           ribosomal RNA gene, partial sequence
          Length = 686

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 554 gtgtagcgcgcgtgcggcccagaacatctaagggc 520



to top

>gb|AY422218.1| Uncultured phototrophic eukaryote clone NCcln2shdApr2k 18S
           ribosomal RNA gene, partial sequence
          Length = 685

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 553 gtgtagcgcgcgtgcggcccagaacatctaagggc 519



to top

>gb|AY422217.1| Uncultured phototrophic eukaryote clone NCcln10shdApr2k 18S
           ribosomal RNA gene, partial sequence
          Length = 685

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 553 gtgtagcgcgcgtgcggcccagaacatctaagggc 519



to top

>gb|AY422216.1| Uncultured phototrophic eukaryote clone NCcln4shdApr2k 18S
           ribosomal RNA gene, partial sequence
          Length = 685

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 553 gtgtagcgcgcgtgcggcccagaacatctaagggc 519



to top

>gb|DQ092918.1| Anamika angustilamellata isolate AFTOL-ID 543 18S ribosomal RNA gene,
            partial sequence
          Length = 1792

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1472 gtgtagcgcgcgtgcggcccagaacatctaagggc 1438



to top

>gb|AY465354.1| Bangia sp. WELT A23126 18S ribosomal RNA gene, partial sequence
          Length = 1749

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1459 gtgtagcgcgcgtgcggcccagaacatctaagggc 1425



to top

>gb|AY465355.1| Bangia sp. WELT A25775 18S ribosomal RNA gene, partial sequence
          Length = 1756

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1466 gtgtagcgcgcgtgcggcccagaacatctaagggc 1432



to top

>gb|AY289649.1| Nypa fruticans 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1418 gtgtagcgcgcgtgcggcccagaacatctaagggc 1384



to top

>gb|AY289648.1| Aegiceras corniculatum 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1418 gtgtagcgcgcgtgcggcccagaacatctaagggc 1384



to top

>gb|AY289647.1| Barringtonia racemosa 18S ribosomal RNA gene, partial sequence
          Length = 1669

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1417 gtgtagcgcgcgtgcggcccagaacatctaagggc 1383



to top

>gb|AY289646.1| Scyphiphora hydrophyllacea 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1418 gtgtagcgcgcgtgcggcccagaacatctaagggc 1384



to top

>gb|AY289645.1| Cerbera manghas 18S ribosomal RNA gene, partial sequence
          Length = 1668

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1416 gtgtagcgcgcgtgcggcccagaacatctaagggc 1382



to top

>gb|AY289644.1| Clerodendrum inerme 18S ribosomal RNA gene, partial sequence
          Length = 1669

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1417 gtgtagcgcgcgtgcggcccagaacatctaagggc 1383



to top

>gb|AY289643.1| Dolichandrone spathacea 18S ribosomal RNA gene, partial sequence
          Length = 1668

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1416 gtgtagcgcgcgtgcggcccagaacatctaagggc 1382



to top

>gb|AY289642.1| Acanthus ebracteatus 18S ribosomal RNA gene, partial sequence
          Length = 1669

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1417 gtgtagcgcgcgtgcggcccagaacatctaagggc 1383



to top

>gb|AY289641.1| Avicennia marina 18S ribosomal RNA gene, partial sequence
          Length = 1669

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1417 gtgtagcgcgcgtgcggcccagaacatctaagggc 1383



to top

>gb|AY289640.1| Aegialitis annulata 18S ribosomal RNA gene, partial sequence
          Length = 1671

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1419 gtgtagcgcgcgtgcggcccagaacatctaagggc 1385



to top

>gb|AY289639.1| Pemphis acidula 18S ribosomal RNA gene, partial sequence
          Length = 1669

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1417 gtgtagcgcgcgtgcggcccagaacatctaagggc 1383



to top

>gb|AY289638.1| Sonneratia ovata 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1418 gtgtagcgcgcgtgcggcccagaacatctaagggc 1384



to top

>gb|AY289637.1| Lumnitzera littorea 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1418 gtgtagcgcgcgtgcggcccagaacatctaagggc 1384



to top

>gb|AY289636.1| Conocarpus erectus 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1418 gtgtagcgcgcgtgcggcccagaacatctaagggc 1384



to top

>gb|AY289635.1| Laguncularia racemosa 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1418 gtgtagcgcgcgtgcggcccagaacatctaagggc 1384



to top

>gb|AY289634.1| Xylocarpus granatum 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1418 gtgtagcgcgcgtgcggcccagaacatctaagggc 1384



to top

>gb|AY289633.1| Heritiera littoralis 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1418 gtgtagcgcgcgtgcggcccagaacatctaagggc 1384



to top

>gb|AY289632.1| Thespesia populnea 18S ribosomal RNA gene, partial sequence
          Length = 1668

