ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd26g20
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 210 4e-51
2dbj|AP005799.3| Oryza sativa (japonica cultivar-group) genomic D... 210 4e-51
3gb|AY103795.1| Zea mays PCO133953 mRNA sequence 208 1e-50
4ref|XM_481003.1| Oryza sativa (japonica cultivar-group), mRNA 200 4e-48
5gb|L39120.1|MZEZMEA Zea mays nuclear-encoded mitochondrial F1F0 ... 180 3e-42
6gb|AY098513.1| Ananas comosus ATP synthase epsilon subunit mRNA,... 60 8e-06
7dbj|D14700.1|IPBF1ATPE Ipomoea batatas mRNA for F1-ATPase epsilo... 52 0.002
8gb|AC109586.2| Homo sapiens chromosome 3 clone CTD-2008P21, comp... 48 0.032
9gb|AC114653.11| Mus musculus chromosome 5, clone RP24-158G19, co... 46 0.13
10gb|BC077318.1| Xenopus laevis fused toes homolog (mouse), mRNA (... 46 0.13
11gb|BC100233.1| Xenopus laevis fused toes homolog (mouse), mRNA (... 46 0.13
12emb|AL008631.1|HS292F10 Human DNA sequence from clone RP1-292F10... 46 0.13
13dbj|AP000887.3| Homo sapiens genomic DNA, chromosome 6q25.2, clo... 46 0.13
14gb|AC118688.10| Mus musculus chromosome 5, clone RP23-302F24, co... 44 0.50
15gb|AC126693.3| Mus musculus BAC clone RP23-247E23 from chromosom... 44 0.50
16emb|AL033380.11|HS462C17 Human DNA sequence from clone RP3-462C1... 44 0.50
17emb|AL022336.1|HS78F24 Human DNA sequence from clone RP1-78F24 o... 44 0.50
18gb|AC078854.16| Homo sapiens 3q BAC RP11-480B17 (Roswell Park Ca... 44 0.50
19gb|AF453501.1| Actinosynnema pretiosum subsp. auranticum maytans... 44 0.50
20gb|AC073475.4| Homo sapiens BAC clone RP11-679C8 from 4, complet... 44 0.50
21emb|CR391943.6| Zebrafish DNA sequence from clone DKEY-15M21 in ... 44 0.50
22gb|AF288742.1|AF288742 Homo sapiens oxysterol binding protein 2 ... 44 0.50
23dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 44 0.50
24gb|AC154825.2| Mus musculus BAC clone RP24-540E16 from chromosom... 44 0.50
25dbj|AP005823.3| Oryza sativa (japonica cultivar-group) genomic D... 44 0.50
26dbj|AK106401.1| Oryza sativa (japonica cultivar-group) cDNA clon... 44 0.50
27gb|AC155271.1| Mus musculus BAC clone RP23-204F12 from 16, compl... 44 0.50
28emb|AL928546.5| Mouse DNA sequence from clone RP23-412C22 on chr... 44 0.50
29ref|NM_104043.2| Arabidopsis thaliana hydrogen-transporting ATP ... 42 2.0
30gb|AC109157.10| Mus musculus chromosome 7, clone RP24-169M16, co... 42 2.0
31ref|XM_479536.1| Oryza sativa (japonica cultivar-group), mRNA 42 2.0
32gb|AC153147.7| Mus musculus BAC clone RP23-205D14 from chromosom... 42 2.0
33gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome 42 2.0
34gb|BC052347.1| Mus musculus G kinase anchoring protein 1, mRNA (... 42 2.0
35ref|NM_019832.2| Mus musculus G kinase anchoring protein 1 (Gkap... 42 2.0
36gb|AC133906.9| Mus musculus chromosome 14, clone RP24-230P12, co... 42 2.0
37gb|AC163038.5| Mus musculus BAC clone RP23-180A14 from chromosom... 42 2.0
38gb|AC109308.8| Mus musculus chromosome 3, clone RP24-459K16, com... 42 2.0
39gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESR... 42 2.0
40emb|X60749.1|NGPILS6 N.gonorrhoeae pilS6 gene copies 1, 2 and 3 42 2.0
41gb|AC129302.3| Mus musculus BAC clone RP24-441C24 from chromosom... 42 2.0
42gb|AC091548.11| Mus musculus Strain C57BL6/J Chromosome 11 BAC, ... 42 2.0
43gb|AC121911.3| Mus musculus BAC clone RP24-181L3 from chromosome... 42 2.0
44gb|AC125215.4| Mus musculus BAC clone RP23-93K19 from 6, complet... 42 2.0
45gb|AC113598.8| Mus musculus chromosome 14, clone RP23-476N23, co... 42 2.0
46gb|AC160553.7| Mus musculus chromosome 7, clone RP23-334C12, com... 42 2.0
47emb|AL163285.2|HS21C085 Homo sapiens chromosome 21 segment HS21C085 42 2.0
48gb|AC160958.2| Mus musculus BAC clone RP24-224I13 from chromosom... 42 2.0
49emb|Z94161.5|HSN102C10 Human DNA sequence from clone LL22NC03-10... 42 2.0
50emb|AL359836.16| Human DNA sequence from clone RP11-389E6 on chr... 42 2.0
51emb|AL391071.1| Human DNA sequence from clone RP11-539A6 on chro... 42 2.0
52gb|AC091543.2| Felis catus clone RP86-588L5, complete sequence 42 2.0
53emb|AL353135.32| Human DNA sequence from clone RP11-63L7 on chro... 42 2.0
54emb|AL353133.7| Human DNA sequence from clone RP1-253B10 on chro... 42 2.0
55emb|AL160406.8| Human DNA sequence from clone RP3-493L23 on chro... 42 2.0
56gb|AC024935.34| Homo sapiens 12 BAC RP11-471G7 (Roswell Park Can... 42 2.0
57emb|X66832.1|NGMS11E3 N.gonorrhoeae (MS11-E3) pilE gene for pilin 42 2.0
58emb|X58403.1|NGPILE1 N.gonorrhoeae piLE1 gene for L-pilin (MS11-D1) 42 2.0
59emb|X52727.1|NGPIF6E N.gonorrhoeae P+ pilin mRNA (NGF6E) 42 2.0
60emb|AL591065.17| Mouse DNA sequence from clone RP23-199H17 on ch... 42 2.0
61gb|AC091606.8| Mus Musculus Strain C57BL6/J chromosome X BAC, RP... 42 2.0
62emb|AL954240.1| Pan troglodytes chromosome 22 clone PTB-045O21 m... 42 2.0
63emb|AL954239.1| Pan troglodytes chromosome 22 clone PTB-028I09 m... 42 2.0
64gb|AC026803.7| Homo sapiens chromosome 19 clone CTD-2639E6, comp... 42 2.0
65gb|AC148314.3| Pan troglodytes BAC clone CH251-527C13 from chrom... 42 2.0
66gb|AC154689.2| Mus musculus BAC clone RP24-329P8 from chromosome... 42 2.0
67gb|AY114540.1| Arabidopsis thaliana epsilon subunit of mitochond... 42 2.0
68gb|AC079630.18| Homo sapiens 12 BAC RP11-476D10 (Roswell Park Ca... 42 2.0
69dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete ... 42 2.0
70gb|AC104795.1| Homo sapiens BAC clone RP11-264O7 from 4, complet... 42 2.0
71dbj|AK140052.1| Mus musculus adult male corpora quadrigemina cDN... 42 2.0
72gb|AC108060.3| Homo sapiens BAC clone RP11-413M22 from 4, comple... 42 2.0
73gb|AC096634.2| Homo sapiens chromosome 1 clone RP11-66M7, comple... 42 2.0
74gb|AY072309.1| Arabidopsis thaliana epsilon subunit of mitochond... 42 2.0
75gb|AC153137.4| Mus musculus BAC clone RP23-471J16 from chromosom... 42 2.0
76gb|AC154437.2| Mus musculus BAC clone RP24-194D17 from chromosom... 42 2.0
77dbj|AK016588.1| Mus musculus adult male testis cDNA, RIKEN full-... 42 2.0
78gb|AC025294.14|AC025294 Arabidopsis thaliana chromosome 1 BAC F1... 42 2.0
79gb|AC025589.20|AC025589 Homo sapiens chromosome 3 clone RP11-175... 42 2.0
80dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
81emb|BX817143.1|CNS0ABQ5 Arabidopsis thaliana Full-length cDNA Co... 42 2.0
82emb|BX816985.1|CNS0ABQK Arabidopsis thaliana Full-length cDNA Co... 42 2.0
83emb|BX818026.1|CNS0AAX3 Arabidopsis thaliana Full-length cDNA Co... 42 2.0
84gb|AC155943.9| Mus musculus 10 BAC RP24-461P19 (Roswell Park Can... 42 2.0
85gb|AC161620.5| Pan troglodytes BAC clone CH251-232H7 from chromo... 42 2.0
86gb|AC020974.4|AC020974 Mus musculus chromosome 18 clone RP23-92D... 42 2.0
87gb|AC138200.10| Mus musculus chromosome 3, clone RP23-438J19, co... 42 2.0
88dbj|AP005243.4| Oryza sativa (japonica cultivar-group) genomic D... 42 2.0
89emb|AL731764.11| Mouse DNA sequence from clone RP23-75F12 on chr... 42 2.0
90dbj|AB023045.1| Arabidopsis thaliana genomic DNA, chromosome 3, ... 42 2.0
91emb|X52722.1|NGPIF69 N.gonorrhoeae P- pilin mRNA (NGF69) 42 2.0
92emb|X52720.1|NGPIF67 N.gonorrhoeae P- pilin mRNA (NGF67) 42 2.0
93emb|X52719.1|NGPIF66 N.gonorrhoeae P- pilin mRNA (NGF66) 42 2.0
94emb|X52718.1|NGPIF65 N. gonorrhoeae P- pilin mRNA (NGF65) 42 2.0
95emb|X52717.1|NGPIF64 N.gonorrhoeae P- pilin mRNA (NGF64) 42 2.0
96emb|X52716.1|NGPIF63 N.gonorrhoeae P- pilin mRNA (NGF63) 42 2.0
97emb|X52714.1|NGPIFG1 N.gonorrhoeae P- pilin mRNA (NGF61) 42 2.0
98emb|X54918.1|NGPILE61 N.gonorrhoeae mRNA for pilin expression lo... 42 2.0
99emb|X54919.1|NGPILE3 N.gonorrhoeae mRNA for pilin expression loc... 42 2.0
100gb|AC002476.1|AC002476 Human PAC clone RP1-318C15 from Xq23, com... 42 2.0
101dbj|AK102562.1| Oryza sativa (japonica cultivar-group) cDNA clon... 42 2.0
102emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl... 42 2.0
103gb|AC005871.3|AC005871 citb_109_p_11, complete sequence 42 2.0
104gb|AC005887.3|AC005887 citb_173_i_12, complete sequence 42 2.0
105gb|AC154846.2| Mus musculus BAC clone RP23-45E1 from 14, complet... 42 2.0
106gb|AC154667.2| Mus musculus BAC clone RP23-153F8 from 16, comple... 42 2.0
107gb|AC154671.2| Mus musculus BAC clone RP24-294I15 from 14, compl... 42 2.0
108gb|AC102858.11| Mus musculus chromosome 5, clone RP24-507F5, com... 42 2.0
109emb|CT025692.15| Mouse DNA sequence from clone RP23-312G18 on ch... 42 2.0
110gb|BC026801.1| Mus musculus angiotensin I converting enzyme (pep... 42 2.0
111dbj|AB053182.1| Mus musculus ACE2 mRNA for anigotensin-convertin... 42 2.0
112dbj|AB053181.1| Mus musculus ACE2 mRNA for anigotensin-convertin... 42 2.0
113gb|AC132911.12| Mus musculus chromosome 17, clone RP24-358A14, c... 42 2.0
114emb|AL773570.1|HS44C5 Homo sapiens chromosome 21 from cosmid LL2... 42 2.0
115emb|AL732539.6| Mouse DNA sequence from clone RP23-255E6 on chro... 42 2.0
116emb|AL773575.1|HS269A14 Homo sapiens chromosome 21 from PAC RP1-... 42 2.0
117emb|AL773578.1|HS265B9 Homo sapiens chromosome 21 from PAC RP1-2... 42 2.0
118gb|AC122394.5| Mus musculus BAC clone RP24-85N8 from 6, complete... 42 2.0
119gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete ge... 42 2.0
120emb|AL928553.8| Mouse DNA sequence from clone RP23-312N5 on chro... 42 2.0
121emb|AL845423.4| Mouse DNA sequence from clone RP23-207C2 on chro... 42 2.0
122emb|AL928739.5| Mouse DNA sequence from clone RP23-409L24 on chr... 42 2.0
123emb|AL671706.8| Mouse DNA sequence from clone RP23-330O24 on chr... 42 2.0
124emb|AL606914.9| Mouse DNA sequence from clone RP23-169H13 on chr... 42 2.0
125emb|AL626808.28| Mouse DNA sequence from clone RP23-383I7 on chr... 42 2.0
126dbj|AB033130.1| Mus musculus mRNA, complete cds, testis-specific... 42 2.0
127dbj|D88377.1| Arabidopsis thaliana mRNA for epsilon subunit of m... 42 2.0
128emb|AL731834.2| Sminthopsis DNA sequence from clone XX-202F9, co... 42 2.0
129emb|AL645851.8| Mouse DNA sequence from clone RP23-193A16 on chr... 42 2.0
130ref|NM_126180.3| Arabidopsis thaliana unknown protein AT2G01190 ... 40 7.8
131gb|AE010317.1| Methanopyrus kandleri AV19 section 16 of 157 of t... 40 7.8
132ref|XM_466660.1| Oryza sativa (japonica cultivar-group), mRNA 40 7.8
133ref|XM_449986.1| Oryza sativa (japonica cultivar-group), mRNA 40 7.8
134gb|AC153638.4| Mus musculus 6 BAC RP23-416H6 (Roswell Park Cance... 40 7.8
135gb|CP000081.1| Leishmania major chromosome 35, complete sequence 40 7.8
136gb|AY632760.1| Mycobacterium avium probable dipeptide-transport ... 40 7.8
137gb|AC102196.7| Mus musculus chromosome 3, clone RP24-445M20, com... 40 7.8
138ref|XM_867308.1| PREDICTED: Bos taurus hypothetical protein LOC5... 40 7.8
139ref|XM_865557.1| PREDICTED: Bos taurus hypothetical protein LOC6... 40 7.8
140ref|XM_598088.2| PREDICTED: Bos taurus similar to PR-domain zinc... 40 7.8
141gb|AE009252.1| Agrobacterium tumefaciens str. C58 linear chromos... 40 7.8
142gb|AE008361.1| Agrobacterium tumefaciens str. C58 linear chromos... 40 7.8
143gb|AC117577.16| Mus musculus chromosome 17, clone RP23-35F19, co... 40 7.8
144gb|AC159994.7| Mus musculus chromosome 7, clone RP23-368F23, com... 40 7.8
