Clone Name	rbasd25p01
Clone Library Name	barley_pub

---

No.	Definition	Score (bits)	E Value
1	gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic prote...	448	e-123
2	gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intr...	446	e-122
3	gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic prote...	444	e-121
4	gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic prote...	440	e-120
5	dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic D...	331	1e-87
6	dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic D...	331	1e-87
7	dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic D...	331	1e-87
8	dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clon...	331	1e-87
9	dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clon...	331	1e-87
10	dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clon...	331	1e-87
11	dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clon...	331	1e-87
12	dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clon...	331	1e-87
13	dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clon...	331	1e-87
14	dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clon...	323	3e-85
15	dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clon...	323	3e-85
16	gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral prot...	200	3e-48
17	gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral prot...	190	3e-45
18	gb|AY105015.1| Zea mays PCO137646 mRNA sequence	190	3e-45
19	ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA	182	6e-43
20	dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D...	182	6e-43
21	dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic D...	182	6e-43
22	dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic D...	182	6e-43
23	dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mR...	182	6e-43
24	dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clon...	182	6e-43
25	emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chro...	182	6e-43
26	gb|AY106931.1| Zea mays PCO140073 mRNA sequence	159	9e-36
27	gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRN...	159	9e-36
28	gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds	151	2e-33
29	gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral prot...	151	2e-33
30	gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic prote...	137	3e-29
31	ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predic...	135	1e-28
32	emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4,...	135	1e-28
33	dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D...	135	1e-28
34	emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein	131	2e-27
35	emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein	131	2e-27
36	gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intr...	113	5e-22
37	emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative...	111	2e-21
38	ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predic...	109	8e-21
39	gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3	109	8e-21
40	gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nippon...	109	8e-21
41	dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D...	109	8e-21
42	dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, com...	109	8e-21
43	dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clon...	109	8e-21
44	dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clon...	109	8e-21
45	dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clon...	109	8e-21
46	dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clon...	109	8e-21
47	dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clon...	109	8e-21
48	gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, c...	101	2e-18
49	ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predic...	98	3e-17
50	dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic D...	98	3e-17
51	dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic D...	98	3e-17
52	dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	3e-17
53	dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clon...	98	3e-17
54	dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mR...	98	3e-17
55	gb|BT016300.1| Zea mays clone Contig133 mRNA sequence	94	4e-16
56	gb|AY104464.1| Zea mays PCO114899 mRNA sequence	94	4e-16
57	gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmT...	94	4e-16
58	gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putat...	92	2e-15
59	gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral prot...	86	1e-13
60	gb|AY112388.1| Zea mays CL24208_1 mRNA sequence	86	1e-13
61	emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquapo...	84	4e-13
62	gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsi...	82	2e-12
63	ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel A...	68	3e-08
64	ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron...	68	3e-08
65	gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic pr...	68	3e-08
66	gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic pr...	68	3e-08
67	emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Co...	68	3e-08
68	emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Co...	68	3e-08
69	emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Co...	68	3e-08
70	gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete s...	68	3e-08
71	dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, ...	68	3e-08
72	gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integr...	68	3e-08
73	dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, compl...	68	3e-08
74	gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP...	66	1e-07
75	gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast int...	64	4e-07
76	gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water chann...	64	4e-07
77	ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT...	62	2e-06
78	gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds	62	2e-06
79	gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds	62	2e-06
80	gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral prot...	62	2e-06
81	dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, ...	62	2e-06
82	ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa822...	60	6e-06
83	gb|AF290618.1|AF290618 Nicotiana glauca putative delta TIP (MIP2...	60	6e-06
84	dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic D...	60	6e-06
85	dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clon...	60	6e-06
86	gb|AF047173.1| Vernicia fordii aquaporin mRNA, complete cds	58	2e-05
87	gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral prot...	56	1e-04
88	gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds	56	1e-04
89	dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds	56	1e-04
90	gb|AC183494.1| Brassica oleracea Contig C, complete sequence	54	4e-04
91	dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds	54	4e-04
92	emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative to...	50	0.006
93	emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for put...	50	0.006
94	dbj|AB206106.1| Mimosa pudica tip2;1 mRNA for tonoplast intrinsi...	50	0.006
95	gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integr...	50	0.006
96	dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds	50	0.006
97	dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds	50	0.006
98	emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic...	48	0.024
99	emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonopla...	48	0.024
100	gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral prot...	48	0.024
101	gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete ge...	48	0.024
102	ref|XM_470886.1| Oryza sativa (japonica cultivar-group), mRNA	46	0.094
103	gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome...	46	0.094
104	emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4,...	46	0.094
105	gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome	46	0.094
106	dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.094
107	dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clon...	46	0.094
108	ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquapori...	44	0.37
109	ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquapori...	44	0.37
110	emb|AJ245953.1|SOL245953 Spinacia oleracea mRNA for delta tonopl...	44	0.37
111	dbj|AB000506.1| Carrot mRNA for root specific gene, complete cds	44	0.37
112	dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds	44	0.37
113	dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds	44	0.37
114	ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water c...	42	1.5
115	gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence	42	1.5
116	ref|XM_001003742.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), ...	42	1.5
117	ref|XM_994651.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA	42	1.5
118	ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquapori...	42	1.5
119	gb|DQ450071.1| Arachis hypogaea clone 8A4R19G1 putative major in...	42	1.5
120	gb|DQ450067.1| Arachis hypogaea clone 2A1R19GZ delta-TIP-like pr...	42	1.5
121	emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA ...	42	1.5
122	emb|Z29946.1|TRGTIPLP T.repens (Huia) mRNA for gamma-Tip-like pr...	42	1.5
123	emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, ...	42	1.5
124	gb|AY056063.1| Arabidopsis thaliana AT4g17340/dl4705w mRNA, comp...	42	1.5
125	gb|AF367283.1|AF367283 Arabidopsis thaliana AT4g17340/dl4705w mR...	42	1.5
126	dbj|AK082699.1| Mus musculus 0 day neonate cerebellum cDNA, RIKE...	42	1.5
127	emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Co...	42	1.5
128	emb|BX825196.1|CNS0A4OU Arabidopsis thaliana Full-length cDNA Co...	42	1.5
129	emb|BX828364.1|CNS0A340 Arabidopsis thaliana Full-length cDNA Co...	42	1.5
130	gb|AY088929.1| Arabidopsis thaliana clone 99796 mRNA, complete s...	42	1.5
131	emb|AJ555456.1|ECA555456 Equus caballus partial mRNA for aquapor...	42	1.5
132	gb|AY610211.1| Sus scrofa clone Clu_9762.scr.msk.p1.Contig1, mRN...	42	1.5
133	gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, comple...	42	1.5
134	ref|NM_175087.2| Mus musculus aquaporin 6 (Aqp6), mRNA	42	1.5
135	ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel A...	40	5.8
136	ref|XM_804228.1| Trypanosoma cruzi strain CL Brener hypothetical...	40	5.8
137	gb|AC137077.26| Medicago truncatula clone mth2-8g15, complete se...	40	5.8
138	emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic p...	40	5.8
139	gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g3683...	40	5.8
140	gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic...	40	5.8
141	emb|X54854.1|ATROOTSP A. thaliana mRNA for root-specific gene	40	5.8
142	gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome	40	5.8
143	gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map ...	40	5.8
144	gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone ...	40	5.8
145	gb|CP000264.1| Jannaschia sp. CCS1, complete genome	40	5.8
146	emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Co...	40	5.8
147	emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Co...	40	5.8
148	emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Co...	40	5.8
149	emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Co...	40	5.8
150	emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Co...	40	5.8
151	emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Co...	40	5.8
152	emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Co...	40	5.8
153	emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Co...	40	5.8
154	emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Co...	40	5.8
155	gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete s...	40	5.8
156	gb|AF497482.1| Micromonospora echinospora calicheamicin biosynth...	40	5.8
157	dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete ...	40	5.8
158	dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intri...	40	5.8
159	gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, c...	40	5.8
160	emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid compl...	40	5.8
161	tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy ...	40	5.8
162	gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic pro...	40	5.8