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1416 gtgtagcgcgcgtgcggcccagaacatctaagggc 1382



to top

>gb|AY289631.1| Hibiscus tiliaceus 18S ribosomal RNA gene, partial sequence
          Length = 1669

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1417 gtgtagcgcgcgtgcggcccagaacatctaagggc 1383



to top

>gb|AY289630.1| Cynometra iripa 18S ribosomal RNA gene, partial sequence
          Length = 1668

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1417 gtgtagcgcgcgtgcggcccagaacatctaagggc 1383



to top

>gb|AY289629.1| Pongamia pinnata 18S ribosomal RNA gene, partial sequence
          Length = 1668

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1416 gtgtagcgcgcgtgcggcccagaacatctaagggc 1382



to top

>gb|AY289628.1| Excoecaria agallocha 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1418 gtgtagcgcgcgtgcggcccagaacatctaagggc 1384



to top

>gb|AY289627.1| Rhizophora stylosa 18S ribosomal RNA gene, partial sequence
          Length = 1671

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1419 gtgtagcgcgcgtgcggcccagaacatctaagggc 1385



to top

>gb|AY289626.1| Bruguiera sexangula 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1418 gtgtagcgcgcgtgcggcccagaacatctaagggc 1384



to top

>gb|AY289625.1| Kandelia candel 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1418 gtgtagcgcgcgtgcggcccagaacatctaagggc 1384



to top

>gb|AY289624.1| Ceriops tagal 18S ribosomal RNA gene, partial sequence
          Length = 1670

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1418 gtgtagcgcgcgtgcggcccagaacatctaagggc 1384



to top

>gb|AY823528.1| Jatropha curcas 18S ribosomal RNA gene, partial sequence
          Length = 1451

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1421 gtgtagcgcgcgtgcggcccagaacatctaagggc 1387



to top

>gb|AY734450.1| Haliclona oculata 18S ribosomal RNA gene, complete sequence
          Length = 1975

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1651 gtgtagcgcgcgtgcggcccagaacatctaagggc 1617



to top

>gb|AY734449.1| Dysidea sp. 23-XI-02-2-001 N27 18S ribosomal RNA gene, complete
            sequence
          Length = 1769

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1460 gtgtagcgcgcgtgcggcccagaacatctaagggc 1426



to top

>gb|AY734448.1| Ircinia felix 18S ribosomal RNA gene, complete sequence
          Length = 1791

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1472 gtgtagcgcgcgtgcggcccagaacatctaagggc 1438



to top

>gb|AY734447.1| Calyx podatypa 18S ribosomal RNA gene, complete sequence
          Length = 1788

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1475 gtgtagcgcgcgtgcggcccagaacatctaagggc 1441



to top

>gb|AY734444.1| Haliclona sp. sp5 18S ribosomal RNA gene, complete sequence
          Length = 1983

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1665 gtgtagcgcgcgtgcggcccagaacatctaagggc 1631



to top

>gb|AY734443.1| Agelas conifera 18S ribosomal RNA gene, complete sequence
          Length = 1798

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1482 gtgtagcgcgcgtgcggcccagaacatctaagggc 1448



to top

>gb|AY734442.1| Pseudaxinella lunaecharta 18S ribosomal RNA gene, complete sequence
          Length = 1794

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1481 gtgtagcgcgcgtgcggcccagaacatctaagggc 1447



to top

>gb|AY734440.1| Spheciospongia vesparium 18S ribosomal RNA gene, complete sequence
          Length = 1786

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1476 gtgtagcgcgcgtgcggcccagaacatctaagggc 1442



to top

>gb|AY734439.1| Cinachyrella sp. sp11 18S ribosomal RNA gene, complete sequence
          Length = 1792

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1473 gtgtagcgcgcgtgcggcccagaacatctaagggc 1439



to top

>gb|AY734438.1| Cinachyrella sp. 24-XI-02-3-2 N28 18S ribosomal RNA gene, complete
            sequence
          Length = 1786

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1473 gtgtagcgcgcgtgcggcccagaacatctaagggc 1439



to top

>gb|AY734437.1| Cinachyrella sp. 22-XI-02-1-13 N25 18S ribosomal RNA gene, complete
            sequence
          Length = 1802

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1483 gtgtagcgcgcgtgcggcccagaacatctaagggc 1449



to top

>gb|AF005243.2| Blattella germanica 18S ribosomal RNA gene, partial sequence;
            internal transcribed spacer 1, 5.8S ribosomal RNA gene,
            internal transcribed spacer 2, and 28S ribosomal RNA
            gene, complete sequence; and intergenic spacer and
            external transcribed spacer regions
          Length = 9015

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1632 gtgtagcgcgcgtgcggcccagaacatctaagggc 1598



to top

>gb|AF280078.1| Phalansterium solitarium 18S ribosomal RNA gene, partial sequence
          Length = 1876