145gb|AF295719.1| Uncultured bacterium clone SR6 LigH-like protein ... 40 7.8
146gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 40 7.8
147gb|AC146613.3| Mus musculus BAC clone RP23-36P1 from chromosome ... 40 7.8
148gb|AC136513.2| Mus musculus BAC clone RP23-477N9 from chromosome... 40 7.8
149emb|CT009691.8| Zebrafish DNA sequence from clone CH73-64E1 in l... 40 7.8
150emb|CT009769.4| Mouse DNA sequence from clone RP23-44C21 on chro... 40 7.8
151ref|XM_747333.1| Aspergillus fumigatus Af293 nuclear localizatio... 40 7.8
152emb|CR931997.1| Corynebacterium jeikeium K411 complete genome 40 7.8
153gb|AC132470.3| Mus musculus BAC clone RP23-96F5 from chromosome ... 40 7.8
154gb|AC131722.4| Mus musculus BAC clone RP23-143M5 from chromosome... 40 7.8
155gb|BC019194.1| Mus musculus Luc7 homolog (S. cerevisiae)-like, m... 40 7.8
156gb|AF223537.1| Pancratium tenuifolium internal transcribed space... 40 7.8
157gb|AC122517.2| Mus musculus BAC clone RP24-459G24 from chromosom... 40 7.8
158ref|XM_797386.1| Trypanosoma cruzi strain CL Brener dispersed ge... 40 7.8
159ref|XM_799324.1| Trypanosoma cruzi strain CL Brener dispersed ge... 40 7.8
160ref|XM_801566.1| Trypanosoma cruzi strain CL Brener dispersed ge... 40 7.8
161ref|XM_801652.1| Trypanosoma cruzi strain CL Brener dispersed ge... 40 7.8
162gb|AC122320.4| Mus musculus BAC clone RP23-315F17 from 14, compl... 40 7.8
163gb|AC121824.2| Mus musculus BAC clone RP23-467P15 from 18, compl... 40 7.8
164gb|AF248865.4| Mycoplasma agalactiae conserved hypothetical prot... 40 7.8
165gb|AC092447.5| Homo sapiens BAC clone RP11-760D2 from 7, complet... 40 7.8
166gb|BC034135.1| Mus musculus Luc7 homolog (S. cerevisiae)-like, m... 40 7.8
167gb|AC102145.3| Mus musculus chromosome 6, clone RP23-302K3, comp... 40 7.8
168gb|AF067939.1| Caenorhabditis elegans fosmid H03G13, complete se... 40 7.8
169gb|AY376959.1| Litopenaeus vannamei microsatellite TUGAPv5-7.166... 40 7.8
170gb|BC055875.1| Mus musculus Luc7 homolog (S. cerevisiae)-like, m... 40 7.8
171ref|NM_001031767.1| Bos taurus hypothetical protein LOC533992 (L... 40 7.8
172emb|AL592144.5| Human DNA sequence from clone RP11-476B1 on chro... 40 7.8
173emb|AL353782.23| Human DNA sequence from clone RP11-207C11 on ch... 40 7.8
174gb|AY147900.1| Ovis aries T-cell receptor junction region Jgamma... 40 7.8
175gb|AC158151.4| Mus musculus chromosome 1, clone RP24-315B17, com... 40 7.8
176gb|AY195887.1| Mycoplasma agalactiae strain variant 627#3 Mar (m... 40 7.8
177gb|AC133216.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.8
178gb|AY070060.1| Arabidopsis thaliana unknown protein (At2g01190) ... 40 7.8
179emb|X61115.1|NTRNP33K6 N.tabacum mRNA for unknown chloroplast ri... 40 7.8
180emb|X58356.1|NSCHRNP33 N.sylvestris gene for 33kd chloroplast ri... 40 7.8
181emb|X53932.1|NTRNP33 Tobacco mRNA for 33 kDa chloroplast ribonuc... 40 7.8
182emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome 40 7.8
183emb|AL845326.5| Zebrafish DNA sequence from clone CH211-191D15 i... 40 7.8
184emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4,... 40 7.8
185emb|AL138647.1|ATF24G16 Arabidopsis thaliana DNA chromosome 3, B... 40 7.8
186emb|AJ494801.1|UBA494801 Uncultured bacterium partial FTHFS gene... 40 7.8
187emb|AJ494800.1|UBA494800 Uncultured bacterium partial FTHFS gene... 40 7.8
188emb|AJ494799.1|UBA494799 Uncultured bacterium partial FTHFS gene... 40 7.8
189emb|AJ494766.1|UBA494766 Uncultured bacterium partial FTHFS gene... 40 7.8
190emb|AJ276656.1|SAL276656 Sinapis alba chloroplast mRNA for sigma... 40 7.8
191emb|AL731818.6| Mouse DNA sequence from clone RP23-401L13 on chr... 40 7.8
192gb|AC115903.12| Mus musculus chromosome 1, clone RP24-472L18, co... 40 7.8
193gb|AE005726.1| Caulobacter crescentus CB15 section 52 of 359 of ... 40 7.8
194gb|AE005718.1| Caulobacter crescentus CB15 section 44 of 359 of ... 40 7.8
195gb|AC100832.2| Homo sapiens chromosome 17, clone RP11-579O24, co... 40 7.8
196gb|CP000133.1| Rhizobium etli CFN 42, complete genome 40 7.8
197gb|AC006200.3| Arabidopsis thaliana chromosome 2 clone F10A8 map... 40 7.8
198gb|AC067752.5| Homo sapiens chromosome 10 clone RP11-335G23, com... 40 7.8
199gb|AC025755.5| Homo sapiens chromosome 5 clone CTD-2045M21, comp... 40 7.8
200gb|AC182430.2| Pan troglodytes BAC clone CH251-398I16 from chrom... 40 7.8
201gb|AC090451.6| Homo sapiens chromosome 8, clone RP11-318N11, com... 40 7.8
202dbj|AK160293.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 40 7.8
203gb|AC099485.2| Homo sapiens chromosome 5 clone CTD-2008M24, comp... 40 7.8
204gb|DQ371653.1| Ceratocystis pirilliformis strain CMW6579 beta tu... 40 7.8
205gb|DQ371652.1| Ceratocystis pirilliformis strain CMW6569 beta tu... 40 7.8
206gb|DQ371651.1| Ceratocystis pirilliformis strain CMW6574 beta tu... 40 7.8
207gb|AC155709.5| Mus musculus 10 BAC RP24-200F4 (Roswell Park Canc... 40 7.8
208gb|AC159887.2| Mus musculus BAC clone RP24-249O13 from chromosom... 40 7.8
209gb|AC092495.2| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 7.8
210gb|AC134051.3| Homo sapiens chromosome 3 clone RP11-705F24, comp... 40 7.8
211dbj|AK010539.1| Mus musculus ES cells cDNA, RIKEN full-length en... 40 7.8
212gb|U55373.2| Caenorhabditis elegans cosmid F26F12, complete sequ... 40 7.8
213gb|AC138596.13| Mus musculus chromosome 1, clone RP24-287G17, co... 40 7.8
214gb|AC153359.4| Mus musculus BAC clone RP23-477I1 from chromosome... 40 7.8
215gb|AC026124.35| Homo sapiens 12 BAC RP11-305O6 (Roswell Park Can... 40 7.8
216gb|AC010088.4| Homo sapiens BAC clone RP11-289L7 from Y, complet... 40 7.8
217gb|BC109560.1| Bos taurus cDNA clone IMAGE:8051523, containing f... 40 7.8
218ref|NM_072122.3| Caenorhabditis elegans LEThal family member (le... 40 7.8
219gb|AF281817.1|AF281817 Tupaia herpesvirus strain 2, complete genome 40 7.8
220tpg|BK001744.1| TPA: TPA_exp: Suid herpesvirus 1, complete genome 40 7.8
221gb|AC148686.1| Macaca mulatta Major Histocompatibility Complex B... 40 7.8
222dbj|AK017655.1| Mus musculus 8 days embryo whole body cDNA, RIKE... 40 7.8
223gb|AC024950.3|AC024950 Mus musculus strain C57BL6/J chromosome 6... 40 7.8
224gb|AC158636.5| Mus musculus 10 BAC RP23-402A24 (Roswell Park Can... 40 7.8
225dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
226dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
227dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
228dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
229dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
230dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
231dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
232emb|BX572626.6| Mouse DNA sequence from clone RP24-408L19 on chr... 40 7.8
233emb|BX819177.1|CNS0AAF1 Arabidopsis thaliana Full-length cDNA Co... 40 7.8
234emb|BX821716.1|CNS0A7X9 Arabidopsis thaliana Full-length cDNA Co... 40 7.8
235emb|BX821235.1|CNS0A88D Arabidopsis thaliana Full-length cDNA Co... 40 7.8
236dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partia... 40 7.8
237gb|AC097372.3| Homo sapiens BAC clone RP11-6L6 from 4, complete ... 40 7.8
238gb|AF308445.1|AF308445 Caenorhabditis elegans LET-418 (let-418) ... 40 7.8
239gb|AC108204.5| Homo sapiens BAC clone RP11-77O12 from 4, complet... 40 7.8
240gb|AC097473.3| Homo sapiens BAC clone RP11-75N20 from 4, complet... 40 7.8
241gb|AC147317.3| Pan troglodytes BAC clone RP43-49P4 from chromoso... 40 7.8
242gb|AC093326.3| Homo sapiens BAC clone RP11-625N16 from 2, comple... 40 7.8
243gb|AC134230.2| Oryza sativa (japonica cultivar-group) chromosome... 40 7.8
244gb|AC005207.2| Homo sapiens chromosome 17, clone RP5-1081P3, com... 40 7.8
245dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, co... 40 7.8
246gb|AF112466.1| Mycoplasma agalactiae variable surface lipoprotei... 40 7.8
247ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P... 40 7.8
248gb|AY085774.1| Arabidopsis thaliana clone 17996 mRNA, complete s... 40 7.8
249gb|AE000783.1| Borrelia burgdorferi B31, complete genome 40 7.8
250gb|AC087856.6| Homo sapiens chromosome 8, clone RP11-4K16, compl... 40 7.8
251gb|AF212846.1|AF212846 Lactococcus lactis bacteriophage ul36.1 O... 40 7.8
252gb|AF212844.1|AF212844 Lactococcus lactis ORF111b (ORF111b), ORF... 40 7.8
253dbj|AP004299.2| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
254emb|AL672169.13| Mouse DNA sequence from clone RP23-357I18 on ch... 40 7.8
255dbj|AP005787.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
256dbj|AP003293.5| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
257dbj|AP003299.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
258dbj|AP003633.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
259gb|AC153884.1| Mus musculus 6 BAC RP23-476E22 (Roswell Park Can... 40 7.8
260dbj|AP006438.3| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
261dbj|AP004881.2| Oryza sativa (japonica cultivar-group) genomic D... 40 7.8
262emb|BX510916.7| Zebrafish DNA sequence from clone DKEY-208B17 in... 40 7.8
263gb|AF208055.1|AF208055 Bacteriophage phi31.1 Orf238 (orf238), Or... 40 7.8
264dbj|AK122155.1| Oryza sativa (japonica cultivar-group) cDNA clon... 40 7.8
265emb|AJ337319.1|HSA337319 Homo sapiens genomic sequence surroundi... 40 7.8
266gb|AC009514.2|AC009514 Homo sapiens chromosome 8 clone RP11-4K16... 40 7.8
267gb|AC114924.5| Mus musculus BAC clone RP23-424D3 from 18, comple... 40 7.8
268gb|AC115823.18| Mus musculus chromosome 5, clone RP23-422P4, com... 40 7.8
269gb|BT020730.1| Bos taurus hypothetical protein FLJ11259 (FLJ1125... 40 7.8
270gb|AC123709.9| Mus musculus chromosome 13, clone RP23-375O18, co... 40 7.8
271gb|BC089960.1| Rattus norvegicus LUC7-like (S. cerevisiae), mRNA... 40 7.8
272gb|AY785537.1| Arabidopsis thaliana At2g01200 gene, promoter region 40 7.8
273gb|AE016958.1| Mycobacterium avium subsp. paratuberculosis str. ... 40 7.8
274gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 40 7.8
275gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome... 40 7.8
276gb|AC160959.5| Mus musculus BAC clone RP24-230N7 from chromosome... 40 7.8
277emb|AL772415.6|CNS08C9T Oryza sativa chromosome 12, . BAC OSJNBa... 40 7.8
278ref|NM_001024269.1| Rattus norvegicus LUC7-like (S. cerevisiae) ... 40 7.8
279ref|NM_025881.1| Mus musculus Luc7 homolog (S. cerevisiae)-like ... 40 7.8
280ref|NM_028190.1| Mus musculus Luc7 homolog (S. cerevisiae)-like ... 40 7.8
281gb|AC132149.4| Mus musculus BAC clone RP23-10H23 from 3, complet... 40 7.8
282emb|CT025570.7| Mouse DNA sequence from clone RP24-82O4 on chrom... 40 7.8
283gb|AC140305.3| Mus musculus BAC clone RP23-425A11 from 6, comple... 40 7.8
284emb|CR759821.9| Zebrafish DNA sequence from clone DKEY-190C14 in... 40 7.8
285gb|AC117715.10| Mus musculus chromosome 7, clone RP23-62M19, com... 40 7.8
286dbj|AP004578.1| Lotus japonicus genomic DNA, chromosome 2, clone... 40 7.8
287emb|AL732538.6| Mouse DNA sequence from clone RP23-242O9 on chro... 40 7.8
288dbj|D00676.1|SH1RSP40 Suid herpesvirus 1 (strain KA) gene for OR... 40 7.8
289dbj|D10451.1|SH1PK Pseudorabies virus (PRV) protein kinase gene,... 40 7.8

