Clone Name | rbasd26g05 |
---|---|
Clone Library Name | barley_pub |
>gb|AF427791.1| Hordeum vulgare Mla locus, complete sequence Length = 261265 Score = 266 bits (134), Expect = 2e-68 Identities = 145/149 (97%) Strand = Plus / Plus Query: 1 agtttgtatctacatgcacaaagggcaagctcnaaaacactcgaaacaccaaatggtcta 60 ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| Sbjct: 135173 agtttgtatctacatgcacaaagtgcaagctccaaaacactcgaaacaccaaatggtcta 135232 Query: 61 caagacaataaggtccatgattacaggttggttggtccataaacgctagagagtcatcat 120 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 135233 caagacaataaggtccatgattacaggttggttggtccataaacgctggagagtcatcat 135292 Query: 121 gtccatgtgcatcaataagttgagtacct 149 ||||||||||||||||| ||||||||||| Sbjct: 135293 gtccatgtgcatcaataggttgagtacct 135321 Score = 266 bits (134), Expect = 2e-68 Identities = 145/149 (97%) Strand = Plus / Plus Query: 1 agtttgtatctacatgcacaaagggcaagctcnaaaacactcgaaacaccaaatggtcta 60 ||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||| Sbjct: 95460 agtttgtatctacatgcacaaagtgcaagctccaaaacactcgaaacaccaaatggtcta 95519 Query: 61 caagacaataaggtccatgattacaggttggttggtccataaacgctagagagtcatcat 120 ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| Sbjct: 95520 caagacaataaggtccatgattacaggttggttggtccataaacgctggagagtcatcat 95579 Query: 121 gtccatgtgcatcaataagttgagtacct 149 ||||||||||||||||| ||||||||||| Sbjct: 95580 gtccatgtgcatcaataggttgagtacct 95608
>gb|CP000237.1| Neorickettsia sennetsu strain Miyayama, complete genome Length = 859006 Score = 46.1 bits (23), Expect = 0.034 Identities = 23/23 (100%) Strand = Plus / Minus Query: 131 atcaataagttgagtaccttttt 153 ||||||||||||||||||||||| Sbjct: 814285 atcaataagttgagtaccttttt 814263
>ref|XM_644429.1| Entamoeba histolytica HM-1:IMSS exonuclease (293.t00010) partial mRNA Length = 1887 Score = 42.1 bits (21), Expect = 0.53 Identities = 27/29 (93%) Strand = Plus / Minus Query: 110 agagtcatcatgtccatgtgcatcaataa 138 |||| |||| ||||||||||||||||||| Sbjct: 1563 agagacatcttgtccatgtgcatcaataa 1535
>gb|AC010016.6| Drosophila melanogaster 3L BAC RP98-10M10 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 174616 Score = 40.1 bits (20), Expect = 2.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 aaaacactcgaaacaccaaa 53 |||||||||||||||||||| Sbjct: 16972 aaaacactcgaaacaccaaa 16991
>gb|AC010558.4| Drosophila melanogaster 3L BAC RPCI98-1K9 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 170356 Score = 40.1 bits (20), Expect = 2.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 aaaacactcgaaacaccaaa 53 |||||||||||||||||||| Sbjct: 135456 aaaacactcgaaacaccaaa 135475
>dbj|AB084515.1| Candida parapsilosis cpr-c1 gene for conjugated polyketone reductase C1, complete cds Length = 1480 Score = 40.1 bits (20), Expect = 2.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 aaaacactcgaaacaccaaa 53 |||||||||||||||||||| Sbjct: 633 aaaacactcgaaacaccaaa 652
>gb|AE003548.3| Drosophila melanogaster chromosome 3L, section 37 of 83 of the complete sequence Length = 244140 Score = 40.1 bits (20), Expect = 2.1 Identities = 20/20 (100%) Strand = Plus / Plus Query: 34 aaaacactcgaaacaccaaa 53 |||||||||||||||||||| Sbjct: 146741 aaaacactcgaaacaccaaa 146760
>gb|AC087833.3| Papio anubis clone RP41-78F4, complete sequence Length = 154295 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 51 aaatggtctacaagacaat 69 ||||||||||||||||||| Sbjct: 31944 aaatggtctacaagacaat 31926
>gb|DQ175301.1| Streptococcus pneumoniae isolate 95.1Ma00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175300.1| Streptococcus pneumoniae isolate 95.1In00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175299.1| Streptococcus pneumoniae isolate 95.1BR98S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175298.1| Streptococcus pneumoniae isolate 94.1Nd00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175297.1| Streptococcus pneumoniae isolate 73.1Tx98S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175296.1| Streptococcus pneumoniae isolate 720.4CH00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175295.1| Streptococcus pneumoniae isolate 720.3CH00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175294.1| Streptococcus pneumoniae isolate 720.1CH00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175293.1| Streptococcus pneumoniae isolate 72.1In00S topoisomerase IV subunit B (parE) gene, partial cds Length = 1608 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175292.1| Streptococcus pneumoniae isolate 71.1SW99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175291.1| Streptococcus pneumoniae isolate 700.1CH00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175290.1| Streptococcus