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1545 gtgtagcgcgcgtgcggcccagaacatctaagggc 1511



to top

>gb|DQ227859.1| Porphyra yezoensis isolate NS007 small subunit ribosomal RNA gene,
            partial sequence
          Length = 2345

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 2003 gtgtagcgcgcgtgcggcccagaacatctaagggc 1969



to top

>gb|DQ227858.1| Porphyra yezoensis isolate NS006 small subunit ribosomal RNA gene,
            partial sequence
          Length = 3281

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1980 gtgtagcgcgcgtgcggcccagaacatctaagggc 1946



to top

>gb|DQ227857.1| Porphyra yezoensis isolate NS005 small subunit ribosomal RNA gene,
            partial sequence
          Length = 2876

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 2005 gtgtagcgcgcgtgcggcccagaacatctaagggc 1971



to top

>gb|DQ227856.1| Porphyra yezoensis isolate NS004 small subunit ribosomal RNA gene,
            partial sequence
          Length = 3314

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 2006 gtgtagcgcgcgtgcggcccagaacatctaagggc 1972



to top

>gb|DQ227855.1| Porphyra yezoensis isolate NS003 small subunit ribosomal RNA gene,
            partial sequence
          Length = 3280

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 2005 gtgtagcgcgcgtgcggcccagaacatctaagggc 1971



to top

>gb|DQ227854.1| Porphyra yezoensis isolate NS002 small subunit ribosomal RNA gene,
            partial sequence
          Length = 2877

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 2006 gtgtagcgcgcgtgcggcccagaacatctaagggc 1972



to top

>gb|DQ227853.1| Porphyra yezoensis isolate NS001 small subunit ribosomal RNA gene,
            partial sequence
          Length = 2874

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 2003 gtgtagcgcgcgtgcggcccagaacatctaagggc 1969



to top

>gb|DQ234257.1| Chaetomium globosum 18S ribosomal RNA gene, partial sequence;
            internal transcribed spacer 1, 5.8S ribosomal RNA gene,
            and internal transcribed spacer 2, complete sequence; and
            26S ribosomal RNA gene, partial sequence
          Length = 2225

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1403 gtgtagcgcgcgtgcggcccagaacatctaagggc 1369



to top

>gb|DQ234563.1| Platygloea disciformis isolate AFTOL-ID 710 18S small subunit
            ribosomal RNA gene, partial sequence
          Length = 1788

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1458 gtgtagcgcgcgtgcggcccagaacatctaagggc 1424



to top

>gb|DQ234543.1| Bensingtonia yuccicola isolate AFTOL-ID 857 18S small subunit
            ribosomal RNA gene, partial sequence
          Length = 1799

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1469 gtgtagcgcgcgtgcggcccagaacatctaagggc 1435



to top

>gb|DQ234542.1| Auricularia sp. PBM2295 18S small subunit ribosomal RNA gene, partial
            sequence
          Length = 1788

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1458 gtgtagcgcgcgtgcggcccagaacatctaagggc 1424



to top

>gb|AY755703.1| Ephedra pachyclada voucher (S) C-7844 18S ribosomal RNA gene, partial
            sequence
          Length = 1624

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1403 gtgtagcgcgcgtgcggcccagaacatctaagggc 1369



to top

>gb|AY755701.1| Ephedra campylopoda voucher (S) C-7605 18S ribosomal RNA gene,
            partial sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755700.1| Ephedra ciliata voucher (S) C-591 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755699.1| Ephedra foliata voucher (S) C-7808 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755698.1| Ephedra alata voucher (S) C-303 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755697.1| Ephedra altissima voucher (S) C-7688 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755696.1| Ephedra altissima voucher (S) C-628 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755695.1| Ephedra aphylla voucher (S) C-7791 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755694.1| Ephedra equisetina voucher (S) C-465-2 18S ribosomal RNA gene,
            partial sequence
          Length = 1467

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755693.1| Ephedra distachya voucher (S) 03-684 18S ribosomal RNA gene, partial
            sequence
          Length = 1461

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755692.1| Ephedra tweediana voucher (UC) 66-0742 18S ribosomal RNA gene,
            partial sequence
          Length = 1467

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755691.1| Ephedra chilensis voucher (UC) 49-0542 18S ribosomal RNA gene,
            partial sequence
          Length = 1646

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755689.1| Ephedra rupestris voucher (UC) 87-1368 18S ribosomal RNA gene,
            partial sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755688.1| Ephedra nevadensis voucher (UC) 66-1033 18S ribosomal RNA gene,
            partial sequence
          Length = 1689