>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, complete
               sequence
          Length = 28434780

 Score =  210 bits (106), Expect = 4e-51
 Identities = 169/190 (88%)
 Strand = Plus / Plus

                                                                           
Query: 163     ggcttctgctgcttctcgtcggtccacttggagagggagaagtggaccttctcgcgggag 222
               ||||||| ||||||  |||||| ||||||||||| || ||||||||||||||||||||||
Sbjct: 9173858 ggcttctcctgcttgccgtcggcccacttggagatggcgaagtggaccttctcgcgggag 9173917

                                                                           
Query: 223     gagagctcggtcttgaagggctccttgaggcagctccgcaccagcgccgcgcagacgttg 282
               | |  ||||| ||||  ||||||||||||||| |  |||||||| || ||||||||||||
Sbjct: 9173918 gcggcctcggacttgtggggctccttgaggcaccggcgcaccagggcggcgcagacgttg 9173977

                                                                           
Query: 283     gagtagccgatgtaggtcatccccgccgcacgccagaagggcaccgccgccgtcaccgcc 342
               ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||  ||||
Sbjct: 9173978 gagtagccgatgtaggtcatccccgccgcgcgccagaagggaaccgccgccgtcgtcgcc 9174037

                         
Query: 343     gacatcgtcg 352
               ||||||||||
Sbjct: 9174038 gacatcgtcg 9174047



to top

>dbj|AP005799.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, BAC
              clone:OSJNBa0012K14
          Length = 155544

 Score =  210 bits (106), Expect = 4e-51
 Identities = 169/190 (88%)
 Strand = Plus / Plus

                                                                          
Query: 163    ggcttctgctgcttctcgtcggtccacttggagagggagaagtggaccttctcgcgggag 222
              ||||||| ||||||  |||||| ||||||||||| || ||||||||||||||||||||||
Sbjct: 109352 ggcttctcctgcttgccgtcggcccacttggagatggcgaagtggaccttctcgcgggag 109411

                                                                          
Query: 223    gagagctcggtcttgaagggctccttgaggcagctccgcaccagcgccgcgcagacgttg 282
              | |  ||||| ||||  ||||||||||||||| |  |||||||| || ||||||||||||
Sbjct: 109412 gcggcctcggacttgtggggctccttgaggcaccggcgcaccagggcggcgcagacgttg 109471

                                                                          
Query: 283    gagtagccgatgtaggtcatccccgccgcacgccagaagggcaccgccgccgtcaccgcc 342
              ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||  ||||
Sbjct: 109472 gagtagccgatgtaggtcatccccgccgcgcgccagaagggaaccgccgccgtcgtcgcc 109531

                        
Query: 343    gacatcgtcg 352
              ||||||||||
Sbjct: 109532 gacatcgtcg 109541



to top

>gb|AY103795.1| Zea mays PCO133953 mRNA sequence
          Length = 665

 Score =  208 bits (105), Expect = 1e-50
 Identities = 165/185 (89%)
 Strand = Plus / Minus

                                                                       
Query: 151 gtgcgcacagtgggcttctgctgcttctcgtcggtccacttggagagggagaagtggacc 210
           ||||| ||||||||||||| ||| ||  | || ||||||||||||| |||||| ||||||
Sbjct: 302 gtgcggacagtgggcttctcctgtttgccatccgtccacttggagatggagaaatggacc 243

                                                                       
Query: 211 ttctcgcgggaggagagctcggtcttgaagggctccttgaggcagctccgcaccagcgcc 270
           ||||||||||| | |  ||||| |||||||||||||||||||||| |||| |||||||| 
Sbjct: 242 ttctcgcgggacgcggcctcggacttgaagggctccttgaggcagttccgtaccagcgca 183

                                                                       
Query: 271 gcgcagacgttggagtagccgatgtaggtcatccccgccgcacgccagaagggcaccgcc 330
           ||||||| ||||||||||||||||||||||||||| ||||| ||||||||||||||||||
Sbjct: 182 gcgcagatgttggagtagccgatgtaggtcatcccggccgcccgccagaagggcaccgcc 123

                
Query: 331 gccgt 335
           |||||
Sbjct: 122 gccgt 118



to top

>ref|XM_481003.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 315

 Score =  200 bits (101), Expect = 4e-48
 Identities = 164/185 (88%)
 Strand = Plus / Minus

                                                                       
Query: 163 ggcttctgctgcttctcgtcggtccacttggagagggagaagtggaccttctcgcgggag 222
           ||||||| ||||||  |||||| ||||||||||| || ||||||||||||||||||||||
Sbjct: 185 ggcttctcctgcttgccgtcggcccacttggagatggcgaagtggaccttctcgcgggag 126

                                                                       
Query: 223 gagagctcggtcttgaagggctccttgaggcagctccgcaccagcgccgcgcagacgttg 282
           | |  ||||| ||||  ||||||||||||||| |  |||||||| || ||||||||||||
Sbjct: 125 gcggcctcggacttgtggggctccttgaggcaccggcgcaccagggcggcgcagacgttg 66

                                                                       
Query: 283 gagtagccgatgtaggtcatccccgccgcacgccagaagggcaccgccgccgtcaccgcc 342
           ||||||||||||||||||||||||||||| ||||||||||| ||||||||||||  ||||
Sbjct: 65  gagtagccgatgtaggtcatccccgccgcgcgccagaagggaaccgccgccgtcgtcgcc 6

                
Query: 343 gacat 347
           |||||
Sbjct: 5   gacat 1



to top

>gb|L39120.1|MZEZMEA Zea mays nuclear-encoded mitochondrial F1F0 ATP synthase epsilon
           subunit (meatpase) mRNA, complete cds
          Length = 488

 Score =  180 bits (91), Expect = 3e-42
 Identities = 157/179 (87%)
 Strand = Plus / Minus

                                                                       
Query: 151 gtgcgcacagtgggcttctgctgcttctcgtcggtccacttggagagggagaagtggacc 210
           ||||| ||||| ||||||| ||||||  | || ||||||||||| | |||||| || |||
Sbjct: 272 gtgcggacagttggcttctcctgcttgccatccgtccacttggaaatggagaaatgaacc 213

                                                                       
Query: 211 ttctcgcgggaggagagctcggtcttgaagggctccttgaggcagctccgcaccagcgcc 270
           ||||||||||| | |  ||| | |||||||||||||||||||||| |||| |||||||| 
Sbjct: 212 ttctcgcgggacgcggcctcagacttgaagggctccttgaggcagttccggaccagcgca 153

                                                                      
Query: 271 gcgcagacgttggagtagccgatgtaggtcatccccgccgcacgccagaagggcaccgc 329
           ||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||
Sbjct: 152 gcgcagatgttggagtagccgatgtaggtcatccccgccgcccgccagaagggcaccgc 94



to top

>gb|AY098513.1| Ananas comosus ATP synthase epsilon subunit mRNA, complete cds
          Length = 711

 Score = 60.0 bits (30), Expect = 8e-06
 Identities = 110/134 (82%), Gaps = 2/134 (1%)
 Strand = Plus / Minus

                                                                       
Query: 201 gaagtggaccttctcgcgggaggagagc-tcggtcttgaagggctccttgaggcagctcc 259
           ||||||||||||||| |||||||  ||| |||| |||| |||||||||||||||||   |
Sbjct: 247 gaagtggaccttctcccgggaggc-agcgtcggccttgtagggctccttgaggcaggagc 189

                                                                       
Query: 260 gcaccagcgccgcgcagacgttggagtagccgatgtaggtcatccccgccgcacgccaga 319
           | |  || |  ||||||| ||||||||||   ||||| |||||||||||||| | |||||
Sbjct: 188 gtagaagggaggcgcagatgttggagtaggttatgtacgtcatccccgccgccctccaga 129

                         
Query: 320 agggcaccgccgcc 333
           | ||| ||||||||
Sbjct: 128 acggcgccgccgcc 115



to top

>dbj|D14700.1|IPBF1ATPE Ipomoea batatas mRNA for F1-ATPase epsilon-subunit, complete cds
          Length = 455

 Score = 52.0 bits (26), Expect = 0.002
 Identities = 29/30 (96%)
 Strand = Plus / Minus

                                         
Query: 190 ttggagagggagaagtggaccttctcgcgg 219
           ||||||| ||||||||||||||||||||||
Sbjct: 172 ttggagaaggagaagtggaccttctcgcgg 143



to top

>gb|AC109586.2| Homo sapiens chromosome 3 clone CTD-2008P21, complete sequence
          Length = 190170

 Score = 48.1 bits (24), Expect = 0.032
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                      
Query: 402    tagaatgctcttccttccctctct 425
              ||||||||||||||||||||||||
Sbjct: 119959 tagaatgctcttccttccctctct 119936



to top

>gb|AC114653.11| Mus musculus chromosome 5, clone RP24-158G19, complete sequence
          Length = 164313

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                             
Query: 356    cctccgcctcctctgcttcttttttcttctc 386
              ||||| |||||||| ||||||||||||||||
Sbjct: 113066 cctcctcctcctcttcttcttttttcttctc 113036



to top

>gb|BC077318.1| Xenopus laevis fused toes homolog (mouse), mRNA (cDNA clone
           MGC:80257 IMAGE:5073060), complete cds
          Length = 2256

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 445 cagatagggatggggaaatgggctttg 471
           |||||||||||||||| ||||||||||
Sbjct: 359 cagatagggatggggatatgggctttg 333



to top

>gb|BC100233.1| Xenopus laevis fused toes homolog (mouse), mRNA (cDNA clone
           MGC:115456 IMAGE:6325787), complete cds
          Length = 2529

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 26/27 (96%)
 Strand = Plus / Minus

                                      
Query: 445 cagatagggatggggaaatgggctttg 471
           |||||||||||||||| ||||||||||
Sbjct: 625 cagatagggatggggatatgggctttg 599



to top

>emb|AL008631.1|HS292F10 Human DNA sequence from clone RP1-292F10 on chromosome 6q25.1-26
             Contains part of the PARK2 gene for Parkinson disease
             (autosomal recessive, juvenile) 2, parkin (PDJ, PRKN,
             AR-JP), complete sequence
          Length = 115984

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 366   ctctgcttcttttttcttctctt 388
             |||||||||||||||||||||||
Sbjct: 23338 ctctgcttcttttttcttctctt 23316



to top

>dbj|AP000887.3| Homo sapiens genomic DNA, chromosome 6q25.2, clone:KB764F10
          Length = 120664

 Score = 46.1 bits (23), Expect = 0.13
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 366  ctctgcttcttttttcttctctt 388
            |||||||||||||||||||||||
Sbjct: 2091 ctctgcttcttttttcttctctt 2113



to top

>gb|AC118688.10| Mus musculus chromosome 5, clone RP23-302F24, complete sequence
          Length = 176001

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 371   cttcttttttcttctcttctct 392
             ||||||||||||||||||||||
Sbjct: 80730 cttcttttttcttctcttctct 80709



to top

>gb|AC126693.3| Mus musculus BAC clone RP23-247E23 from chromosome 16, complete
             sequence
          Length = 199505

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 385   tcttctctagggtagaatagaa 406
             ||||||||||||||||||||||
Sbjct: 30611 tcttctctagggtagaatagaa 30632



to top

>emb|AL033380.11|HS462C17 Human DNA sequence from clone RP3-462C17 on chromosome 6p21.1, complete
             sequence
          Length = 118112

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 99    tcaacaaacttctcagaacatc 120
             ||||||||||||||||||||||
Sbjct: 48316 tcaacaaacttctcagaacatc 48295



to top

>emb|AL022336.1|HS78F24 Human DNA sequence from clone RP1-78F24 on chromosome 22q12.1-12.3,
              complete sequence
          Length = 145414

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                    
Query: 371    cttcttttttcttctcttctct 392
              ||||||||||||||||||||||
Sbjct: 117188 cttcttttttcttctcttctct 117167



to top

>gb|AC078854.16| Homo sapiens 3q BAC RP11-480B17 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 162313

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                        
Query: 365    cctctgcttcttttttcttctcttct 390
              |||||||||||||| |||||||||||
Sbjct: 158743 cctctgcttcttttctcttctcttct 158768



to top

>gb|AF453501.1| Actinosynnema pretiosum subsp. auranticum maytansinoid antitumor agent
             ansamitocin biosynthetic gene cluster I, partial sequence
          Length = 82746