---

>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA,
           complete cds
          Length = 853

 Score =  448 bits (226), Expect = e-123
 Identities = 256/266 (96%)
 Strand = Plus / Minus

                                                                       
Query: 165 ttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagac 224
           |||||||||||||| |||||||| | |||||| |||||||||||||| ||||||||||||
Sbjct: 801 ttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtacacgtaccggtagac 742

                                                                       
Query: 225 gatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 284
           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 741 gacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 682

                                                                       
Query: 285 gtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaa 344
           ||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||
Sbjct: 681 gtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaa 622

                                                                       
Query: 345 ggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggt 404
           |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
Sbjct: 621 ggggccggcaacgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatggt 562

                                     
Query: 405 gccgagggatcccttcttggggtcgg 430
           ||||||||| ||||||||||||||||
Sbjct: 561 gccgagggaacccttcttggggtcgg 536

---

>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1067

 Score =  446 bits (225), Expect = e-122
 Identities = 361/406 (88%), Gaps = 19/406 (4%)
 Strand = Plus / Minus

                                                                       
Query: 32  gcttcgatctgaaccaaacaacatgacgttcttcacatcatcgaggacattc-------t 84
           ||||||||||||||||||||||| || |||||||||||||||||  ||||||       |
Sbjct: 932 gcttcgatctgaaccaaacaacaggatgttcttcacatcatcgaa-acattcgtgagact 874

                                                                       
Query: 85  gaccaccacgcacgcacttttttatgttgccgaaggcatcatggcaaaccaaacaccgaa 144
           | |||||||| ||||||||||| |||||||||||||||| ||||          ||||||
Sbjct: 873 gcccaccacgtacgcacttttt-atgttgccgaaggcattatgg----------accgaa 825