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755687.1| Ephedra trifurca voucher (Mo) 04630447 18S ribosomal RNA gene,
            partial sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755686.1| Ephedra distachya voucher (S) 04-481 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755685.1| Ephedra gerardiana voucher (O) 74-460 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755684.1| Ephedra torreyana voucher (S) 04-487 18S ribosomal RNA gene, partial
            sequence
          Length = 1689

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755683.1| Ephedra intermedia voucher (S) 04-483 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755682.1| Ephedra antisyphilitica voucher (S) 04-488 18S ribosomal RNA gene,
            partial sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755681.1| Ephedra minuta voucher (S) 04-486 18S ribosomal RNA gene, partial
            sequence
          Length = 1689

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755680.1| Ephedra minuta voucher (S) 04-485 18S ribosomal RNA gene, partial
            sequence
          Length = 1689

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755679.1| Ephedra chilensis voucher (E) E00130260 18S ribosomal RNA gene,
            partial sequence
          Length = 1689

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755678.1| Ephedra gerardiana voucher (E) E00130259 18S ribosomal RNA gene,
            partial sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755676.1| Ephedra californica voucher (O) 68-154 18S ribosomal RNA gene,
            partial sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755675.1| Ephedra sinica voucher (S) CRetoh 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755674.1| Ephedra frustillata voucher (K) 10218 18S ribosomal RNA gene, partial
            sequence
          Length = 1689

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755672.1| Ephedra monosperma voucher (K) 10142 18S ribosomal RNA gene, partial
            sequence
          Length = 1661

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755671.1| Ephedra gerardiana voucher (K) 10141 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755670.1| Ephedra andina voucher (K) 10140 18S ribosomal RNA gene, partial
            sequence
          Length = 1463

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1424 gtgtagcgcgcgtgcggcccagaacatctaagggc 1390



to top

>gb|AY755669.1| Ephedra frustillata voucher (S) 04-482 18S ribosomal RNA gene,
            partial sequence
          Length = 1689

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755668.1| Ephedra minuta voucher (S) 03-930 18S ribosomal RNA gene, partial
            sequence
          Length = 1462

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755667.1| Ephedra intermedia voucher (S) 03-925 18S ribosomal RNA gene, partial
            sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755666.1| Ephedra equisetina voucher (S) 03-928 18S ribosomal RNA gene, partial
            sequence
          Length = 1689

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755665.1| Ephedra likiangensis voucher (S) 03-926 18S ribosomal RNA gene,
            partial sequence
          Length = 1688

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1428 gtgtagcgcgcgtgcggcccagaacatctaagggc 1394



to top

>gb|AY755664.1| Gnetum montanum voucher (E) E00130261 18S ribosomal RNA gene, partial
            sequence
          Length = 1690

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1429 gtgtagcgcgcgtgcggcccagaacatctaagggc 1395



to top

>gb|AY755663.1| Gnetum indicum voucher (E) E00130257 18S ribosomal RNA gene, partial
            sequence
          Length = 1689

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1429 gtgtagcgcgcgtgcggcccagaacatctaagggc 1395



to top

>gb|AY755662.1| Gnetum parvifolium voucher (S) CRetoh 18S ribosomal RNA gene, partial
            sequence
          Length = 1690

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1429 gtgtagcgcgcgtgcggcccagaacatctaagggc 1395



to top

>gb|AY755661.1| Gnetum costatum voucher (K) 10219 18S ribosomal RNA gene, partial
            sequence
          Length = 1691

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1430 gtgtagcgcgcgtgcggcccagaacatctaagggc 1396



to top

>gb|AY755660.1| Gnetum gnemon voucher (S) 03-926 18S ribosomal RNA gene, partial
            sequence
          Length = 1691

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1430 gtgtagcgcgcgtgcggcccagaacatctaagggc 1396



to top

>gb|AY744286.1| Uncultured Leptosphaeriaceae clone Arch3573.1 18S ribosomal RNA
           gene, partial sequence; internal transcribed spacer 1,
           5.8S ribosomal RNA gene, and internal transcribed spacer
           2, complete sequence; and 28S ribosomal RNA gene,
           partial sequence
          Length = 987

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 131 gtgtagcgcgcgtgcggcccagaacatctaagggc 97



to top

>gb|AY744285.1| Uncultured mycorrhiza (Archaeosporaceae) clone Arch3538.1 18S
           ribosomal RNA gene, partial sequence; internal
           transcribed spacer 1, 5.8S ribosomal RNA gene, and
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 1007

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 134 gtgtagcgcgcgtgcggcccagaacatctaagggc 100



to top

>gb|AY744279.1| Uncultured glomeraceous AM fungus clone Glom3538.2 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 28S ribosomal RNA gene,
           partial sequence
          Length = 976