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 324   caccgccgccgtcaccgccgac 345
             ||||||||||||||||||||||
Sbjct: 28189 caccgccgccgtcaccgccgac 28168



to top

>gb|AC073475.4| Homo sapiens BAC clone RP11-679C8 from 4, complete sequence
          Length = 173005

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                   
Query: 371   cttcttttttcttctcttctct 392
             ||||||||||||||||||||||
Sbjct: 25666 cttcttttttcttctcttctct 25645



to top

>emb|CR391943.6| Zebrafish DNA sequence from clone DKEY-15M21 in linkage group 9, complete
              sequence
          Length = 212667

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 371    cttcttttttcttctcttctct 392
              ||||||||||||||||||||||
Sbjct: 126401 cttcttttttcttctcttctct 126422



 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 371    cttcttttttcttctcttctct 392
              ||||||||||||||||||||||
Sbjct: 126063 cttcttttttcttctcttctct 126084



to top

>gb|AF288742.1|AF288742 Homo sapiens oxysterol binding protein 2 (OSBP2) gene, complete cds
          Length = 217292

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 371   cttcttttttcttctcttctct 392
             ||||||||||||||||||||||
Sbjct: 43853 cttcttttttcttctcttctct 43874



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                      
Query: 348      cgtcgtcgcctccgcctcctct 369
                ||||||||||||||||||||||
Sbjct: 27789495 cgtcgtcgcctccgcctcctct 27789516



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                        
Query: 326      ccgccgccgtcaccgccgacatcg 349
                |||||||||||||||||| |||||
Sbjct: 23927621 ccgccgccgtcaccgccgccatcg 23927644



to top

>gb|AC154825.2| Mus musculus BAC clone RP24-540E16 from chromosome 16, complete
            sequence
          Length = 202988

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 385  tcttctctagggtagaatagaa 406
            ||||||||||||||||||||||
Sbjct: 3288 tcttctctagggtagaatagaa 3267



to top

>dbj|AP005823.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
             clone:P0663F07
          Length = 159046

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 348   cgtcgtcgcctccgcctcctct 369
             ||||||||||||||||||||||
Sbjct: 74828 cgtcgtcgcctccgcctcctct 74849



to top

>dbj|AK106401.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-G07, full
           insert sequence
          Length = 1599

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                 
Query: 348 cgtcgtcgcctccgcctcctct 369
           ||||||||||||||||||||||
Sbjct: 192 cgtcgtcgcctccgcctcctct 213



to top

>gb|AC155271.1| Mus musculus BAC clone RP23-204F12 from 16, complete sequence
          Length = 204679

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 385   tcttctctagggtagaatagaa 406
             ||||||||||||||||||||||
Sbjct: 57677 tcttctctagggtagaatagaa 57698



to top

>emb|AL928546.5| Mouse DNA sequence from clone RP23-412C22 on chromosome 2, complete
             sequence
          Length = 193834

 Score = 44.1 bits (22), Expect = 0.50
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 371   cttcttttttcttctcttctct 392
             ||||||||||||||||||||||
Sbjct: 30454 cttcttttttcttctcttctct 30475



to top

>ref|NM_104043.2| Arabidopsis thaliana hydrogen-transporting ATP synthase, rotational
           mechanism / hydrogen-transporting ATPase, rotational
           mechanism AT1G51650 mRNA, complete cds
          Length = 566

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 190 ttggagagggagaagtggaccttctcgcg 218
           |||||||| |||||||| |||||||||||
Sbjct: 220 ttggagagagagaagtgaaccttctcgcg 192



to top

>gb|AC109157.10| Mus musculus chromosome 7, clone RP24-169M16, complete sequence
          Length = 164968

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 124676 ttcttttttcttctcttctct 124656



to top

>ref|XM_479536.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1468

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 434 cgccgccgccgcagatagggatggg 458
           |||||||||||||| ||||||||||
Sbjct: 142 cgccgccgccgcagctagggatggg 118



to top

>gb|AC153147.7| Mus musculus BAC clone RP23-205D14 from chromosome 12, complete
             sequence
          Length = 206281

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 81323 ttcttttttcttctcttctct 81343



to top

>gb|CP000356.1| Sphingopyxis alaskensis RB2256, complete genome
          Length = 3345170

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 337     accgccgacatcgtcgtcgcc 357
               |||||||||||||||||||||
Sbjct: 1129492 accgccgacatcgtcgtcgcc 1129512



to top

>gb|BC052347.1| Mus musculus G kinase anchoring protein 1, mRNA (cDNA clone
           MGC:58237 IMAGE:6774715), complete cds
          Length = 1548

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 371 cttcttttttcttctcttctc 391
           |||||||||||||||||||||
Sbjct: 346 cttcttttttcttctcttctc 326



to top

>ref|NM_019832.2| Mus musculus G kinase anchoring protein 1 (Gkap1), mRNA
          Length = 1548

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 371 cttcttttttcttctcttctc 391
           |||||||||||||||||||||
Sbjct: 346 cttcttttttcttctcttctc 326



to top

>gb|AC133906.9| Mus musculus chromosome 14, clone RP24-230P12, complete sequence
          Length = 176220

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 368   ctgcttcttttttcttctcttctct 392
             ||||||||||| |||||||||||||
Sbjct: 37544 ctgcttcttttctcttctcttctct 37520



to top

>gb|AC163038.5| Mus musculus BAC clone RP23-180A14 from chromosome 13, complete sequence
          Length = 213865

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 371    cttcttttttcttctcttctc 391
              |||||||||||||||||||||
Sbjct: 182801 cttcttttttcttctcttctc 182821



to top

>gb|AC109308.8| Mus musculus chromosome 3, clone RP24-459K16, complete sequence
          Length = 133381

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 71442 ttcttttttcttctcttctct 71462



to top

>gb|AY528719.1| Homo sapiens estrogen-related receptor gamma (ESRRG) gene, complete cds
          Length = 590284

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 42013 ttcttttttcttctcttctct 42033



to top

>emb|X60749.1|NGPILS6 N.gonorrhoeae pilS6 gene copies 1, 2 and 3
          Length = 1026

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 322 ggcaccgccgccgtcaccgccgaca 346
           ||||||| |||||||||||||||||
Sbjct: 402 ggcaccgacgccgtcaccgccgaca 426



to top

>gb|AC129302.3| Mus musculus BAC clone RP24-441C24 from chromosome 2, complete sequence
          Length = 186647

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 164026 ttcttttttcttctcttctct 164006



to top

>gb|AC091548.11| Mus musculus Strain C57BL6/J Chromosome 11 BAC, RP23-193K14, complete
             sequence
          Length = 214157

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Plus

                                              
Query: 357   ctccgcctcctctgcttcttttttcttctcttc 389
             |||| |||||||| |||||| ||||||||||||
Sbjct: 47650 ctcctcctcctcttcttcttctttcttctcttc 47682



to top

>gb|AC121911.3| Mus musculus BAC clone RP24-181L3 from chromosome 1, complete sequence
          Length = 141695

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 72758 ttcttttttcttctcttctct 72778



to top

>gb|AC125215.4| Mus musculus BAC clone RP23-93K19 from 6, complete sequence
          Length = 215584

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 124522 ttcttttttcttctcttctct 124542



to top

>gb|AC113598.8| Mus musculus chromosome 14, clone RP23-476N23, complete sequence
          Length = 214461

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 19835 ttcttttttcttctcttctct 19815



to top

>gb|AC160553.7| Mus musculus chromosome 7, clone RP23-334C12, complete sequence
          Length = 191999

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 52474 ttcttttttcttctcttctct 52454



to top

>emb|AL163285.2|HS21C085 Homo sapiens chromosome 21 segment HS21C085
          Length = 340000

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 77188 ttcttttttcttctcttctct 77208



to top

>gb|AC160958.2| Mus musculus BAC clone RP24-224I13 from chromosome 13, complete sequence
          Length = 178784

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 157670 ttcttttttcttctcttctct 157690



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 365    cctctgcttcttttttcttctcttctct 392
              ||||||| |||| |||||||||||||||
Sbjct: 175318 cctctgcctcttctttcttctcttctct 175291



to top

>emb|Z94161.5|HSN102C10 Human DNA sequence from clone LL22NC03-102C10 on chromosome 22q13
             Contains the first exon of the PPARA gene for peroxisome
             proliferative activated receptor alpha, an EST, GSSs and a
             putative CpG island, complete sequence
          Length = 44134

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 28243 ttcttttttcttctcttctct 28263



to top

>emb|AL359836.16| Human DNA sequence from clone RP11-389E6 on chromosome 10 Contains the
             5' end of gene LOC118987 and a CpG island, complete
             sequence
          Length = 49052

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 47133 ttcttttttcttctcttctct 47153



to top

>emb|AL391071.1| Human DNA sequence from clone RP11-539A6 on chromosome Xq21.33-22.3
             Contains a novel gene, complete sequence
          Length = 82279

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 373   tcttttttcttctcttctcta 393
             |||||||||||||||||||||
Sbjct: 30035 tcttttttcttctcttctcta 30055



to top

>gb|AC091543.2| Felis catus clone RP86-588L5, complete sequence
          Length = 166752

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 20977 ttcttttttcttctcttctct 20957



to top

>emb|AL353135.32| Human DNA sequence from clone RP11-63L7 on chromosome 6 Contains the
              PROL2 gene for proline rich 2 (proline-rich protein with
              nuclear targeting signal), the gene for NB4
              apoptosis/differentiation related protein (PNAS-145), the
              gene for serine-arginine repressor protein (35kDa)
              (SRrp35), the gene for a novel protein similar to putative
              amidohydrolase, the 3' end of the GABRR1 gene for
              gamma-aminobutyric acid (GABA) receptor, rho 1 and 3 CpG
              islands, complete sequence
          Length = 127653

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 125265 ttcttttttcttctcttctct 125245



to top

>emb|AL353133.7| Human DNA sequence from clone RP1-253B10 on chromosome 6q14.3-16.1
             Contains a ribosomal protein L29 (RPL29) pseudogene and a
             novel pseudogene, complete sequence
          Length = 125527

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 96793 ttcttttttcttctcttctct 96773



to top

>emb|AL160406.8| Human DNA sequence from clone RP3-493L23 on chromosome 6, complete
             sequence
          Length = 60901

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 371   cttcttttttcttctcttctc 391
             |||||||||||||||||||||
Sbjct: 51182 cttcttttttcttctcttctc 51202



to top

>gb|AC024935.34| Homo sapiens 12 BAC RP11-471G7 (Roswell Park Cancer Institute Human BAC
             Library) complete sequence
          Length = 102102

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 362   cctcctctgcttcttttttcttctcttct 390
             ||||||||||| ||| |||||||||||||
Sbjct: 31617 cctcctctgctgcttctttcttctcttct 31589



to top

>emb|X66832.1|NGMS11E3 N.gonorrhoeae (MS11-E3) pilE gene for pilin
          Length = 510

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 322 ggcaccgccgccgtcaccgccgaca 346
           ||||||| |||||||||||||||||
Sbjct: 412 ggcaccgacgccgtcaccgccgaca 436



to top

>emb|X58403.1|NGPILE1 N.gonorrhoeae piLE1 gene for L-pilin (MS11-D1)
          Length = 1147

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 322 ggcaccgccgccgtcaccgccgaca 346
           ||||||| |||||||||||||||||
Sbjct: 547 ggcaccgacgccgtcaccgccgaca 571



to top

>emb|X52727.1|NGPIF6E N.gonorrhoeae P+ pilin mRNA (NGF6E)
          Length = 495

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 322 ggcaccgccgccgtcaccgccgaca 346
           ||||||| |||||||||||||||||
Sbjct: 397 ggcaccgacgccgtcaccgccgaca 421



to top

>emb|AL591065.17| Mouse DNA sequence from clone RP23-199H17 on chromosome 11 Contains the
              Myo18a gene for myosin XVIIIa, the Pipox gene for pipecolic
              acid oxidase, a novel gene (LOC327969), the 5' end of the
              Sez6 gene for seizure related gene 6 and two CpG islands,
              complete sequence
          Length = 220176

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 197488 ttcttttttcttctcttctct 197508



to top

>gb|AC091606.8| Mus Musculus Strain C57BL6/J chromosome X BAC, RP23-75P20, complete
              sequence
          Length = 234105

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                       
Query: 367    tctgcttcttttttcttctcttctc 391
              ||||||| |||||||||||||||||
Sbjct: 126523 tctgctttttttttcttctcttctc 126547



to top

>emb|AL954240.1| Pan troglodytes chromosome 22 clone PTB-045O21 map 22q22.2-q22.3,
             complete sequence
          Length = 164591

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 19477 ttcttttttcttctcttctct 19497



to top

>emb|AL954239.1| Pan troglodytes chromosome 22 clone PTB-028I09 map 22q22.2-q22.3,
              complete sequence
          Length = 141737

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 100423 ttcttttttcttctcttctct 100443



to top

>gb|AC026803.7| Homo sapiens chromosome 19 clone CTD-2639E6, complete sequence
          Length = 224271

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 69753 ttcttttttcttctcttctct 69733



to top

>gb|AC148314.3| Pan troglodytes BAC clone CH251-527C13 from chromosome 7, complete
             sequence
          Length = 172090

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 58964 ttcttttttcttctcttctct 58944



to top

>gb|AC154689.2| Mus musculus BAC clone RP24-329P8 from chromosome 14, complete sequence
          Length = 124803