                                                                       
Query: 145 cgacccttcacatggatggcttagtagtcgttgctggcgacgggggtgtggttgtcgcac 204
           |||| |||| ||||| |||||||||||||||||| |||||||||| |||||| ||| |||
Sbjct: 824 cgactcttcccatggctggcttagtagtcgttgccggcgacggggctgtggtcgtcccac 765

                                                                       
Query: 205 atgtacaggtaccggtagacgatgccggcgaggccaccgccgatgagcgggccggcccag 264
           ||||| ||||| ||||| |||| |||||||||||||||||||||||||||||||||||||
Sbjct: 764 atgtataggtatcggtaaacgacgccggcgaggccaccgccgatgagcgggccggcccag 705

                                                                       
Query: 265 tagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcaggg 324
           || | ||| |||||||||||||||||||||||||||||||||||||| ||||||||||||
Sbjct: 704 taaacccaaatgttggtgaagtcgccgctggcaacggcggggccgaaggagcgtgcaggg 645

                                                                       
Query: 325 ttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaagccg 384
           |||||||| |||||||| ||||||||||| |||||||||||||| ||||| |||||||||
Sbjct: 644 ttcatggacccgccggaaaaggggccggccacgaggatgttggcgccgacaatgaagccg 585

                                                         
Query: 385 atggcgatgggggcgatggtgccgagggatcccttcttggggtcgg 430
           ||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 584 atggcgatgggggcgatggtgccgagggatcccttcttggggtcgg 539

---

>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA,
           complete cds
          Length = 829

 Score =  444 bits (224), Expect = e-121
 Identities = 257/268 (95%)
 Strand = Plus / Minus

                                                                       
Query: 163 gcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtag 222
           |||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||
Sbjct: 800 gcttagtagtcgttgccggcgacggcggtgtggtcgtcgcacatgtacaggtaccggtag 741

                                                                       
Query: 223 acgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 282
           |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
Sbjct: 740 acgacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 681

                                                                       
Query: 283 aagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggag 342
           ||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||
Sbjct: 680 aagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggag 621

                                                                       
Query: 343 aaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatg 402
           ||||||||||| |||||||||||||| ||||||||||||||||||||||| || ||||||
Sbjct: 620 aaggggccggcgacgaggatgttggcgccgacgatgaagccgatggcgattggagcgatg 561

                                       
Query: 403 gtgccgagggatcccttcttggggtcgg 430
           ||||||||||| ||||||||||||||||
Sbjct: 560 gtgccgagggaccccttcttggggtcgg 533

---

>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA,
           complete cds
          Length = 817

 Score =  440 bits (222), Expect = e-120
 Identities = 258/270 (95%)
 Strand = Plus / Minus

                                                                       
Query: 161 tggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggt 220
           |||||||||||||||||| |||||||| | |||||| |||||||||||| ||||| ||||
Sbjct: 806 tggcttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtataggtatcggt 747

                                                                       
Query: 221 agacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttgg 280
           |||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||
Sbjct: 746 agacgacgccggcgaggccaccgccgatgagcgggccggcccagtagacccagatgttgg 687

                                                                       
Query: 281 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccgg 340
           ||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||
Sbjct: 686 tgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccgg 627

                                                                       
Query: 341 agaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcga 400
           ||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||
Sbjct: 626 agaaggggccggccacgaggatgttggcgccgacgatgaagccgatggcgatgggggcga 567

                                         
Query: 401 tggtgccgagggatcccttcttggggtcgg 430
           ||||||||||||||||||||||||||||||
Sbjct: 566 tggtgccgagggatcccttcttggggtcgg 537

---

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score =  331 bits (167), Expect = 1e-87
 Identities = 233/255 (91%)
 Strand = Plus / Minus

                                                                            
Query: 176      tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 235
                ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 13251125 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 13251066

                                                                            
Query: 236      ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 295
                |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 13251065 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 13251006

                                                                            
Query: 296      caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 355
                | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 13251005 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 13250946

                                                                            
Query: 356      cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
                ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 13250945 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 13250886

                               
Query: 416      ccttcttggggtcgg 430
                |||||||||||||||
Sbjct: 13250885 ccttcttggggtcgg 13250871

---

>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
             clone:P0427E01
          Length = 146395

 Score =  331 bits (167), Expect = 1e-87
 Identities = 233/255 (91%)
 Strand = Plus / Minus

                                                                         
Query: 176   tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 235
             ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 12935 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 12876

                                                                         
Query: 236   ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 295
             |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 12875 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 12816

                                                                         
Query: 296   caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 355
             | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 12815 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 12756

                                                                         
Query: 356   cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
             ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 12755 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 12696

                            
Query: 416   ccttcttggggtcgg 430
             |||||||||||||||
Sbjct: 12695 ccttcttggggtcgg 12681

---

>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC
              clone:OSJNBa0012F14
          Length = 168629

 Score =  331 bits (167), Expect = 1e-87
 Identities = 233/255 (91%)
 Strand = Plus / Minus

                                                                          
Query: 176    tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 235
              ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 168313 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 168254

                                                                          
Query: 236    ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 295
              |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 168253 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 168194