pneumoniae isolate 687.1CH99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175289.1| Streptococcus pneumoniae isolate 68.1Wa00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175288.1| Streptococcus pneumoniae isolate 68.1SW99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175287.1| Streptococcus pneumoniae isolate 68.1PR00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175286.1| Streptococcus pneumoniae isolate 68.1AT98S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175285.1| Streptococcus pneumoniae isolate 672.1US00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175284.1| Streptococcus pneumoniae isolate 67.1JA00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175283.1| Streptococcus pneumoniae isolate 67.1FR92S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175282.1| Streptococcus pneumoniae isolate 638.3CH99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175281.1| Streptococcus pneumoniae isolate 638.2CH99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175280.1| Streptococcus pneumoniae isolate 636.1Ca99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175279.1| Streptococcus pneumoniae isolate 588.1JA99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175278.1| Streptococcus pneumoniae isolate 586.1CH99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175277.1| Streptococcus pneumoniae isolate 584.1Ca99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175276.1| Streptococcus pneumoniae isolate 582.1CH00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175275.1| Streptococcus pneumoniae isolate 581.1Ny99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175274.1| Streptococcus pneumoniae isolate 544.1Tx99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175273.1| Streptococcus pneumoniae isolate 543.1Ca99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175272.1| Streptococcus pneumoniae isolate 526.1Tx99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175271.1| Streptococcus pneumoniae isolate 524.1Ne00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175270.1| Streptococcus pneumoniae isolate 458.1JA00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175269.1| Streptococcus pneumoniae isolate 432.1JA00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175268.1| Streptococcus pneumoniae isolate 322.1JA98S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175267.1| Streptococcus pneumoniae isolate 319.2JA99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175266.1| Streptococcus pneumoniae isolate 319.1JA99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175265.1| Streptococcus pneumoniae isolate 319.1JA00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175264.1| Streptococcus pneumoniae isolate 294.1JA99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175263.1| Streptococcus pneumoniae isolate 292.1AT96S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175262.1| Streptococcus pneumoniae isolate 215.1Oh00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175261.1| Streptococcus pneumoniae isolate 136.1PL98S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175260.1| Streptococcus pneumoniae isolate 132.1US00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175259.1| Streptococcus pneumoniae isolate 132.1NY98S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175258.1| Streptococcus pneumoniae isolate 128.2Ca00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175257.1| Streptococcus pneumoniae isolate 0.7FR93S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175256.1| Streptococcus pneumoniae isolate 0.74Oh94S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175255.1| Streptococcus pneumoniae isolate 0.68Oh92S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175254.1| Streptococcus pneumoniae isolate 0.57SW99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175253.1| Streptococcus pneumoniae isolate 0.49SP94S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175252.1| Streptococcus pneumoniae isolate 0.47SP00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175251.1| Streptococcus pneumoniae isolate 0.45SL99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175250.1| Streptococcus pneumoniae isolate 0.34PL96S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175249.1| Streptococcus pneumoniae isolate 0.31JA99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175248.1| Streptococcus pneumoniae isolate 0.29JA98S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175247.1| Streptococcus pneumoniae isolate 0.19IS99S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175246.1| Streptococcus pneumoniae isolate 0.16GR98S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175245.1| Streptococcus pneumoniae isolate 0.15GR00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|DQ175244.1| Streptococcus pneumoniae isolate 0.14GE00S topoisomerase IV subunit B (parE) gene, complete cds Length = 1944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 1093 acctttttccttatggaaa 1111