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 368   ctgcttcttttttcttctcttctct 392
             ||||||||||| |||||||||||||
Sbjct: 35517 ctgcttcttttctcttctcttctct 35541



to top

>gb|AY114540.1| Arabidopsis thaliana epsilon subunit of mitochondrial F1-ATPase
           (At1g51650) mRNA, complete cds
          Length = 305

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 190 ttggagagggagaagtggaccttctcgcg 218
           |||||||| |||||||| |||||||||||
Sbjct: 155 ttggagagagagaagtgaaccttctcgcg 127



to top

>gb|AC079630.18| Homo sapiens 12 BAC RP11-476D10 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 178388

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 122470 ttcttttttcttctcttctct 122490



to top

>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome
          Length = 4967148

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                    
Query: 337     accgccgacatcgtcgtcgcc 357
               |||||||||||||||||||||
Sbjct: 2199094 accgccgacatcgtcgtcgcc 2199074



to top

>gb|AC104795.1| Homo sapiens BAC clone RP11-264O7 from 4, complete sequence
          Length = 178311

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 99     tcaacaaacttctcagaacat 119
              |||||||||||||||||||||
Sbjct: 141794 tcaacaaacttctcagaacat 141814



to top

>dbj|AK140052.1| Mus musculus adult male corpora quadrigemina cDNA, RIKEN
           full-length enriched library, clone:B230112M22
           product:cGMP-dependent protein kinase anchoring protein,
           full insert sequence
          Length = 1172

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 371 cttcttttttcttctcttctc 391
           |||||||||||||||||||||
Sbjct: 766 cttcttttttcttctcttctc 746



to top

>gb|AC108060.3| Homo sapiens BAC clone RP11-413M22 from 4, complete sequence
          Length = 138302

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 94323 ttcttttttcttctcttctct 94343



to top

>gb|AC096634.2| Homo sapiens chromosome 1 clone RP11-66M7, complete sequence
          Length = 163926

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 79609 ttcttttttcttctcttctct 79589



to top

>gb|AY072309.1| Arabidopsis thaliana epsilon subunit of mitochondrial F1-ATPase
           (At1g51650) mRNA, complete cds
          Length = 518

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 190 ttggagagggagaagtggaccttctcgcg 218
           |||||||| |||||||| |||||||||||
Sbjct: 220 ttggagagagagaagtgaaccttctcgcg 192



to top

>gb|AC153137.4| Mus musculus BAC clone RP23-471J16 from chromosome 1, complete sequence
          Length = 201668

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 148753 ttcttttttcttctcttctct 148773



to top

>gb|AC154437.2| Mus musculus BAC clone RP24-194D17 from chromosome 13, complete
            sequence
          Length = 180558

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 371  cttcttttttcttctcttctc 391
            |||||||||||||||||||||
Sbjct: 5182 cttcttttttcttctcttctc 5202



to top

>dbj|AK016588.1| Mus musculus adult male testis cDNA, RIKEN full-length enriched
           library, clone:4933400B15 product:42 kD cGMP-dependent
           protein kinase anchoring protein, full insert sequence
          Length = 1219

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 371 cttcttttttcttctcttctc 391
           |||||||||||||||||||||
Sbjct: 118 cttcttttttcttctcttctc 98



to top

>gb|AC025294.14|AC025294 Arabidopsis thaliana chromosome 1 BAC F19C24 genomic sequence, complete
             sequence
          Length = 124511

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Plus

                                          
Query: 190   ttggagagggagaagtggaccttctcgcg 218
             |||||||| |||||||| |||||||||||
Sbjct: 92893 ttggagagagagaagtgaaccttctcgcg 92921



to top

>gb|AC025589.20|AC025589 Homo sapiens chromosome 3 clone RP11-175F9, complete sequence
          Length = 172759

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 88388 ttcttttttcttctcttctct 88368



to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                         
Query: 434      cgccgccgccgcagatagggatggg 458
                |||||||||||||| ||||||||||
Sbjct: 28730220 cgccgccgccgcagctagggatggg 28730244



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 373      tcttttttcttctcttctct 392
                ||||||||||||||||||||
Sbjct: 17381599 tcttttttcttctcttctct 17381618



to top

>emb|BX817143.1|CNS0ABQ5 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH89ZE12 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1283

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 190 ttggagagggagaagtggaccttctcgcg 218
           |||||||| |||||||| |||||||||||
Sbjct: 197 ttggagagagagaagtgaaccttctcgcg 169



to top

>emb|BX816985.1|CNS0ABQK Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH7ZA08 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 1276

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 190 ttggagagggagaagtggaccttctcgcg 218
           |||||||| |||||||| |||||||||||
Sbjct: 198 ttggagagagagaagtgaaccttctcgcg 170



to top

>emb|BX818026.1|CNS0AAX3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL57ZE06 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 343

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 190 ttggagagggagaagtggaccttctcgcg 218
           |||||||| |||||||| |||||||||||
Sbjct: 42  ttggagagagagaagtgaaccttctcgcg 14



to top

>gb|AC155943.9| Mus musculus 10 BAC RP24-461P19 (Roswell Park Cancer Institute
             (C57BL/6J Male) Mouse BAC Library) complete sequence
          Length = 158911

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 31231 ttcttttttcttctcttctct 31211



to top

>gb|AC161620.5| Pan troglodytes BAC clone CH251-232H7 from chromosome unknown, complete
              sequence
          Length = 204271

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 186055 ttcttttttcttctcttctct 186035



to top

>gb|AC020974.4|AC020974 Mus musculus chromosome 18 clone RP23-92D17, complete sequence
          Length = 162639

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 10850 ttcttttttcttctcttctct 10870



to top

>gb|AC138200.10| Mus musculus chromosome 3, clone RP23-438J19, complete sequence
          Length = 183803

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 372  ttcttttttcttctcttctct 392
            |||||||||||||||||||||
Sbjct: 4186 ttcttttttcttctcttctct 4206



to top

>dbj|AP005243.4| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC
             clone:OJ1205_F02
          Length = 112862

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 434   cgccgccgccgcagatagggatggg 458
             |||||||||||||| ||||||||||
Sbjct: 37781 cgccgccgccgcagctagggatggg 37805



to top

>emb|AL731764.11| Mouse DNA sequence from clone RP23-75F12 on chromosome X, complete
             sequence
          Length = 190219

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 66536 ttcttttttcttctcttctct 66516



to top

>dbj|AB023045.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MXL8
          Length = 85599

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                          
Query: 190   ttggagagggagaagtggaccttctcgcg 218
             ||||||||||||||||| ||||| |||||
Sbjct: 23025 ttggagagggagaagtgaaccttgtcgcg 22997



to top

>emb|X52722.1|NGPIF69 N.gonorrhoeae P- pilin mRNA (NGF69)
          Length = 488

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 322 ggcaccgccgccgtcaccgccgaca 346
           ||||||| |||||||||||||||||
Sbjct: 396 ggcaccgacgccgtcaccgccgaca 420



to top

>emb|X52720.1|NGPIF67 N.gonorrhoeae P- pilin mRNA (NGF67)
          Length = 494

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 322 ggcaccgccgccgtcaccgccgaca 346
           ||||||| |||||||||||||||||
Sbjct: 396 ggcaccgacgccgtcaccgccgaca 420



to top

>emb|X52719.1|NGPIF66 N.gonorrhoeae P- pilin mRNA (NGF66)
          Length = 494

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 322 ggcaccgccgccgtcaccgccgaca 346
           ||||||| |||||||||||||||||
Sbjct: 396 ggcaccgacgccgtcaccgccgaca 420



to top

>emb|X52718.1|NGPIF65 N. gonorrhoeae P- pilin mRNA (NGF65)
          Length = 494

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 322 ggcaccgccgccgtcaccgccgaca 346
           ||||||| |||||||||||||||||
Sbjct: 396 ggcaccgacgccgtcaccgccgaca 420



to top

>emb|X52717.1|NGPIF64 N.gonorrhoeae P- pilin mRNA (NGF64)
          Length = 494

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 322 ggcaccgccgccgtcaccgccgaca 346
           ||||||| |||||||||||||||||
Sbjct: 396 ggcaccgacgccgtcaccgccgaca 420



to top

>emb|X52716.1|NGPIF63 N.gonorrhoeae P- pilin mRNA (NGF63)
          Length = 495

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 322 ggcaccgccgccgtcaccgccgaca 346
           ||||||| |||||||||||||||||
Sbjct: 396 ggcaccgacgccgtcaccgccgaca 420



to top

>emb|X52714.1|NGPIFG1 N.gonorrhoeae P- pilin mRNA (NGF61)
          Length = 494

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 322 ggcaccgccgccgtcaccgccgaca 346
           ||||||| |||||||||||||||||
Sbjct: 396 ggcaccgacgccgtcaccgccgaca 420



to top

>emb|X54918.1|NGPILE61 N.gonorrhoeae mRNA for pilin expression locus (pilE), L-pilin clone
           pLP61
          Length = 683

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 322 ggcaccgccgccgtcaccgccgaca 346
           ||||||| |||||||||||||||||
Sbjct: 397 ggcaccgacgccgtcaccgccgaca 421



to top

>emb|X54919.1|NGPILE3 N.gonorrhoeae mRNA for pilin expression locus (pilE), revertant 3
          Length = 369

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 322 ggcaccgccgccgtcaccgccgaca 346
           ||||||| |||||||||||||||||
Sbjct: 262 ggcaccgacgccgtcaccgccgaca 286



to top

>gb|AC002476.1|AC002476 Human PAC clone RP1-318C15 from Xq23, complete sequence
          Length = 147102

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 371    cttcttttttcttctcttctc 391
              |||||||||||||||||||||
Sbjct: 123401 cttcttttttcttctcttctc 123381



to top

>dbj|AK102562.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033097I23, full
           insert sequence
          Length = 1467

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 434 cgccgccgccgcagatagggatggg 458
           |||||||||||||| ||||||||||
Sbjct: 141 cgccgccgccgcagctagggatggg 117



to top

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 329   ccgccgtcaccgccgacatcgtcgt 353
             |||||||||||||||||||| ||||
Sbjct: 24343 ccgccgtcaccgccgacatcatcgt 24367



to top

>gb|AC005871.3|AC005871 citb_109_p_11, complete sequence
          Length = 186418

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 186344 ttcttttttcttctcttctct 186324



to top

>gb|AC005887.3|AC005887 citb_173_i_12, complete sequence
          Length = 120578

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 36603 ttcttttttcttctcttctct 36583



to top

>gb|AC154846.2| Mus musculus BAC clone RP23-45E1 from 14, complete sequence
          Length = 250542

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 75353 ttcttttttcttctcttctct 75373



to top

>gb|AC154667.2| Mus musculus BAC clone RP23-153F8 from 16, complete sequence
          Length = 195017

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 140376 ttcttttttcttctcttctct 140356



to top

>gb|AC154671.2| Mus musculus BAC clone RP24-294I15 from 14, complete sequence
          Length = 146499

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 37999 ttcttttttcttctcttctct 37979



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 371   cttcttttttcttctcttct 390
             ||||||||||||||||||||
Sbjct: 92662 cttcttttttcttctcttct 92643



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 371   cttcttttttcttctcttct 390
             ||||||||||||||||||||
Sbjct: 92637 cttcttttttcttctcttct 92618



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 371   cttcttttttcttctcttct 390
             ||||||||||||||||||||
Sbjct: 92609 cttcttttttcttctcttct 92590



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 371   cttcttttttcttctcttct 390
             ||||||||||||||||||||
Sbjct: 92340 cttcttttttcttctcttct 92321



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 371   cttcttttttcttctcttct 390
             ||||||||||||||||||||
Sbjct: 92315 cttcttttttcttctcttct 92296



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 371   cttcttttttcttctcttct 390
             ||||||||||||||||||||
Sbjct: 92287 cttcttttttcttctcttct 92268



to top

>gb|AC102858.11| Mus musculus chromosome 5, clone RP24-507F5, complete sequence
          Length = 176211

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 124727 ttcttttttcttctcttctct 124747



to top

>emb|CT025692.15| Mouse DNA sequence from clone RP23-312G18 on chromosome 17, complete
            sequence
          Length = 177741

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  ttcttttttcttctcttctct 392
            |||||||||||||||||||||
Sbjct: 4080 ttcttttttcttctcttctct 4060



to top

>gb|BC026801.1| Mus musculus angiotensin I converting enzyme (peptidyl-dipeptidase
           A) 2, mRNA (cDNA clone MGC:25940 IMAGE:4236529),
           complete cds
          Length = 2739

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 367 tctgcttcttttttcttctcttctc 391
           ||||||| |||||||||||||||||
Sbjct: 46  tctgctttttttttcttctcttctc 70



to top

>dbj|AB053182.1| Mus musculus ACE2 mRNA for anigotensin-converting enzyme-related
           carboxypeptidase, complete cds
          Length = 1993

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 367 tctgcttcttttttcttctcttctc 391
           ||||||| |||||||||||||||||
Sbjct: 57  tctgctttttttttcttctcttctc 81



to top

>dbj|AB053181.1| Mus musculus ACE2 mRNA for anigotensin-converting enzyme-related
           carboxypeptidase, complete cds
          Length = 2760

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                    
Query: 367 tctgcttcttttttcttctcttctc 391
           ||||||| |||||||||||||||||
Sbjct: 57  tctgctttttttttcttctcttctc 81



to top

>gb|AC132911.12| Mus musculus chromosome 17, clone RP24-358A14, complete sequence
          Length = 195993

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 135268 ttcttttttcttctcttctct 135248



to top

>emb|AL773570.1|HS44C5 Homo sapiens chromosome 21 from cosmid LL21NC02-44C5 map
             21q22.2,D21S349-MX1, complete sequence
          Length = 45566