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 126 gtgtagcgcgcgtgcggcccagaacatctaagggc 92



to top

>gb|AY744278.1| Uncultured glomeraceous AM fungus clone Glom3524.1 18S ribosomal
           RNA gene, partial sequence; internal transcribed spacer
           1, 5.8S ribosomal RNA gene, and internal transcribed
           spacer 2, complete sequence; and 28S ribosomal RNA gene,
           partial sequence
          Length = 983

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 126 gtgtagcgcgcgtgcggcccagaacatctaagggc 92



to top

>gb|AY744277.1| Uncultured glomeraceous AM fungus clone Glom3523.1 18S ribosomal
           RNA gene, partial sequence; and internal transcribed
           spacer 1, complete sequence
          Length = 600

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 127 gtgtagcgcgcgtgcggcccagaacatctaagggc 93



to top

>gb|AY803753.1| Trechispora sp. PBM418 isolate AFTOL-ID 678 18S ribosomal RNA gene,
            complete sequence
          Length = 1789

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1472 gtgtagcgcgcgtgcggcccagaacatctaagggc 1438



to top

>gb|AY803752.1| Tilletiaria anomala isolate AFTOL-ID 865 18S ribosomal RNA gene,
            complete sequence
          Length = 1783

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1465 gtgtagcgcgcgtgcggcccagaacatctaagggc 1431



to top

>gb|AY676694.1| Syneta adamsi 18S ribosomal RNA gene, partial sequence
          Length = 1888

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1591 gtgtagcgcgcgtgcggcccagaacatctaagggc 1557



to top

>gb|AY676693.1| Polyoptilis sp. Sa02 18S ribosomal RNA gene, partial sequence
          Length = 1689

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1509 gtgtagcgcgcgtgcggcccagaacatctaagggc 1475



to top

>gb|AY676692.1| Sagra sp. Sa04 18S ribosomal RNA gene, partial sequence
          Length = 741

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 567 gtgtagcgcgcgtgcggcccagaacatctaagggc 533



to top

>gb|AY676691.1| Sagra sp. Sa03 18S ribosomal RNA gene, partial sequence
          Length = 1776

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1600 gtgtagcgcgcgtgcggcccagaacatctaagggc 1566



to top

>gb|AY676688.1| Lamprosoma sp. LP01 18S ribosomal RNA gene, partial sequence
          Length = 1865

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1585 gtgtagcgcgcgtgcggcccagaacatctaagggc 1551



to top

>gb|AY676686.1| Lema trilineata 18S ribosomal RNA gene, partial sequence
          Length = 1796

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1537 gtgtagcgcgcgtgcggcccagaacatctaagggc 1503



to top

>gb|AY676685.1| Ornithia sp. ORN01 18S ribosomal RNA gene, partial sequence
          Length = 1829

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                               
Query: 283  gtgtagcgcgcgtgcggcccagaacatctaagggc 317
            |||||||||||||||||||||||||||||||||||
Sbjct: 1571 gtgtagcgcgcgtgcggcccagaacatctaagggc 1537



to top

>gb|AY773761.1| Uncultured rhizosphere basidiomycete isolate Root.24.03 18S
           ribosomal RNA gene, partial sequence
          Length = 733

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 646 gtgtagcgcgcgtgcggcccagaacatctaagggc 612



to top

>gb|AY773760.1| Uncultured rhizosphere ascomycete isolate Root.24.02 18S ribosomal
           RNA gene, partial sequence
          Length = 708

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 626 gtgtagcgcgcgtgcggcccagaacatctaagggc 592



to top

>gb|AY773759.1| Uncultured rhizosphere ascomycete isolate Root.23.17 18S ribosomal
           RNA gene, partial sequence
          Length = 681

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 601 gtgtagcgcgcgtgcggcccagaacatctaagggc 567



to top

>gb|AY773758.1| Uncultured rhizosphere ascomycete isolate Root.23.12 18S ribosomal
           RNA gene, partial sequence
          Length = 716

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 636 gtgtagcgcgcgtgcggcccagaacatctaagggc 602



to top

>gb|AY773757.1| Uncultured rhizosphere ascomycete isolate Root.23.06 18S ribosomal
           RNA gene, partial sequence
          Length = 716

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 634 gtgtagcgcgcgtgcggcccagaacatctaagggc 600



to top

>gb|AY773754.1| Uncultured rhizosphere ascomycete isolate Root.23.02 18S ribosomal
           RNA gene, partial sequence
          Length = 724

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 644 gtgtagcgcgcgtgcggcccagaacatctaagggc 610



to top

>gb|AY773752.1| Uncultured rhizosphere ascomycete isolate Root.22.15 18S ribosomal
           RNA gene, partial sequence
          Length = 709

