>gb|BC103733.1| Rattus norvegicus cDNA clone IMAGE:7365313
          Length = 3208

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 148 gctgcccaaaagcttgctgttttg 171
           |||||| |||||||||||||||||
Sbjct: 9   gctgcctaaaagcttgctgttttg 32

>ref|XM_947843.1| Theileria annulata strain Ankara prenyltransferase (TA07535)
           partial mRNA
          Length = 981

 Score = 40.1 bits (20), Expect = 2.4
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 84  aattgatgacgactccggta 103
           ||||||||||||||||||||
Sbjct: 627 aattgatgacgactccggta 646

>gb|AE017352.1| Cryptococcus neoformans var. neoformans JEC21 chromosome 12, complete
             sequence
          Length = 906719

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 116   ccgaacccccgttcacgac 134
             |||||||||||||||||||
Sbjct: 98547 ccgaacccccgttcacgac 98529

>gb|CP000017.1| Streptococcus pyogenes MGAS5005, complete genome
          Length = 1838554

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 161     ttgctgttttgatgtcatc 179
               |||||||||||||||||||
Sbjct: 1638213 ttgctgttttgatgtcatc 1638231

>gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome
          Length = 1899877

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 161     ttgctgttttgatgtcatc 179
               |||||||||||||||||||
Sbjct: 1689242 ttgctgttttgatgtcatc 1689260

>gb|AE006620.1| Streptococcus pyogenes M1 GAS, section 149 of 167 of the complete
            genome
          Length = 10586

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                               
Query: 161  ttgctgttttgatgtcatc 179
            |||||||||||||||||||
Sbjct: 3065 ttgctgttttgatgtcatc 3083

>gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome
          Length = 1937111

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 161     ttgctgttttgatgtcatc 179
               |||||||||||||||||||
Sbjct: 1723702 ttgctgttttgatgtcatc 1723720

>gb|CP000261.1| Streptococcus pyogenes MGAS2096, complete genome
          Length = 1860355

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 161     ttgctgttttgatgtcatc 179
               |||||||||||||||||||
Sbjct: 1655316 ttgctgttttgatgtcatc 1655334

>gb|CP000260.1| Streptococcus pyogenes MGAS10270, complete genome
          Length = 1928252

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 161     ttgctgttttgatgtcatc 179
               |||||||||||||||||||
Sbjct: 1694948 ttgctgttttgatgtcatc 1694966

>gb|CP000259.1| Streptococcus pyogenes MGAS9429, complete genome
          Length = 1836467

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 161     ttgctgttttgatgtcatc 179
               |||||||||||||||||||
Sbjct: 1631429 ttgctgttttgatgtcatc 1631447

>gb|CP000051.1| Chlamydia trachomatis A/HAR-13, complete genome
          Length = 1044459

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 142    acatctgctgcccaaaagc 160
              |||||||||||||||||||
Sbjct: 184138 acatctgctgcccaaaagc 184120

>gb|AC107667.12| Mus musculus chromosome 3, clone RP23-187C2, complete sequence
          Length = 229632

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 169    ttgatgtcatcctttgtca 187
              |||||||||||||||||||
Sbjct: 107251 ttgatgtcatcctttgtca 107233

>gb|AC122896.4| Mus musculus BAC clone RP23-69N8 from chromosome 10, complete sequence
          Length = 232473

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                 
Query: 167    ttttgatgtcatcctttgt 185
              |||||||||||||||||||
Sbjct: 166920 ttttgatgtcatcctttgt 166902

>ref|XM_567956.1| Cryptococcus neoformans var. neoformans JEC21 hypothetical protein
           (CNL04010) partial mRNA
          Length = 1149

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                              
Query: 116 ccgaacccccgttcacgac 134
           |||||||||||||||||||
Sbjct: 292 ccgaacccccgttcacgac 310

>gb|AC133207.3| Mus musculus BAC clone RP23-116L23 from chromosome 10, complete
            sequence
          Length = 222101

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 167  ttttgatgtcatcctttgt 185
            |||||||||||||||||||
Sbjct: 1043 ttttgatgtcatcctttgt 1025

>gb|AC131730.2| Mus musculus BAC clone RP23-115A5 from chromosome 5, complete sequence
          Length = 218708

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 142   acatctgctgcccaaaagc 160
             |||||||||||||||||||
Sbjct: 35842 acatctgctgcccaaaagc 35860

>gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome
          Length = 1897573

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 161     ttgctgttttgatgtcatc 179
               |||||||||||||||||||
Sbjct: 1668255 ttgctgttttgatgtcatc 1668273

>gb|AC087889.15| Mus Musculus Strain C57BL6/J Chromosome 10 BAC, RP23-337L15, Complete
             Sequence, complete sequence
          Length = 215756

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                                
Query: 167   ttttgatgtcatcctttgt 185
             |||||||||||||||||||
Sbjct: 62278 ttttgatgtcatcctttgt 62260

>gb|AC006965.3|AC006965 Homo sapiens PAC clone RP4-562J12 from Xq23, complete sequence
          Length = 132068

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 165  tgttttgatgtcatccttt 183
            |||||||||||||||||||
Sbjct: 7571 tgttttgatgtcatccttt 7553

>gb|AE014074.1| Streptococcus pyogenes MGAS315, complete genome
          Length = 1900521

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 161     ttgctgttttgatgtcatc 179
               |||||||||||||||||||
Sbjct: 1707810 ttgctgttttgatgtcatc 1707828

>dbj|BA000034.2| Streptococcus pyogenes SSI-1 DNA, complete genome
          Length = 1894275

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                  
Query: 161     ttgctgttttgatgtcatc 179
               |||||||||||||||||||
Sbjct: 1701596 ttgctgttttgatgtcatc 1701614

>emb|AJ488940.1|SPY488940 Streptococcus pyogenes pulA gene for pullulanase
          Length = 3498

 Score = 38.2 bits (19), Expect = 9.4
 Identities = 19/19 (100%)
 Strand = Plus / Minus

                               
Query: 161  ttgctgttttgatgtcatc 179
            |||||||||||||||||||
Sbjct: 1543 ttgctgttttgatgtcatc 1525


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,117,301
Number of Sequences: 3902068
Number of extensions: 1117301
Number of successful extensions: 71783
Number of sequences better than 10.0: 22
Number of HSP's better than 10.0 without gapping: 22
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 71589
Number of HSP's gapped (non-prelim): 194
length of query: 190
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 168
effective length of database: 17,147,199,772
effective search space: 2880729561696
effective search space used: 2880729561696
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)