                                                                          
Query: 296    caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 355
              | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 168193 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 168134

                                                                          
Query: 356    cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
              ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 168133 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 168074

                             
Query: 416    ccttcttggggtcgg 430
              |||||||||||||||
Sbjct: 168073 ccttcttggggtcgg 168059

---

>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full
           insert sequence
          Length = 1194

 Score =  331 bits (167), Expect = 1e-87
 Identities = 233/255 (91%)
 Strand = Plus / Minus

                                                                       
Query: 176 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 235
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 825 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 766

                                                                       
Query: 236 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 295
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 765 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 706

                                                                       
Query: 296 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 355
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 705 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 646

                                                                       
Query: 356 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 645 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 586

                          
Query: 416 ccttcttggggtcgg 430
           |||||||||||||||
Sbjct: 585 ccttcttggggtcgg 571

---

>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full
           insert sequence
          Length = 1214

 Score =  331 bits (167), Expect = 1e-87
 Identities = 233/255 (91%)
 Strand = Plus / Minus

                                                                       
Query: 176 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 235
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768

                                                                       
Query: 236 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 295
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708

                                                                       
Query: 296 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 355
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 707 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648

                                                                       
Query: 356 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 588

                          
Query: 416 ccttcttggggtcgg 430
           |||||||||||||||
Sbjct: 587 ccttcttggggtcgg 573

---

>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full
           insert sequence
          Length = 1197

 Score =  331 bits (167), Expect = 1e-87
 Identities = 233/255 (91%)
 Strand = Plus / Minus

                                                                       
Query: 176 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 235
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769

                                                                       
Query: 236 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 295
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709

                                                                       
Query: 296 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 355
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649

                                                                       
Query: 356 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 589

                          
Query: 416 ccttcttggggtcgg 430
           |||||||||||||||
Sbjct: 588 ccttcttggggtcgg 574

---

>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full
           insert sequence
          Length = 1195

 Score =  331 bits (167), Expect = 1e-87
 Identities = 233/255 (91%)
 Strand = Plus / Minus

                                                                       
Query: 176 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 235
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767

                                                                       
Query: 236 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 295
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707

                                                                       
Query: 296 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 355
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647

                                                                       
Query: 356 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 587

                          
Query: 416 ccttcttggggtcgg 430
           |||||||||||||||
Sbjct: 586 ccttcttggggtcgg 572

---

>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full
           insert sequence
          Length = 1202

 Score =  331 bits (167), Expect = 1e-87
 Identities = 233/255 (91%)
 Strand = Plus / Minus

                                                                       
Query: 176 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 235
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769

                                                                       
Query: 236 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 295
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709

                                                                       
Query: 296 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 355
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649

                                                                       
Query: 356 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 589

                          
Query: 416 ccttcttggggtcgg 430
           |||||||||||||||
Sbjct: 588 ccttcttggggtcgg 574

---

>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full
           insert sequence
          Length = 1220

 Score =  331 bits (167), Expect = 1e-87
 Identities = 233/255 (91%)
 Strand = Plus / Minus

                                                                       
Query: 176 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 235
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767

                                                                       
Query: 236 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 295
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707

                                                                       
Query: 296 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 355
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647

                                                                       
Query: 356 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 587

                          
Query: 416 ccttcttggggtcgg 430
           |||||||||||||||
Sbjct: 586 ccttcttggggtcgg 572

---

>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full
           insert sequence
          Length = 1196

 Score =  323 bits (163), Expect = 3e-85
 Identities = 232/255 (90%)
 Strand = Plus / Minus

                                                                       
Query: 176 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 235
           ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| ||||||||
Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768

                                                                       
Query: 236 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 295
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708

                                                                       
Query: 296 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 355
           | |||||||| ||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 707 cgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648

                                                                       
Query: 356 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 588

                          
Query: 416 ccttcttggggtcgg 430
           |||||||||||||||
Sbjct: 587 ccttcttggggtcgg 573

---

>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full
           insert sequence
          Length = 1074

 Score =  323 bits (163), Expect = 3e-85
 Identities = 232/255 (90%)
 Strand = Plus / Minus

                                                                       
Query: 176 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 235
           ||||||| ||||||| ||||| | |||||||||| | ||| |||||||||| ||||||||
Sbjct: 705 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaacggtagacgaggccggcga 646

                                                                       
Query: 236 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 295
           |||| ||||||| ||| |||||| ||||||||||||||||||||||| ||||||||||||
Sbjct: 645 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 586

                                                                       
Query: 296 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 355
           | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| |
Sbjct: 585 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 526

                                                                       
Query: 356 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
           ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || |
Sbjct: 525 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 466

                          
Query: 416 ccttcttggggtcgg 430
           |||||||||||||||
Sbjct: 465 ccttcttggggtcgg 451

---

>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA,
           complete cds
          Length = 1073

 Score =  200 bits (101), Expect = 3e-48
 Identities = 187/213 (87%), Gaps = 2/213 (0%)
 Strand = Plus / Minus