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 630 gtgtagcgcgcgtgcggcccagaacatctaagggc 596



to top

>gb|AY773750.1| Uncultured rhizosphere ascomycete isolate Root.22.07 18S ribosomal
           RNA gene, partial sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 635 gtgtagcgcgcgtgcggcccagaacatctaagggc 601



to top

>gb|AY773749.1| Uncultured rhizosphere basidiomycete isolate Root.22.06 18S
           ribosomal RNA gene, partial sequence
          Length = 733

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 645 gtgtagcgcgcgtgcggcccagaacatctaagggc 611



to top

>gb|AY773748.1| Uncultured rhizosphere basidiomycete isolate Root.22.01 18S
           ribosomal RNA gene, partial sequence
          Length = 733

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 645 gtgtagcgcgcgtgcggcccagaacatctaagggc 611



to top

>gb|AY773746.1| Uncultured rhizosphere ascomycete isolate Root.21.18 18S ribosomal
           RNA gene, partial sequence
          Length = 714

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 636 gtgtagcgcgcgtgcggcccagaacatctaagggc 602



to top

>gb|AY773745.1| Uncultured rhizosphere zygomycete isolate Root.21.15 18S ribosomal
           RNA gene, partial sequence
          Length = 732

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 650 gtgtagcgcgcgtgcggcccagaacatctaagggc 616



to top

>gb|AY773744.1| Uncultured rhizosphere basidiomycete isolate Root.21.11 18S
           ribosomal RNA gene, partial sequence
          Length = 734

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 646 gtgtagcgcgcgtgcggcccagaacatctaagggc 612



to top

>gb|AY773743.1| Uncultured rhizosphere basidiomycete isolate Root.21.09 18S
           ribosomal RNA gene, partial sequence
          Length = 733

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 646 gtgtagcgcgcgtgcggcccagaacatctaagggc 612



to top

>gb|AY773740.1| Uncultured rhizosphere basidiomycete isolate Root.20.11 18S
           ribosomal RNA gene, partial sequence
          Length = 735

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 646 gtgtagcgcgcgtgcggcccagaacatctaagggc 612



to top

>gb|AY773739.1| Uncultured rhizosphere basidiomycete isolate Root.20.03 18S
           ribosomal RNA gene, partial sequence
          Length = 734

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 646 gtgtagcgcgcgtgcggcccagaacatctaagggc 612



to top

>gb|AY773737.1| Uncultured rhizosphere basidiomycete isolate Root.19.10 18S
           ribosomal RNA gene, partial sequence
          Length = 723

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 636 gtgtagcgcgcgtgcggcccagaacatctaagggc 602



to top

>gb|AY773734.1| Uncultured rhizosphere ascomycete isolate Root.18.19 18S ribosomal
           RNA gene, partial sequence
          Length = 745

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 653 gtgtagcgcgcgtgcggcccagaacatctaagggc 619



to top

>gb|AY773733.1| Uncultured rhizosphere ascomycete isolate Root.18.14 18S ribosomal
           RNA gene, partial sequence
          Length = 714

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 636 gtgtagcgcgcgtgcggcccagaacatctaagggc 602



to top

>gb|AY773732.1| Uncultured rhizosphere ascomycete isolate Root.18.12 18S ribosomal
           RNA gene, partial sequence
          Length = 713

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 635 gtgtagcgcgcgtgcggcccagaacatctaagggc 601



to top

>gb|AY773731.1| Uncultured rhizosphere basidiomycete isolate Root.18.05 18S
           ribosomal RNA gene, partial sequence
          Length = 729

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 644 gtgtagcgcgcgtgcggcccagaacatctaagggc 610



to top

>gb|AY773730.1| Uncultured rhizosphere ascomycete isolate Root.18.04 18S ribosomal
           RNA gene, partial sequence
          Length = 717

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 636 gtgtagcgcgcgtgcggcccagaacatctaagggc 602



to top

>gb|AY773729.1| Uncultured rhizosphere ascomycete isolate Root.18.01 18S ribosomal
           RNA gene, partial sequence
          Length = 716

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 636 gtgtagcgcgcgtgcggcccagaacatctaagggc 602



to top

>gb|AY773728.1| Uncultured rhizosphere basidiomycete isolate Root.17.19 18S
           ribosomal RNA gene, partial sequence
          Length = 704

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 625 gtgtagcgcgcgtgcggcccagaacatctaagggc 591



to top

>gb|AY773727.1| Uncultured rhizosphere basidiomycete isolate Root.17.11 18S
           ribosomal RNA gene, partial sequence
          Length = 733

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 646 gtgtagcgcgcgtgcggcccagaacatctaagggc 612



to top

>gb|AY773726.1| Uncultured rhizosphere ascomycete isolate Root.17.09 18S ribosomal
           RNA gene, partial sequence
          Length = 706

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 627 gtgtagcgcgcgtgcggcccagaacatctaagggc 593



to top

>gb|AY773725.1| Uncultured rhizosphere ascomycete isolate Root.17.01 18S ribosomal
           RNA gene, partial sequence
          Length = 713