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 25026 ttcttttttcttctcttctct 25046



to top

>emb|AL732539.6| Mouse DNA sequence from clone RP23-255E6 on chromosome 11 Contains the
             3' end of the Msi2h gene for Musashi homolog 2
             (Drosophila), an eukaryotic translation elongation factor
             2 (Eef2) pseudogene and a ribosomal protein L35a (Rpl35a)
             pseudogene, complete sequence
          Length = 216688

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 48288 ttcttttttcttctcttctct 48268



to top

>emb|AL773575.1|HS269A14 Homo sapiens chromosome 21 from PAC RP1-269A14 map 21q22.2,D21S349-MX1,
             complete sequence
          Length = 95846

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 91589 ttcttttttcttctcttctct 91609



to top

>emb|AL773578.1|HS265B9 Homo sapiens chromosome 21 from PAC RP1-265B9 map
            21q22.2,D21S349-MX1, complete sequence
          Length = 157662

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 372  ttcttttttcttctcttctct 392
            |||||||||||||||||||||
Sbjct: 3416 ttcttttttcttctcttctct 3436



to top

>gb|AC122394.5| Mus musculus BAC clone RP24-85N8 from 6, complete sequence
          Length = 215914

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 148122 ttcttttttcttctcttctct 148102



to top

>gb|AE017262.2| Listeria monocytogenes str. 4b F2365, complete genome
          Length = 2905187

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                        
Query: 365     cctctgcttcttttttcttctcttc 389
               ||||| |||||||||||||||||||
Sbjct: 1947648 cctcttcttcttttttcttctcttc 1947624



to top

>emb|AL928553.8| Mouse DNA sequence from clone RP23-312N5 on chromosome 2, complete
             sequence
          Length = 148202

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 38680 ttcttttttcttctcttctct 38700



to top

>emb|AL845423.4| Mouse DNA sequence from clone RP23-207C2 on chromosome 2, complete
            sequence
          Length = 97017

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 372  ttcttttttcttctcttctct 392
            |||||||||||||||||||||
Sbjct: 6942 ttcttttttcttctcttctct 6922



to top

>emb|AL928739.5| Mouse DNA sequence from clone RP23-409L24 on chromosome 2, complete
             sequence
          Length = 153028

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 372   ttcttttttcttctcttctct 392
             |||||||||||||||||||||
Sbjct: 68286 ttcttttttcttctcttctct 68306



to top

>emb|AL671706.8| Mouse DNA sequence from clone RP23-330O24 on chromosome X, complete
             sequence
          Length = 192676

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 24/25 (96%)
 Strand = Plus / Plus

                                      
Query: 367   tctgcttcttttttcttctcttctc 391
             ||||||| |||||||||||||||||
Sbjct: 21482 tctgctttttttttcttctcttctc 21506



to top

>emb|AL606914.9| Mouse DNA sequence from clone RP23-169H13 on chromosome 4, complete
             sequence
          Length = 197061

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 371   cttcttttttcttctcttctc 391
             |||||||||||||||||||||
Sbjct: 16799 cttcttttttcttctcttctc 16779



to top

>emb|AL626808.28| Mouse DNA sequence from clone RP23-383I7 on chromosome 4, complete
              sequence
          Length = 203992

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 372    ttcttttttcttctcttctct 392
              |||||||||||||||||||||
Sbjct: 151673 ttcttttttcttctcttctct 151653



to top

>dbj|AB033130.1| Mus musculus mRNA, complete cds, testis-specific gene
          Length = 1380

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 371 cttcttttttcttctcttctc 391
           |||||||||||||||||||||
Sbjct: 205 cttcttttttcttctcttctc 185



to top

>dbj|D88377.1| Arabidopsis thaliana mRNA for epsilon subunit of mitochondrial
           F1-ATPase, complete cds
          Length = 477

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 190 ttggagagggagaagtggaccttctcgcg 218
           |||||||| |||||||| |||||||||||
Sbjct: 198 ttggagagagagaagtgaaccttctcgcg 170



to top

>emb|AL731834.2| Sminthopsis DNA sequence from clone XX-202F9, complete sequence
          Length = 60585

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 371  cttcttttttcttctcttctc 391
            |||||||||||||||||||||
Sbjct: 4500 cttcttttttcttctcttctc 4520



to top

>emb|AL645851.8| Mouse DNA sequence from clone RP23-193A16 on chromosome 11, complete
             sequence
          Length = 112037

 Score = 42.1 bits (21), Expect = 2.0
 Identities = 30/33 (90%)
 Strand = Plus / Minus

                                              
Query: 357   ctccgcctcctctgcttcttttttcttctcttc 389
             |||| |||||||| |||||| ||||||||||||
Sbjct: 64382 ctcctcctcctcttcttcttctttcttctcttc 64350



to top

>ref|NM_126180.3| Arabidopsis thaliana unknown protein AT2G01190 mRNA, complete cds
          Length = 2555

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 371  cttcttttttcttctcttct 390
            ||||||||||||||||||||
Sbjct: 2303 cttcttttttcttctcttct 2322



to top

>gb|AE010317.1| Methanopyrus kandleri AV19 section 16 of 157 of the complete genome
          Length = 13319

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 338  ccgccgacatcgtcgtcgcc 357
            ||||||||||||||||||||
Sbjct: 3994 ccgccgacatcgtcgtcgcc 3975



to top

>ref|XM_466660.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 753

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 326 ccgccgccgtcaccgccgacatcg 349
           |||||||||||||||||| |||||
Sbjct: 305 ccgccgccgtcaccgccgccatcg 282



to top

>ref|XM_449986.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 642

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                           
Query: 327 cgccgccgtcaccgccgacatcgtcgtcgcct 358
           ||||||||||||| ||| || |||||||||||
Sbjct: 298 cgccgccgtcacccccgccaccgtcgtcgcct 329



to top

>gb|AC153638.4| Mus musculus 6 BAC RP23-416H6 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 171957

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 371   cttcttttttcttctcttct 390
             ||||||||||||||||||||
Sbjct: 66360 cttcttttttcttctcttct 66341



to top

>gb|CP000081.1| Leishmania major chromosome 35, complete sequence
          Length = 2090491

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 364    tcctctgcttcttttttctt 383
              ||||||||||||||||||||
Sbjct: 104598 tcctctgcttcttttttctt 104617



to top

>gb|AY632760.1| Mycobacterium avium probable dipeptide-transport ATP-binding
           protein ABC-transporter (dppD) gene, complete cds
          Length = 1656

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 338 ccgccgacatcgtcgtcgcctccg 361
           ||||||||||| ||||||||||||
Sbjct: 836 ccgccgacatcctcgtcgcctccg 859



to top

>gb|AC102196.7| Mus musculus chromosome 3, clone RP24-445M20, complete sequence
          Length = 166532

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 369   tgcttcttttttcttctcttctct 392
             |||||||||| |||||||||||||
Sbjct: 86370 tgcttcttttctcttctcttctct 86393



to top

>ref|XM_867308.1| PREDICTED: Bos taurus hypothetical protein LOC533992 (LOC533992),
            mRNA
          Length = 3526

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 312  acgccagaagggcaccgccg 331
            ||||||||||||||||||||
Sbjct: 1330 acgccagaagggcaccgccg 1311



to top

>ref|XM_865557.1| PREDICTED: Bos taurus hypothetical protein LOC614176 (LOC614176),
            mRNA
          Length = 2062

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 373  tcttttttcttctcttctct 392
            ||||||||||||||||||||
Sbjct: 1400 tcttttttcttctcttctct 1381



to top

>ref|XM_598088.2| PREDICTED: Bos taurus similar to PR-domain zinc finger protein 6
           (LOC519857), mRNA
          Length = 1401

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 205 tggaccttctcgcgggaggagagc 228
           |||||||||||||||||| |||||
Sbjct: 409 tggaccttctcgcgggagcagagc 432



to top

>gb|AE009252.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 22 of 187
             of the complete sequence
          Length = 14499

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 437   cgccgccgcagatagggatg 456
             ||||||||||||||||||||
Sbjct: 10419 cgccgccgcagatagggatg 10438



to top

>gb|AE008361.1| Agrobacterium tumefaciens str. C58 linear chromosome, section 165 of
            187 of the complete sequence
          Length = 12142

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 437  cgccgccgcagatagggatg 456
            ||||||||||||||||||||
Sbjct: 4167 cgccgccgcagatagggatg 4148



to top

>gb|AC117577.16| Mus musculus chromosome 17, clone RP23-35F19, complete sequence
          Length = 198548

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 365   cctctgcttcttttttcttctcttctct 392
             ||||||||||| || |||||||||||||
Sbjct: 33270 cctctgcttctcttctcttctcttctct 33297



to top

>gb|AC159994.7| Mus musculus chromosome 7, clone RP23-368F23, complete sequence
          Length = 181238

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 371   cttcttttttcttctcttct 390
             ||||||||||||||||||||
Sbjct: 34098 cttcttttttcttctcttct 34079



to top

>gb|AF295719.1| Uncultured bacterium clone SR6 LigH-like protein gene, partial cds
          Length = 1053

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 342 cgacatcgtcgtcgcctccg 361
           ||||||||||||||||||||
Sbjct: 186 cgacatcgtcgtcgcctccg 205



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 324      caccgccgccgtcaccgccg 343
                ||||||||||||||||||||
Sbjct: 11398842 caccgccgccgtcaccgccg 11398861



to top

>gb|AC146613.3| Mus musculus BAC clone RP23-36P1 from chromosome 18, complete sequence
          Length = 197939

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 373    tcttttttcttctcttctct 392
              ||||||||||||||||||||
Sbjct: 159539 tcttttttcttctcttctct 159520



to top

>gb|AC136513.2| Mus musculus BAC clone RP23-477N9 from chromosome 5, complete sequence
          Length = 188517

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 356   cctccgcctcctctgcttcttttttctt 383
             ||||| |||||||| |||||||||||||
Sbjct: 35800 cctcctcctcctcttcttcttttttctt 35827



to top

>emb|CT009691.8| Zebrafish DNA sequence from clone CH73-64E1 in linkage group 5,
             complete sequence
          Length = 99497

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 375   ttttttcttctcttctctag 394
             ||||||||||||||||||||
Sbjct: 62580 ttttttcttctcttctctag 62561



to top

>emb|CT009769.4| Mouse DNA sequence from clone RP23-44C21 on chromosome 9, complete
              sequence
          Length = 197074

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 356    cctccgcctcctctgcttcttttttctt 383
              ||||| |||||||| |||||||||||||
Sbjct: 169153 cctcctcctcctcttcttcttttttctt 169126



to top

>ref|XM_747333.1| Aspergillus fumigatus Af293 nuclear localization protein (Afu1g10600)
            partial mRNA
          Length = 2319

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 426  gctcgagacgccgccgccgc 445
            ||||||||||||||||||||
Sbjct: 1099 gctcgagacgccgccgccgc 1118



to top

>emb|CR931997.1| Corynebacterium jeikeium K411 complete genome
          Length = 2462499

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 226     agctcggtcttgaagggctc 245
               ||||||||||||||||||||
Sbjct: 1258784 agctcggtcttgaagggctc 1258803



to top

>gb|AC132470.3| Mus musculus BAC clone RP23-96F5 from chromosome 14, complete sequence
          Length = 206002

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                          
Query: 365    cctctgcttcttttttcttctcttctct 392
              ||||| ||||| ||||||||||||||||
Sbjct: 182986 cctctacttctcttttcttctcttctct 182959



to top

>gb|AC131722.4| Mus musculus BAC clone RP23-143M5 from chromosome 9, complete sequence
          Length = 228144

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 375    ttttttcttctcttctctag 394
              ||||||||||||||||||||
Sbjct: 173122 ttttttcttctcttctctag 173141



to top

>gb|BC019194.1| Mus musculus Luc7 homolog (S. cerevisiae)-like, mRNA (cDNA clone
           IMAGE:5035861), containing frame-shift errors
          Length = 1698

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 364 tcctctgcttcttttttctt 383
           ||||||||||||||||||||
Sbjct: 626 tcctctgcttcttttttctt 607



to top

>gb|AF223537.1| Pancratium tenuifolium internal transcribed spacer 1, 5.8S
           ribosomal RNA gene, and internal transcribed spacer 2,
           complete sequence
          Length = 645

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 348 cgtcgtcgcctccgcctcct 367
           ||||||||||||||||||||
Sbjct: 66  cgtcgtcgcctccgcctcct 85



to top

>gb|AC122517.2| Mus musculus BAC clone RP24-459G24 from chromosome 7, complete
            sequence
          Length = 186032

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 373  tcttttttcttctcttctct 392
            ||||||||||||||||||||
Sbjct: 8698 tcttttttcttctcttctct 8679



to top

>ref|XM_797386.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1
           (DGF-1) (Tc00.1047053509889.9) partial mRNA
          Length = 1747

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 324 caccgccgccgtcaccgccg 343
           ||||||||||||||||||||
Sbjct: 587 caccgccgccgtcaccgccg 606



to top

>ref|XM_799324.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1
            (DGF-1) (Tc00.1047053506645.9) partial mRNA
          Length = 5905

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 324  caccgccgccgtcaccgccg 343
            ||||||||||||||||||||
Sbjct: 1454 caccgccgccgtcaccgccg 1473



to top

>ref|XM_801566.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1
            (DGF-1) (Tc00.1047053506045.19) partial mRNA
          Length = 7005

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 324  caccgccgccgtcaccgccg 343
            ||||||||||||||||||||
Sbjct: 4955 caccgccgccgtcaccgccg 4974



to top

>ref|XM_801652.1| Trypanosoma cruzi strain CL Brener dispersed gene family protein 1
            (DGF-1) (Tc00.1047053511105.29) partial mRNA
          Length = 7036