                                                                       
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 278
           |||||||| ||| ||||| || |||||||||||||||||| ||||||||| |||| ||  
Sbjct: 763 gtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagacccagttgcc 704

                                                                       
Query: 279 ggtgaagtcg-ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgc 337
           || ||||||| |||| ||| |||||||||||||| ||||| || ||||||||||| ||||
Sbjct: 703 ggcgaagtcggccgc-ggcgacggcggggccgaaggagcgggcggggttcatggagccgc 645

                                                                       
Query: 338 cggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatggggg 397
           ||  |||||| || ||  ||||||||||||| |||||||||||||||||||||||||| |
Sbjct: 644 cgctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcg 585

                                            
Query: 398 cgatggtgccgagggatcccttcttggggtcgg 430
           |||||||||||||||| ||||||||||||||||
Sbjct: 584 cgatggtgccgagggagcccttcttggggtcgg 552

---

>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA,
           complete cds
          Length = 1110

 Score =  190 bits (96), Expect = 3e-45
 Identities = 183/212 (86%)
 Strand = Plus / Minus

                                                                       
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 278
           |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| |   
Sbjct: 920 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 861

                                                                       
Query: 279 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 338
           || |||||||||   ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 860 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 801

                                                                       
Query: 339 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 398
           |  |||||| || ||  ||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 800 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 741

                                           
Query: 399 gatggtgccgagggatcccttcttggggtcgg 430
           |||||||||||| || ||||||||||||||||
Sbjct: 740 gatggtgccgagcgagcccttcttggggtcgg 709

---

>gb|AY105015.1| Zea mays PCO137646 mRNA sequence
          Length = 1238

 Score =  190 bits (96), Expect = 3e-45
 Identities = 183/212 (86%)
 Strand = Plus / Minus

                                                                       
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 278
           |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| |   
Sbjct: 919 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 860

                                                                       
Query: 279 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 338
           || |||||||||   ||| |||||||||||||| ||||| || ||||||||||| |||||
Sbjct: 859 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 800

                                                                       
Query: 339 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 398
           |  |||||| || ||  ||||||||||||| |||||||||||||||||||||||||| ||
Sbjct: 799 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 740

                                           
Query: 399 gatggtgccgagggatcccttcttggggtcgg 430
           |||||||||||| || ||||||||||||||||
Sbjct: 739 gatggtgccgagcgagcccttcttggggtcgg 708

---

>ref|XM_467137.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 747

 Score =  182 bits (92), Expect = 6e-43
 Identities = 173/200 (86%)
 Strand = Plus / Minus

                                                                       
Query: 229 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 288
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 624

                                                                       
Query: 289 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 348
           |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 623 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 564

                                                                       
Query: 349 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 408
           |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 563 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 504

                               
Query: 409 agggatcccttcttggggtc 428
           || ||||||||||| |||||
Sbjct: 503 agcgatcccttcttcgggtc 484

---

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score =  182 bits (92), Expect = 6e-43
 Identities = 173/200 (86%)
 Strand = Plus / Plus

                                                                            
Query: 229      ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 288
                ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 26627242

                                                                            
Query: 289      ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 348
                |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 26627243 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 26627302

                                                                            
Query: 349      ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 408
                |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 26627303 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 26627362

                                    
Query: 409      agggatcccttcttggggtc 428
                || ||||||||||| |||||
Sbjct: 26627363 agcgatcccttcttcgggtc 26627382

---

>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0519E06
          Length = 170634

 Score =  182 bits (92), Expect = 6e-43
 Identities = 173/200 (86%)
 Strand = Plus / Plus

                                                                          
Query: 229    ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 288
              ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 169623

                                                                          
Query: 289    ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 348
              |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 169624 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 169683

                                                                          
Query: 349    ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 408
              |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 169684 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 169743

                                  
Query: 409    agggatcccttcttggggtc 428
              || ||||||||||| |||||
Sbjct: 169744 agcgatcccttcttcgggtc 169763

---

>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
             clone:OJ1112_F09
          Length = 139371

 Score =  182 bits (92), Expect = 6e-43
 Identities = 173/200 (86%)
 Strand = Plus / Plus

                                                                         
Query: 229   ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 288
             ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 61403

                                                                         
Query: 289   ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 348
             |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 61404 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 61463

                                                                         
Query: 349   ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 408
             |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 61464 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 61523

                                 
Query: 409   agggatcccttcttggggtc 428
             || ||||||||||| |||||
Sbjct: 61524 agcgatcccttcttcgggtc 61543

---

>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 1013

 Score =  182 bits (92), Expect = 6e-43
 Identities = 173/200 (86%)
 Strand = Plus / Minus

                                                                       
Query: 229 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 288
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 697

                                                                       
Query: 289 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 348
           |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 696 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 637

                                                                       
Query: 349 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 408
           |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 636 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 577

                               
Query: 409 agggatcccttcttggggtc 428
           || ||||||||||| |||||
Sbjct: 576 agcgatcccttcttcgggtc 557

---

>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full
           insert sequence
          Length = 873