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 634 gtgtagcgcgcgtgcggcccagaacatctaagggc 600



to top

>gb|AY773723.1| Uncultured rhizosphere zygomycete isolate Root.16.03 18S ribosomal
           RNA gene, partial sequence
          Length = 731

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 650 gtgtagcgcgcgtgcggcccagaacatctaagggc 616



to top

>gb|AY773721.1| Uncultured rhizosphere ascomycete isolate Root.14.17 18S ribosomal
           RNA gene, partial sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 635 gtgtagcgcgcgtgcggcccagaacatctaagggc 601



to top

>gb|AY773720.1| Uncultured rhizosphere ascomycete isolate Root.14.14 18S ribosomal
           RNA gene, partial sequence
          Length = 747

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 655 gtgtagcgcgcgtgcggcccagaacatctaagggc 621



to top

>gb|AY773718.1| Uncultured rhizosphere zygomycete isolate Root.14.09 18S ribosomal
           RNA gene, partial sequence
          Length = 729

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 648 gtgtagcgcgcgtgcggcccagaacatctaagggc 614



to top

>gb|AY773717.1| Uncultured soil basidiomycete isolate Root.14.08 18S ribosomal RNA
           gene, partial sequence
          Length = 730

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 644 gtgtagcgcgcgtgcggcccagaacatctaagggc 610



to top

>gb|AY773716.1| Uncultured rhizosphere ascomycete isolate Root.14.01 18S ribosomal
           RNA gene, partial sequence
          Length = 712

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 635 gtgtagcgcgcgtgcggcccagaacatctaagggc 601



to top

>gb|AY773810.1| Uncultured soil ascomycete isolate Soil.24.19 18S ribosomal RNA
           gene, partial sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 635 gtgtagcgcgcgtgcggcccagaacatctaagggc 601



to top

>gb|AY773809.1| Uncultured soil ascomycete isolate Soil.24.11 18S ribosomal RNA
           gene, partial sequence
          Length = 746

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 652 gtgtagcgcgcgtgcggcccagaacatctaagggc 618



to top

>gb|AY773808.1| Uncultured soil ascomycete isolate Soil.23.20 18S ribosomal RNA
           gene, partial sequence
          Length = 727

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 641 gtgtagcgcgcgtgcggcccagaacatctaagggc 607



to top

>gb|AY773807.1| Uncultured soil zygomycete isolate Soil.22.07 18S ribosomal RNA
           gene, partial sequence
          Length = 728

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 647 gtgtagcgcgcgtgcggcccagaacatctaagggc 613



to top

>gb|AY773806.1| Uncultured soil ascomycete isolate Soil.20.18 18S ribosomal RNA
           gene, partial sequence
          Length = 717

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 635 gtgtagcgcgcgtgcggcccagaacatctaagggc 601



to top

>gb|AY773805.1| Uncultured soil ascomycete isolate Soil.20.04 18S ribosomal RNA
           gene, partial sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 634 gtgtagcgcgcgtgcggcccagaacatctaagggc 600



to top

>gb|AY773804.1| Uncultured soil ascomycete isolate Soil.20.02 18S ribosomal RNA
           gene, partial sequence
          Length = 707

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 629 gtgtagcgcgcgtgcggcccagaacatctaagggc 595



to top

>gb|AY773803.1| Uncultured soil ascomycete isolate Soil.19.19 18S ribosomal RNA
           gene, partial sequence
          Length = 737

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 645 gtgtagcgcgcgtgcggcccagaacatctaagggc 611



to top

>gb|AY773802.1| Uncultured soil ascomycete isolate Soil.19.18 18S ribosomal RNA
           gene, partial sequence
          Length = 737

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 643 gtgtagcgcgcgtgcggcccagaacatctaagggc 609



to top

>gb|AY773801.1| Uncultured soil basidiomycete isolate Soil.19.15 18S ribosomal RNA
           gene, partial sequence
          Length = 721

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 635 gtgtagcgcgcgtgcggcccagaacatctaagggc 601



to top

>gb|AY773800.1| Uncultured soil ascomycete isolate Soil.19.14 18S ribosomal RNA
           gene, partial sequence
          Length = 727

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 645 gtgtagcgcgcgtgcggcccagaacatctaagggc 611



to top

>gb|AY773798.1| Uncultured soil ascomycete isolate Soil.18.16 18S ribosomal RNA
           gene, partial sequence
          Length = 715

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 634 gtgtagcgcgcgtgcggcccagaacatctaagggc 600



to top

>gb|AY773797.1| Uncultured soil ascomycete isolate Soil.18.14 18S ribosomal RNA
           gene, partial sequence
          Length = 726