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 324  caccgccgccgtcaccgccg 343
            ||||||||||||||||||||
Sbjct: 4952 caccgccgccgtcaccgccg 4971



to top

>gb|AC122320.4| Mus musculus BAC clone RP23-315F17 from 14, complete sequence
          Length = 197655

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 365    cctctgcttcttttttcttctcttctct 392
              ||||| ||||| ||||||||||||||||
Sbjct: 169640 cctctacttctcttttcttctcttctct 169667



to top

>gb|AC121824.2| Mus musculus BAC clone RP23-467P15 from 18, complete sequence
          Length = 195027

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 371   cttcttttttcttctcttct 390
             ||||||||||||||||||||
Sbjct: 69529 cttcttttttcttctcttct 69510



to top

>gb|AF248865.4| Mycoplasma agalactiae conserved hypothetical protein gene, partial
            cds; tRNA-Lys (trnL) gene, complete sequence; and
            integrase-recombinase (xer1), VpmaZ precursor (vpmaZ),
            VpmaU precursor (vpmaU), VpmaY precursor (vpmaY), VpmaX
            precursor (vpmaX), VpmaW precursor (vpmaW), and VpmaV
            precursor (vpmaV) genes, complete cds
          Length = 9981

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 367  tctgcttcttttttcttctcttct 390
            ||||||||||||||||||| ||||
Sbjct: 7022 tctgcttcttttttcttcttttct 6999



to top

>gb|AC092447.5| Homo sapiens BAC clone RP11-760D2 from 7, complete sequence
          Length = 176547

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 373    tcttttttcttctcttctct 392
              ||||||||||||||||||||
Sbjct: 131821 tcttttttcttctcttctct 131840



to top

>gb|BC034135.1| Mus musculus Luc7 homolog (S. cerevisiae)-like, mRNA (cDNA clone
           MGC:32167 IMAGE:5003664), complete cds
          Length = 1953

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 364 tcctctgcttcttttttctt 383
           ||||||||||||||||||||
Sbjct: 799 tcctctgcttcttttttctt 780



to top

>gb|AC102145.3| Mus musculus chromosome 6, clone RP23-302K3, complete sequence
          Length = 199882

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 365   cctctgcttcttttttcttctcttctct 392
             |||||||||||| | |||||||||||||
Sbjct: 18661 cctctgcttcttctctcttctcttctct 18688



to top

>gb|AF067939.1| Caenorhabditis elegans fosmid H03G13, complete sequence
          Length = 1931

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 369 tgcttcttttttcttctcttctct 392
           |||| |||||||||||||||||||
Sbjct: 978 tgctccttttttcttctcttctct 955



to top

>gb|AY376959.1| Litopenaeus vannamei microsatellite TUGAPv5-7.166 sequence
          Length = 334

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 27/28 (96%), Gaps = 1/28 (3%)
 Strand = Plus / Plus

                                       
Query: 366 ctctgcttct-tttttcttctcttctct 392
           |||||||||| |||||||||||||||||
Sbjct: 210 ctctgcttctctttttcttctcttctct 237



to top

>gb|BC055875.1| Mus musculus Luc7 homolog (S. cerevisiae)-like, mRNA (cDNA clone
            IMAGE:3962747), partial cds
          Length = 2684

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 364  tcctctgcttcttttttctt 383
            ||||||||||||||||||||
Sbjct: 1616 tcctctgcttcttttttctt 1597



to top

>ref|NM_001031767.1| Bos taurus hypothetical protein LOC533992 (LOC533992), mRNA
          Length = 2273

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 312 acgccagaagggcaccgccg 331
           ||||||||||||||||||||
Sbjct: 71  acgccagaagggcaccgccg 52



to top

>emb|AL592144.5| Human DNA sequence from clone RP11-476B1 on chromosome 1 Contains a novel
              gene, complete sequence
          Length = 197322

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 364    tcctctgcttcttttttctt 383
              ||||||||||||||||||||
Sbjct: 174913 tcctctgcttcttttttctt 174894



to top

>emb|AL353782.23| Human DNA sequence from clone RP11-207C11 on chromosome 9 Contains the
             5' end of the GPR51 gene for G protein-coupled receptor 51
             (HG20, GABBR2, GPRC3B, GABABR2), the 3' end of a novel
             gene (FLJ36928), a CDC10 cell division cycle 10 homolog
             (S. cerevisiae) (SEPT7) pseudogene and a CpG island,
             complete sequence
          Length = 165358

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 188   acttggagagggagaagtgg 207
             ||||||||||||||||||||
Sbjct: 54353 acttggagagggagaagtgg 54334



to top

>gb|AY147900.1| Ovis aries T-cell receptor junction region Jgamma5 gene, partial
            sequence
          Length = 7352

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 375  ttttttcttctcttctctag 394
            ||||||||||||||||||||
Sbjct: 4678 ttttttcttctcttctctag 4659



to top

>gb|AC158151.4| Mus musculus chromosome 1, clone RP24-315B17, complete sequence
          Length = 184935

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 371   cttcttttttcttctcttct 390
             ||||||||||||||||||||
Sbjct: 81362 cttcttttttcttctcttct 81381



to top

>gb|AY195887.1| Mycoplasma agalactiae strain variant 627#3 Mar (mar), AvgF (avgF),
            AvgD (avgD), AvgC (avgC), AvgB (avgB), AvgA (avgA), and
            AvgE (avgE) mRNAs, complete cds
          Length = 10176

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 367  tctgcttcttttttcttctcttct 390
            ||||||||||||||||||| ||||
Sbjct: 8193 tctgcttcttttttcttcttttct 8170



to top

>gb|AC133216.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone
             OSJNBb0049B20, complete sequence
          Length = 131337

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 347   tcgtcgtcgcctccgcctcc 366
             ||||||||||||||||||||
Sbjct: 56782 tcgtcgtcgcctccgcctcc 56763



to top

>gb|AY070060.1| Arabidopsis thaliana unknown protein (At2g01190) mRNA, complete cds
          Length = 2459

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 371  cttcttttttcttctcttct 390
            ||||||||||||||||||||
Sbjct: 2259 cttcttttttcttctcttct 2278



to top

>emb|X61115.1|NTRNP33K6 N.tabacum mRNA for unknown chloroplast ribonucleoprotein
          Length = 1250

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 454 atggggaaatgggctttgag 473
           ||||||||||||||||||||
Sbjct: 140 atggggaaatgggctttgag 121



to top

>emb|X58356.1|NSCHRNP33 N.sylvestris gene for 33kd chloroplast ribonucleoprotein
          Length = 4832

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 454  atggggaaatgggctttgag 473
            ||||||||||||||||||||
Sbjct: 1002 atggggaaatgggctttgag 983



to top

>emb|X53932.1|NTRNP33 Tobacco mRNA for 33 kDa chloroplast ribonucleoprotein
          Length = 1356

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 454 atggggaaatgggctttgag 473
           ||||||||||||||||||||
Sbjct: 195 atggggaaatgggctttgag 176



to top

>emb|CR626927.1| Bacteroides fragilis NCTC 9343, complete genome
          Length = 5205140

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 327     cgccgccgtcaccgccgaca 346
               ||||||||||||||||||||
Sbjct: 2056306 cgccgccgtcaccgccgaca 2056287



to top

>emb|AL845326.5| Zebrafish DNA sequence from clone CH211-191D15 in linkage group 5
             Contains a novel gene similar to mouse and Xenopus laevis
             CORO1A (coronin, actin binding protein 1A), three novel
             genes, a novel gene similar to human and mouse NIFU
             (nitrogen fixation cluster-like) and a CpG island,
             complete sequence
          Length = 143528

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 374   cttttttcttctcttctcta 393
             ||||||||||||||||||||
Sbjct: 35729 cttttttcttctcttctcta 35710



to top

>emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073L04,
             complete sequence
          Length = 143301

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 321   gggcaccgccgccgtcaccgccga 344
             |||||||||||||||| |||||||
Sbjct: 67796 gggcaccgccgccgtcgccgccga 67773



to top

>emb|AL138647.1|ATF24G16 Arabidopsis thaliana DNA chromosome 3, BAC clone F24G16
          Length = 100906

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 371   cttcttttttcttctcttct 390
             ||||||||||||||||||||
Sbjct: 86996 cttcttttttcttctcttct 87015



to top

>emb|AJ494801.1|UBA494801 Uncultured bacterium partial FTHFS gene for formyltetrahydrofolate
           synthetase clone SAL14
          Length = 1053

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 342 cgacatcgtcgtcgcctccg 361
           ||||||||||||||||||||
Sbjct: 186 cgacatcgtcgtcgcctccg 205



to top

>emb|AJ494800.1|UBA494800 Uncultured bacterium partial FTHFS gene for formyltetrahydrofolate
           synthetase clone SAL11
          Length = 1053

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 342 cgacatcgtcgtcgcctccg 361
           ||||||||||||||||||||
Sbjct: 186 cgacatcgtcgtcgcctccg 205



to top

>emb|AJ494799.1|UBA494799 Uncultured bacterium partial FTHFS gene for formyltetrahydrofolate
           synthetase clone SAL9
          Length = 1053

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 342 cgacatcgtcgtcgcctccg 361
           ||||||||||||||||||||
Sbjct: 186 cgacatcgtcgtcgcctccg 205



to top

>emb|AJ494766.1|UBA494766 Uncultured bacterium partial FTHFS gene for formyltetrahydrofolate
           synthetase clone JI15G
          Length = 1053

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 342 cgacatcgtcgtcgcctccg 361
           ||||||||||||||||||||
Sbjct: 186 cgacatcgtcgtcgcctccg 205



to top

>emb|AJ276656.1|SAL276656 Sinapis alba chloroplast mRNA for sigma factor 2 (sig2 gene)
          Length = 1929

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 156  cacagtgggcttctgctgct 175
            ||||||||||||||||||||
Sbjct: 1034 cacagtgggcttctgctgct 1053



to top

>emb|AL731818.6| Mouse DNA sequence from clone RP23-401L13 on chromosome 11 Contains two
             novel genes, the AI503894 gene for expressed sequence
             AI503894, a laminin receptor 1 (ribosomal protein
             SA)(Lamr1) pseudogene and a CpG island, complete sequence
          Length = 201664

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 371   cttcttttttcttctcttct 390
             ||||||||||||||||||||
Sbjct: 48886 cttcttttttcttctcttct 48867



to top

>gb|AC115903.12| Mus musculus chromosome 1, clone RP24-472L18, complete sequence
          Length = 125123

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 371   cttcttttttcttctcttct 390
             ||||||||||||||||||||
Sbjct: 66046 cttcttttttcttctcttct 66065



to top

>gb|AE005726.1| Caulobacter crescentus CB15 section 52 of 359 of the complete genome
          Length = 10094

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 326  ccgccgccgtcaccgccgac 345
            ||||||||||||||||||||
Sbjct: 7760 ccgccgccgtcaccgccgac 7779



to top

>gb|AE005718.1| Caulobacter crescentus CB15 section 44 of 359 of the complete genome
          Length = 10320

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 326  ccgccgccgtcaccgccgac 345
            ||||||||||||||||||||
Sbjct: 4519 ccgccgccgtcaccgccgac 4538



to top

>gb|AC100832.2| Homo sapiens chromosome 17, clone RP11-579O24, complete sequence
          Length = 190107

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 409  ctcttccttccctctctgct 428
            ||||||||||||||||||||
Sbjct: 7388 ctcttccttccctctctgct 7369



to top

>gb|CP000133.1| Rhizobium etli CFN 42, complete genome
          Length = 4381608

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 322     ggcaccgccgccgtcaccgc 341
               ||||||||||||||||||||
Sbjct: 4270046 ggcaccgccgccgtcaccgc 4270027



to top

>gb|AC006200.3| Arabidopsis thaliana chromosome 2 clone F10A8 map rga, complete
             sequence
          Length = 94029

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 371   cttcttttttcttctcttct 390
             ||||||||||||||||||||
Sbjct: 26984 cttcttttttcttctcttct 27003



to top

>gb|AC067752.5| Homo sapiens chromosome 10 clone RP11-335G23, complete sequence
          Length = 188453

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 372   ttcttttttcttctcttctc 391
             ||||||||||||||||||||
Sbjct: 20075 ttcttttttcttctcttctc 20056



to top

>gb|AC025755.5| Homo sapiens chromosome 5 clone CTD-2045M21, complete sequence
          Length = 111634

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 407  tgctcttccttccctctctg 426
            ||||||||||||||||||||
Sbjct: 4652 tgctcttccttccctctctg 4671



to top

>gb|AC182430.2| Pan troglodytes BAC clone CH251-398I16 from chromosome 4, complete
              sequence
          Length = 145600

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 374    cttttttcttctcttctcta 393
              ||||||||||||||||||||
Sbjct: 123049 cttttttcttctcttctcta 123030



to top

>gb|AC090451.6| Homo sapiens chromosome 8, clone RP11-318N11, complete sequence
          Length = 160671

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 365   cctctgcttcttttttcttctcttctct 392
             ||||| ||| ||||||||||||||||||
Sbjct: 59448 cctcttctttttttttcttctcttctct 59421



to top

>dbj|AK160293.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:5730587D06 product:Luc7 homolog
           (S. cerevisiae)-like, full insert sequence
          Length = 857

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 364 tcctctgcttcttttttctt 383
           ||||||||||||||||||||
Sbjct: 634 tcctctgcttcttttttctt 615



to top

>gb|AC099485.2| Homo sapiens chromosome 5 clone CTD-2008M24, complete sequence
          Length = 114624