 Score =  182 bits (92), Expect = 6e-43
 Identities = 173/200 (86%)
 Strand = Plus / Minus

                                                                       
Query: 229 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 288
           ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 499

                                                                       
Query: 289 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 348
           |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 498 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 439

                                                                       
Query: 349 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 408
           |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 438 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 379

                               
Query: 409 agggatcccttcttggggtc 428
           || ||||||||||| |||||
Sbjct: 378 agcgatcccttcttcgggtc 359

---

>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2
          Length = 339972

 Score =  182 bits (92), Expect = 6e-43
 Identities = 173/200 (86%)
 Strand = Plus / Minus

                                                                          
Query: 229    ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 288
              ||||||||||| |||||||| ||||||||| ||||||||| |||| ||   | ||||| |
Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 250592

                                                                          
Query: 289    ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 348
              |||  ||| |||||||||||||| ||||| || ||||||||||| ||||||  ||| |||
Sbjct: 250591 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 250532

                                                                          
Query: 349    ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 408
              |||||  ||||||||||||| ||||||||||||||||| |||||||| ||||||||||||
Sbjct: 250531 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 250472

                                  
Query: 409    agggatcccttcttggggtc 428
              || ||||||||||| |||||
Sbjct: 250471 agcgatcccttcttcgggtc 250452



 Score =  115 bits (58), Expect = 1e-22
 Identities = 91/102 (89%)
 Strand = Plus / Plus

                                                                          
Query: 327    catggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgat 386
              |||||| ||||||  ||| ||||||||  ||||||||||||| |||||||||||||||||
Sbjct: 332095 catggagccgccgctgaacgggccggcggcgaggatgttggcgccgacgatgaagccgat 332154

                                                        
Query: 387    ggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
               |||||||| |||||||||||||| ||||||||||| |||||
Sbjct: 332155 cgcgatgggcgcgatggtgccgagcgatcccttcttcgggtc 332196

---

>gb|AY106931.1| Zea mays PCO140073 mRNA sequence
          Length = 1069

 Score =  159 bits (80), Expect = 9e-36
 Identities = 167/196 (85%)
 Strand = Plus / Minus

                                                                       
Query: 235 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 294
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || ||||| ||||   
Sbjct: 757 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 698

                                                                       
Query: 295 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 354
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 697 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 638

                                                                       
Query: 355 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 414
            | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| 
Sbjct: 637 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 578

                           
Query: 415 cccttcttggggtcgg 430
           |||||||| |||||||
Sbjct: 577 cccttcttcgggtcgg 562

---

>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds
          Length = 1060

 Score =  159 bits (80), Expect = 9e-36
 Identities = 167/196 (85%)
 Strand = Plus / Minus

                                                                       
Query: 235 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 294
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || ||||| ||||   
Sbjct: 739 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 680

                                                                       
Query: 295 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 354
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 679 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 620

                                                                       
Query: 355 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 414
            | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| 
Sbjct: 619 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 560

                           
Query: 415 cccttcttggggtcgg 430
           |||||||| |||||||
Sbjct: 559 cccttcttcgggtcgg 544

---

>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds
          Length = 968

 Score =  151 bits (76), Expect = 2e-33
 Identities = 166/196 (84%)
 Strand = Plus / Minus

                                                                       
Query: 235 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 294
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || |||||  |||   
Sbjct: 680 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 621

                                                                       
Query: 295 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 354
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 620 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 561

                                                                       
Query: 355 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 414
            | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| 
Sbjct: 560 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 501

                           
Query: 415 cccttcttggggtcgg 430
           |||||||| |||||||
Sbjct: 500 cccttcttcgggtcgg 485

---

>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA,
           complete cds
          Length = 1042

 Score =  151 bits (76), Expect = 2e-33
 Identities = 166/196 (84%)
 Strand = Plus / Minus

                                                                       
Query: 235 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 294
           ||||||||||||| ||| |||||| ||||||| | |||| ||  || |||||  |||   
Sbjct: 748 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 689

                                                                       
Query: 295 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 354
           || |||||||||||||| ||||| || ||||||||||| ||||||  |||||||||||| 
Sbjct: 688 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 629

                                                                       
Query: 355 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 414
            | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| 
Sbjct: 628 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 569

                           
Query: 415 cccttcttggggtcgg 430
           |||||||| |||||||
Sbjct: 568 cccttcttcgggtcgg 553

---

>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast
             intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes,
             complete cds
          Length = 65979

 Score =  137 bits (69), Expect = 3e-29
 Identities = 117/133 (87%)
 Strand = Plus / Minus

                                                                         
Query: 298   acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 357
             ||||| || ||||| ||||| || ||||||||||| ||||||  |||||| |||||  ||
Sbjct: 44843 acggccggcccgaaggagcgcgccgggttcatggagccgccgctgaagggcccggcggcg 44784

                                                                         
Query: 358   aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 417
             ||||||||||| ||||||||||||||||| || ||||| ||||||||||||||||| |||
Sbjct: 44783 aggatgttggcgccgacgatgaagccgatcgccatgggcgcgatggtgccgagggagccc 44724