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 643 gtgtagcgcgcgtgcggcccagaacatctaagggc 609



to top

>gb|AY773796.1| Uncultured soil ascomycete isolate Soil.18.09 18S ribosomal RNA
           gene, partial sequence
          Length = 734

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 643 gtgtagcgcgcgtgcggcccagaacatctaagggc 609



to top

>gb|AY773795.1| Uncultured soil ascomycete isolate Soil.18.08 18S ribosomal RNA
           gene, partial sequence
          Length = 718

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 637 gtgtagcgcgcgtgcggcccagaacatctaagggc 603



to top

>gb|AY773794.1| Uncultured soil ascomycete isolate Soil.18.05 18S ribosomal RNA
           gene, partial sequence
          Length = 714

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 636 gtgtagcgcgcgtgcggcccagaacatctaagggc 602



to top

>gb|AY773792.1| Uncultured soil basidiomycete isolate Soil.17.19 18S ribosomal RNA
           gene, partial sequence
          Length = 744

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 653 gtgtagcgcgcgtgcggcccagaacatctaagggc 619



to top

>gb|AY773791.1| Uncultured soil ascomycete isolate Soil.17.18 18S ribosomal RNA
           gene, partial sequence
          Length = 712

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 634 gtgtagcgcgcgtgcggcccagaacatctaagggc 600



to top

>gb|AY773790.1| Uncultured soil ascomycete isolate Soil.17.16 18S ribosomal RNA
           gene, partial sequence
          Length = 734

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 642 gtgtagcgcgcgtgcggcccagaacatctaagggc 608



to top

>gb|AY773789.1| Uncultured soil ascomycete isolate Soil.17.14 18S ribosomal RNA
           gene, partial sequence
          Length = 713

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 634 gtgtagcgcgcgtgcggcccagaacatctaagggc 600



to top

>gb|AY773787.1| Uncultured soil ascomycete isolate Soil.17.03 18S ribosomal RNA
           gene, partial sequence
          Length = 718

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 638 gtgtagcgcgcgtgcggcccagaacatctaagggc 604



to top

>gb|AY773786.1| Uncultured soil basidiomycete isolate Soil.16.19 18S ribosomal RNA
           gene, partial sequence
          Length = 726

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 637 gtgtagcgcgcgtgcggcccagaacatctaagggc 603



to top

>gb|AY773785.1| Uncultured soil ascomycete isolate Soil.16.09 18S ribosomal RNA
           gene, partial sequence
          Length = 704

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 629 gtgtagcgcgcgtgcggcccagaacatctaagggc 595



to top

>gb|AY773784.1| Uncultured soil ascomycete isolate Soil.16.06 18S ribosomal RNA
           gene, partial sequence
          Length = 724

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 641 gtgtagcgcgcgtgcggcccagaacatctaagggc 607



to top

>gb|AY773781.1| Uncultured soil ascomycete isolate Soil.15.19 18S ribosomal RNA
           gene, partial sequence
          Length = 716

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 637 gtgtagcgcgcgtgcggcccagaacatctaagggc 603



to top

>gb|AY773780.1| Uncultured soil basidiomycete isolate Soil.15.14 18S ribosomal RNA
           gene, partial sequence
          Length = 732

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 647 gtgtagcgcgcgtgcggcccagaacatctaagggc 613



to top

>gb|AY773779.1| Uncultured soil ascomycete isolate Soil.15.13 18S ribosomal RNA
           gene, partial sequence
          Length = 737

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 645 gtgtagcgcgcgtgcggcccagaacatctaagggc 611



to top

>gb|AY773778.1| Uncultured soil basidiomycete isolate Soil.15.06 18S ribosomal RNA
           gene, partial sequence
          Length = 732

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 646 gtgtagcgcgcgtgcggcccagaacatctaagggc 612



to top

>gb|AY773777.1| Uncultured soil basidiomycete isolate Soil.15.02 18S ribosomal RNA
           gene, partial sequence
          Length = 733

 Score = 69.9 bits (35), Expect = 5e-09
 Identities = 35/35 (100%)
 Strand = Plus / Minus

                                              
Query: 283 gtgtagcgcgcgtgcggcccagaacatctaagggc 317
           |||||||||||||||||||||||||||||||||||
Sbjct: 646 gtgtagcgcgcgtgcggcccagaacatctaagggc 612


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 7,801,735
Number of Sequences: 3902068
Number of extensions: 7801735
Number of successful extensions: 321426
Number of sequences better than 10.0: 30060
Number of HSP's better than 10.0 without gapping: 29936
Number of HSP's successfully gapped in prelim test: 172
Number of HSP's that attempted gapping in prelim test: 261057
Number of HSP's gapped (non-prelim): 60323
length of query: 318
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 296
effective length of database: 17,147,199,772
effective search space: 5075571132512
effective search space used: 5075571132512
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top