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 407   tgctcttccttccctctctg 426
             ||||||||||||||||||||
Sbjct: 81829 tgctcttccttccctctctg 81848



to top

>gb|DQ371653.1| Ceratocystis pirilliformis strain CMW6579 beta tubulin gene,
           partial cds
          Length = 554

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 374 cttttttcttctcttctcta 393
           ||||||||||||||||||||
Sbjct: 247 cttttttcttctcttctcta 266



to top

>gb|DQ371652.1| Ceratocystis pirilliformis strain CMW6569 beta tubulin gene,
           partial cds
          Length = 554

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 374 cttttttcttctcttctcta 393
           ||||||||||||||||||||
Sbjct: 247 cttttttcttctcttctcta 266



to top

>gb|DQ371651.1| Ceratocystis pirilliformis strain CMW6574 beta tubulin gene,
           partial cds
          Length = 554

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 374 cttttttcttctcttctcta 393
           ||||||||||||||||||||
Sbjct: 247 cttttttcttctcttctcta 266



to top

>gb|AC155709.5| Mus musculus 10 BAC RP24-200F4 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 176109

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 373   tcttttttcttctcttctct 392
             ||||||||||||||||||||
Sbjct: 23841 tcttttttcttctcttctct 23822



to top

>gb|AC159887.2| Mus musculus BAC clone RP24-249O13 from chromosome 9, complete sequence
          Length = 160241

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 356   cctccgcctcctctgcttcttttttctt 383
             ||||| |||||||| |||||||||||||
Sbjct: 84817 cctcctcctcctcttcttcttttttctt 84844



to top

>gb|AC092495.2| Mus musculus strain C57BL6/J chromosome 6 clone RP23-73G15, complete
            sequence
          Length = 65584

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 371  cttcttttttcttctcttct 390
            ||||||||||||||||||||
Sbjct: 8788 cttcttttttcttctcttct 8769



to top

>gb|AC134051.3| Homo sapiens chromosome 3 clone RP11-705F24, complete sequence
          Length = 85615

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 402  tagaatgctcttccttccct 421
            ||||||||||||||||||||
Sbjct: 9122 tagaatgctcttccttccct 9103



to top

>dbj|AK010539.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library,
           clone:2410018D03 product:Luc7 homolog (S.
           cerevisiae)-like, full insert sequence
          Length = 1638

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 364 tcctctgcttcttttttctt 383
           ||||||||||||||||||||
Sbjct: 585 tcctctgcttcttttttctt 566



to top

>gb|U55373.2| Caenorhabditis elegans cosmid F26F12, complete sequence
          Length = 42467

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 369 tgcttcttttttcttctcttctct 392
           |||| |||||||||||||||||||
Sbjct: 847 tgctccttttttcttctcttctct 824



to top

>gb|AC138596.13| Mus musculus chromosome 1, clone RP24-287G17, complete sequence
          Length = 151611

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 371    cttcttttttcttctcttct 390
              ||||||||||||||||||||
Sbjct: 111946 cttcttttttcttctcttct 111927



to top

>gb|AC153359.4| Mus musculus BAC clone RP23-477I1 from chromosome 9, complete sequence
          Length = 195269

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 375    ttttttcttctcttctctag 394
              ||||||||||||||||||||
Sbjct: 159787 ttttttcttctcttctctag 159768



to top

>gb|AC026124.35| Homo sapiens 12 BAC RP11-305O6 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 181835

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 369    tgcttcttttttcttctcttctct 392
              |||||||| |||||||||||||||
Sbjct: 145493 tgcttcttgtttcttctcttctct 145470



to top

>gb|AC010088.4| Homo sapiens BAC clone RP11-289L7 from Y, complete sequence
          Length = 107687

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 364   tcctctgcttcttttttcttctcttctc 391
             |||||| ||||||||||||| |||||||
Sbjct: 72061 tcctcttcttcttttttcttttcttctc 72088



to top

>gb|BC109560.1| Bos taurus cDNA clone IMAGE:8051523, containing frame-shift errors
          Length = 832

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 371 cttcttttttcttctcttct 390
           ||||||||||||||||||||
Sbjct: 51  cttcttttttcttctcttct 32



to top

>ref|NM_072122.3| Caenorhabditis elegans LEThal family member (let-418) (let-418)
           mRNA, complete cds
          Length = 5685

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 369 tgcttcttttttcttctcttctct 392
           |||| |||||||||||||||||||
Sbjct: 733 tgctccttttttcttctcttctct 710



to top

>gb|AF281817.1|AF281817 Tupaia herpesvirus strain 2, complete genome
          Length = 195859

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 324   caccgccgccgtcaccgccg 343
             ||||||||||||||||||||
Sbjct: 11790 caccgccgccgtcaccgccg 11771



to top

>tpg|BK001744.1| TPA: TPA_exp: Suid herpesvirus 1, complete genome
          Length = 143461

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 324    caccgccgccgtcaccgccg 343
              ||||||||||||||||||||
Sbjct: 118041 caccgccgccgtcaccgccg 118060



to top

>gb|AC148686.1| Macaca mulatta Major Histocompatibility Complex BAC MMU192G09, complete
             sequence
          Length = 181166

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 373   tcttttttcttctcttctct 392
             ||||||||||||||||||||
Sbjct: 24498 tcttttttcttctcttctct 24517



to top

>dbj|AK017655.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length
           enriched library, clone:5730451A02 product:Luc7 homolog
           (S. cerevisiae)-like, full insert sequence
          Length = 1399

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 364 tcctctgcttcttttttctt 383
           ||||||||||||||||||||
Sbjct: 593 tcctctgcttcttttttctt 574



to top

>gb|AC024950.3|AC024950 Mus musculus strain C57BL6/J chromosome 6 clone RP23-208N9, complete
              sequence
          Length = 182382

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 371    cttcttttttcttctcttct 390
              ||||||||||||||||||||
Sbjct: 181592 cttcttttttcttctcttct 181573



to top

>gb|AC158636.5| Mus musculus 10 BAC RP23-402A24 (Roswell Park Cancer Institute
             (C57BL/6J Female) Mouse BAC Library) complete sequence
          Length = 191887

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 373   tcttttttcttctcttctct 392
             ||||||||||||||||||||
Sbjct: 92496 tcttttttcttctcttctct 92477



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 321      gggcaccgccgccgtcaccgccga 344
                |||||||||||||||| |||||||
Sbjct: 20337163 gggcaccgccgccgtcgccgccga 20337140



to top

>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete
                sequence
          Length = 27566993

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 373      tcttttttcttctcttctct 392
                ||||||||||||||||||||
Sbjct: 16046607 tcttttttcttctcttctct 16046626



to top

>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 347      tcgtcgtcgcctccgcctcc 366
                ||||||||||||||||||||
Sbjct: 27003494 tcgtcgtcgcctccgcctcc 27003475



to top

>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9,
              complete sequence
          Length = 22696651

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                              
Query: 327    cgccgccgtcaccgccgacatcgtcgtcgcct 358
              ||||||||||||| ||| || |||||||||||
Sbjct: 820470 cgccgccgtcacccccgccaccgtcgtcgcct 820439



to top

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                                
Query: 324      caccgccgccgtcaccgccgacatcgtcgtcg 355
                ||||||||||| |||||||| | |||||||||
Sbjct: 27215065 caccgccgccgccaccgccgccgtcgtcgtcg 27215096



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                    
Query: 324      caccgccgccgtcaccgccg 343
                ||||||||||||||||||||
Sbjct: 11395605 caccgccgccgtcaccgccg 11395624



to top

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                    
Query: 179      cgtcggtccacttggagagg 198
                ||||||||||||||||||||
Sbjct: 33771614 cgtcggtccacttggagagg 33771595



to top

>emb|BX572626.6| Mouse DNA sequence from clone RP24-408L19 on chromosome X, complete
              sequence
          Length = 155849

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 369    tgcttcttttttcttctcttctct 392
              |||||||||| |||||||||||||
Sbjct: 143311 tgcttcttttctcttctcttctct 143288



to top

>emb|BX819177.1|CNS0AAF1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB54ZB04 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 2511

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 371  cttcttttttcttctcttct 390
            ||||||||||||||||||||
Sbjct: 2300 cttcttttttcttctcttct 2319



to top

>emb|BX821716.1|CNS0A7X9 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL67ZH12 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 694

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 371 cttcttttttcttctcttct 390
           ||||||||||||||||||||
Sbjct: 614 cttcttttttcttctcttct 633



to top

>emb|BX821235.1|CNS0A88D Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL28ZA12 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 634

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 371 cttcttttttcttctcttct 390
           ||||||||||||||||||||
Sbjct: 414 cttcttttttcttctcttct 433



to top

>dbj|AB128049.1| Macaca mulatta genes, MHC class I region, partial and complete cds
          Length = 3284914

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 373    tcttttttcttctcttctct 392
              ||||||||||||||||||||
Sbjct: 812053 tcttttttcttctcttctct 812034



to top

>gb|AC097372.3| Homo sapiens BAC clone RP11-6L6 from 4, complete sequence
          Length = 163823

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 373    tcttttttcttctcttctct 392
              ||||||||||||||||||||
Sbjct: 159804 tcttttttcttctcttctct 159823



to top

>gb|AF308445.1|AF308445 Caenorhabditis elegans LET-418 (let-418) mRNA, complete cds
          Length = 5689

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 369 tgcttcttttttcttctcttctct 392
           |||| |||||||||||||||||||
Sbjct: 755 tgctccttttttcttctcttctct 732



to top

>gb|AC108204.5| Homo sapiens BAC clone RP11-77O12 from 4, complete sequence
          Length = 28395

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 374  cttttttcttctcttctcta 393
            ||||||||||||||||||||
Sbjct: 2392 cttttttcttctcttctcta 2373



to top

>gb|AC097473.3| Homo sapiens BAC clone RP11-75N20 from 4, complete sequence
          Length = 150573

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 23    tagtaaatataacaacatag 42
             ||||||||||||||||||||
Sbjct: 55962 tagtaaatataacaacatag 55981



to top

>gb|AC147317.3| Pan troglodytes BAC clone RP43-49P4 from chromosome 7, complete sequence
          Length = 196949

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 409    ctcttccttccctctctgct 428
              ||||||||||||||||||||
Sbjct: 173889 ctcttccttccctctctgct 173870



to top

>gb|AC093326.3| Homo sapiens BAC clone RP11-625N16 from 2, complete sequence
          Length = 188711

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 130  cctgatcttcattcctcatc 149
            ||||||||||||||||||||
Sbjct: 4272 cctgatcttcattcctcatc 4291



to top

>gb|AC134230.2| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0005J15,
              complete sequence
          Length = 159270

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 324    caccgccgccgtcaccgccg 343
              ||||||||||||||||||||
Sbjct: 107139 caccgccgccgtcaccgccg 107158



to top

>gb|AC005207.2| Homo sapiens chromosome 17, clone RP5-1081P3, complete sequence
          Length = 59412

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 409   ctcttccttccctctctgct 428
             ||||||||||||||||||||
Sbjct: 23092 ctcttccttccctctctgct 23111



to top

>dbj|BA000030.2| Streptomyces avermitilis MA-4680 genomic DNA, complete genome
          Length = 9025608

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 29/32 (90%)
 Strand = Plus / Plus

                                               
Query: 336     caccgccgacatcgtcgtcgcctccgcctcct 367
               ||||||||||| |||||||| | |||||||||
Sbjct: 4735594 caccgccgacaccgtcgtcgtccccgcctcct 4735625



 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 324    caccgccgccgtcaccgccgacat 347
              ||||||||||||||||| ||||||
Sbjct: 737051 caccgccgccgtcaccgtcgacat 737074



to top

>gb|AF112466.1| Mycoplasma agalactiae variable surface lipoprotein A (avgA) gene,
           complete cds
          Length = 666

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 367 tctgcttcttttttcttctcttct 390
           ||||||||||||||||||| ||||
Sbjct: 536 tctgcttcttttttcttcttttct 513



to top

>ref|NG_004755.1| Homo sapiens chromosome Y palindromes P1, P2, P3 and inverted repeat IR2
               (P1-P2-P3-IR2@) on chromosome Y
          Length = 4538292

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 364     tcctctgcttcttttttcttctcttctc 391
               |||||| ||||||||||||| |||||||
Sbjct: 1289335 tcctcttcttcttttttcttttcttctc 1289362



to top

>gb|AY085774.1| Arabidopsis thaliana clone 17996 mRNA, complete sequence
          Length = 2538

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 371  cttcttttttcttctcttct 390
            ||||||||||||||||||||
Sbjct: 2286 cttcttttttcttctcttct 2305



to top

>gb|AE000783.1| Borrelia burgdorferi B31, complete genome
          Length = 910724

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 368    ctgcttcttttttcttctct 387
              ||||||||||||||||||||
Sbjct: 851126 ctgcttcttttttcttctct 851107



to top

>gb|AC087856.6| Homo sapiens chromosome 8, clone RP11-4K16, complete sequence
          Length = 169060

 Score = 40.1 bits (20), Expect = 7.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 365   cctctgcttcttttttcttctcttctct 392
             ||||| ||| ||||||||||||||||||
Sbjct: 48173 cctcttctttttttttcttctcttctct 48200


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 6,584,576
Number of Sequences: 3902068
Number of extensions: 6584576
Number of successful extensions: 248122
Number of sequences better than 10.0: 289
Number of HSP's better than 10.0 without gapping: 290
Number of HSP's successfully gapped in prelim test: 1
Number of HSP's that attempted gapping in prelim test: 244146
Number of HSP's gapped (non-prelim): 3974
length of query: 577
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 554
effective length of database: 17,143,297,704
effective search space: 9497386928016
effective search space used: 9497386928016
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top