                          
Query: 418   ttcttggggtcgg 430
             |||||||||||||
Sbjct: 44723 ttcttggggtcgg 44711



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 44/52 (84%)
 Strand = Plus / Minus

                                                                 
Query: 281   tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 332
             |||||||||||||| |||| || || ||||| || || || |||||||||||
Sbjct: 46205 tgaagtcgccgctgacaaccgccggcccgaacgaccgcgcggggttcatgga 46154

---

>ref|XM_473424.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 2307

 Score =  135 bits (68), Expect = 1e-28
 Identities = 176/212 (83%)
 Strand = Plus / Minus

                                                                       
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 278
           ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 696 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 637

                                                                       
Query: 279 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 338
           || ||||| ||||   || ||||| |||||||| ||||| |||||||||||||||| |||
Sbjct: 636 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 577

                                                                       
Query: 339 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 398
           |   ||||| || ||  | ||||||||||| |||||||||||||||||||| ||||| ||
Sbjct: 576 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 517

                                           
Query: 399 gatggtgccgagggatcccttcttggggtcgg 430
           || |||||||||||| |||||||| |||||||
Sbjct: 516 gacggtgccgagggaacccttcttcgggtcgg 485

---

>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17,
             complete sequence
          Length = 127259

 Score =  135 bits (68), Expect = 1e-28
 Identities = 176/212 (83%)
 Strand = Plus / Plus

                                                                         
Query: 219   gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 278
             ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 92483 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 92542

                                                                         
Query: 279   ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 338
             || ||||| ||||   || ||||| |||||||| ||||| |||||||||||||||| |||
Sbjct: 92543 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 92602

                                                                         
Query: 339   ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 398
             |   ||||| || ||  | ||||||||||| |||||||||||||||||||| ||||| ||
Sbjct: 92603 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 92662

                                             
Query: 399   gatggtgccgagggatcccttcttggggtcgg 430
             || |||||||||||| |||||||| |||||||
Sbjct: 92663 gacggtgccgagggaacccttcttcgggtcgg 92694

---

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  135 bits (68), Expect = 1e-28
 Identities = 176/212 (83%)
 Strand = Plus / Plus

                                                                            
Query: 219      gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 278
                ||||||||  ||||| |||||||| ||||| || |||||| ||||||| | |||| ||  
Sbjct: 27568507 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 27568566

                                                                            
Query: 279      ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 338
                || ||||| ||||   || ||||| |||||||| ||||| |||||||||||||||| |||
Sbjct: 27568567 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 27568626

                                                                            
Query: 339      ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 398
                |   ||||| || ||  | ||||||||||| |||||||||||||||||||| ||||| ||
Sbjct: 27568627 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 27568686

                                                
Query: 399      gatggtgccgagggatcccttcttggggtcgg 430
                || |||||||||||| |||||||| |||||||
Sbjct: 27568687 gacggtgccgagggaacccttcttcgggtcgg 27568718



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                       
Query: 272      agatgttggtgaagtcgccgctg 294
                |||||||||||||||||||||||
Sbjct: 25620210 agatgttggtgaagtcgccgctg 25620232

---

>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein
          Length = 1020

 Score =  131 bits (66), Expect = 2e-27
 Identities = 114/130 (87%)
 Strand = Plus / Minus

                                                                       
Query: 300 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgag 359
           |||||||||||| |||   || |||||||||||  |||||||||||| |||| | |||||
Sbjct: 681 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 622

                                                                       
Query: 360 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 419
           ||||||||| |||||||||||||||||||||||||| ||||||||||| |||   |||||
Sbjct: 621 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 562

                     
Query: 420 cttggggtcg 429
           ||||||||||
Sbjct: 561 cttggggtcg 552



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 762 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 715

---

>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein
          Length = 1007

 Score =  131 bits (66), Expect = 2e-27
 Identities = 177/214 (82%)
 Strand = Plus / Minus

                                                                       
Query: 217 cggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatg 276
           ||||||||||| ||||| ||||| || |||||||| |||||| ||||||| | |||| ||
Sbjct: 775 cggtagacgataccggcaaggccgcctccgatgagggggccgacccagtacacccagttg 716

                                                                       
Query: 277 ttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccg 336
           | ||||||||| |||||  |||| || ||| |||| ||||| || ||||||||||| |||
Sbjct: 715 tcggtgaagtctccgctcacaacagcagggtcgaaggagcgggcggggttcatggagccg 656

                                                                       
Query: 337 ccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggg 396
           || ||||||||||| ||  | | ||||||||| || ||||||||||| || || ||||| 
Sbjct: 655 ccagagaaggggcccgcggccaagatgttggcgcccacgatgaagccaatagcaatggga 596

                                             
Query: 397 gcgatggtgccgagggatcccttcttggggtcgg 430
           ||||||||||| |||   |||||||| |||||||
Sbjct: 595 gcgatggtgcccaggtcgcccttcttcgggtcgg 562

---

>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA,
           complete cds
          Length = 1133