>gb|AC109329.8| Homo sapiens chromosome 8, clone CTD-3107M8, complete sequence Length = 215644 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 150 ttttccttatggaaatctt 168 ||||||||||||||||||| Sbjct: 147689 ttttccttatggaaatctt 147707
>gb|AC123557.4| Mus musculus BAC clone RP23-183P22 from 1, complete sequence Length = 198349 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 150 ttttccttatggaaatctt 168 ||||||||||||||||||| Sbjct: 102292 ttttccttatggaaatctt 102274
>gb|AC119803.10| Mus musculus chromosome 6, clone RP23-124H21, complete sequence Length = 197762 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 7 tatctacatgcacaaaggg 25 ||||||||||||||||||| Sbjct: 139836 tatctacatgcacaaaggg 139854
>gb|AE016795.2| Vibrio vulnificus CMCP6 chromosome I complete sequence Length = 3281944 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 152 ttccttatggaaatcttat 170 ||||||||||||||||||| Sbjct: 800796 ttccttatggaaatcttat 800814
>emb|AL590731.12| Human DNA sequence from clone RP11-149M6 on chromosome 6, complete sequence Length = 149389 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 151 tttccttatggaaatctta 169 ||||||||||||||||||| Sbjct: 144527 tttccttatggaaatctta 144509
>emb|Z83832.1|ASSGT Avena sativa mRNA for UDP-glucose:sterol glucosyltransferase Length = 2317 Score = 38.2 bits (19), Expect = 8.3 Identities = 22/23 (95%) Strand = Plus / Minus Query: 148 ctttttccttatggaaatcttat 170 ||||||||||| ||||||||||| Sbjct: 456 ctttttccttacggaaatcttat 434
>emb|Z67739.2|SPPARCETP Streptococcus pneumoniae parC, parE and transposase genes and ORF DNA Length = 6812 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 2347 acctttttccttatggaaa 2365
>emb|X95717.1|SPPARECGN S.pneumoniae parE and parC genes Length = 3947 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 817 acctttttccttatggaaa 835
>gb|AC073531.22| Homo sapiens 12 BAC RP11-802J22 (Roswell Park Cancer Institute Human BAC Library) complete sequence Length = 212172 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 109 gagagtcatcatgtccatg 127 ||||||||||||||||||| Sbjct: 191909 gagagtcatcatgtccatg 191927
>dbj|BA000037.2| Vibrio vulnificus YJ016 DNA, chromosome I, complete sequence Length = 3354505 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 152 ttccttatggaaatcttat 170 ||||||||||||||||||| Sbjct: 340415 ttccttatggaaatcttat 340397
>gb|AE008451.1|AE008451 Streptococcus pneumoniae R6 section 67 of 184 of the complete genome Length = 10828 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 6992 acctttttccttatggaaa 7010
>gb|AC008282.4| Homo sapiens BAC clone RP11-516B14 from 2, complete sequence Length = 203241 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 5 tgtatctacatgcacaaag 23 ||||||||||||||||||| Sbjct: 83660 tgtatctacatgcacaaag 83678
>gb|AC022404.7|AC022404 Homo sapiens chromosome 14 clone CTD-2308C24 and RP11-757H14 map 14q31, complete sequence Length = 232309 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 150 ttttccttatggaaatctt 168 ||||||||||||||||||| Sbjct: 113870 ttttccttatggaaatctt 113888
>gb|AE005672.2| Streptococcus pneumoniae TIGR4, complete genome Length = 2160842 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Plus Query: 146 acctttttccttatggaaa 164 ||||||||||||||||||| Sbjct: 799429 acctttttccttatggaaa 799447
>gb|AC153853.4| Mus musculus BAC RP23-341J13 (Roswell Park Cancer Institute (C57BL/6J Female) Mouse BAC Library) complete sequence Length = 194037 Score = 38.2 bits (19), Expect = 8.3 Identities = 19/19 (100%) Strand = Plus / Minus Query: 7 tatctacatgcacaaaggg 25 ||||||||||||||||||| Sbjct: 77145 tatctacatgcacaaaggg 77127 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,249,852 Number of Sequences: 3902068 Number of extensions: 1249852 Number of successful extensions: 76930 Number of sequences better than 10.0: 81 Number of HSP's better than 10.0 without gapping: 81 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 76782 Number of HSP's gapped (non-prelim): 148 length of query: 170 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 148 effective length of database: 17,147,199,772 effective search space: 2537785566256 effective search space used: 2537785566256 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)