 Score =  113 bits (57), Expect = 5e-22
 Identities = 111/129 (86%)
 Strand = Plus / Minus

                                                                       
Query: 300 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgag 359
           |||||||||||| |||   || |||||||||||  |||||||||||| |||| | || ||
Sbjct: 712 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgcccaccag 653

                                                                       
Query: 360 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 419
           ||||||||| || ||||||||||||||||||||||| ||||||||||| |||   |||||
Sbjct: 652 gatgttggcgcccacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 593

                    
Query: 420 cttggggtc 428
           |||||||||
Sbjct: 592 cttggggtc 584



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 793 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 746

---

>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic
           protein (TIP)
          Length = 1146

 Score =  111 bits (56), Expect = 2e-21
 Identities = 95/108 (87%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||  |||||  ||||| |||| | |||||||||||||| || |||||||||
Sbjct: 675 gggttcatggacgcgccgtcgaaggcgccgccgacgaggatgttggcgcccacgatgaag 616

                                                           
Query: 382 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcg 429
           |||||||||||||||||||||||||| |||   |||||||||||||||
Sbjct: 615 ccgatggcgatgggggcgatggtgcccaggctgcccttcttggggtcg 568

---

>ref|XM_470213.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 753

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 596 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 537

                                                          
Query: 382 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           ||||||||||||||||||||||||||||||   ||||||||||||||
Sbjct: 536 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtc 490



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 699 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 652

---

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                           
Query: 322     gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
               |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 2544886 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 2544945

                                                              
Query: 382     ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
               ||||||||||||||||||||||||||||||   ||||||||||||||
Sbjct: 2544946 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtc 2544992



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                               
Query: 219     gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
               ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 2544783 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544830



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 272      agatgttggtgaagtcgccgctg 294
                |||||||||||||||||||||||
Sbjct: 15990586 agatgttggtgaagtcgccgctg 15990564

---

>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone
              OSJNBa0067N01, from chromosome 3, complete sequence
          Length = 159636

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                          
Query: 322    gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
              |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 125208 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 125149

                                                             
Query: 382    ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
              ||||||||||||||||||||||||||||||   ||||||||||||||
Sbjct: 125148 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtc 125102



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                              
Query: 219    gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
              ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 125311 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 125264

---

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                           
Query: 322     gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
               |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 2544996 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 2545055

                                                              
Query: 382     ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
               ||||||||||||||||||||||||||||||   ||||||||||||||
Sbjct: 2545056 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtc 2545102



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Plus

                                                               
Query: 219     gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
               ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 2544893 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544940



 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                       
Query: 272      agatgttggtgaagtcgccgctg 294
                |||||||||||||||||||||||
Sbjct: 15985120 agatgttggtgaagtcgccgctg 15985098

---

>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds
          Length = 1080

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 674 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 615

                                                          
Query: 382 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           ||||||||||||||||||||||||||||||   ||||||||||||||
Sbjct: 614 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtc 568



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 777 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 730

---

>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full
           insert sequence
          Length = 1024

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Plus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 295 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 354

                                                          
Query: 382 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           ||||||||||||||||||||||||||||||   ||||||||||||||
Sbjct: 355 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtc 401

---

>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full
           insert sequence
          Length = 1034

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 683 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 624

                                                          
Query: 382 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           ||||||||||||||||||||||||||||||   ||||||||||||||
Sbjct: 623 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtc 577



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 786 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 739

---

>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full
           insert sequence
          Length = 1082

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 685 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 626

                                                          
Query: 382 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           ||||||||||||||||||||||||||||||   ||||||||||||||
Sbjct: 625 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtc 579



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 788 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 741

---

>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full
           insert sequence
          Length = 551

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 209 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 150

                                                          
Query: 382 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           ||||||||||||||||||||||||||||||   ||||||||||||||
Sbjct: 149 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtc 103



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 312 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 265

---

>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full
           insert sequence
          Length = 1055

 Score =  109 bits (55), Expect = 8e-21
 Identities = 94/107 (87%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||  |||||  ||| | |||| | ||||||||||| || ||||||||||||
Sbjct: 681 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 622

                                                          
Query: 382 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           ||||||||||||||||||||||||||||||   ||||||||||||||
Sbjct: 621 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtc 575



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
           ||||| || |||||||||||||||||||||||| |||||  |||||||
Sbjct: 784 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 737

---

>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds
          Length = 1039

 Score =  101 bits (51), Expect = 2e-18
 Identities = 93/107 (86%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||  |||||  ||||| |||| | || |||||||||||||| |||||||||
Sbjct: 597 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 538

                                                          
Query: 382 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           |||||||||||||||||||||||||| |||   |||||||| |||||
Sbjct: 537 ccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtc 491



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 700 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 653

---

>ref|NM_189497.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 759

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 357
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 623 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 564

                                                        
Query: 358 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 402
           ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 563 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 519

---

>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete
                sequence
          Length = 43261740

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                            
Query: 298      acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 357
                |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 43108804 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 43108863

                                                             
Query: 358      aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 402
                ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 43108864 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 43108908



 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                           
Query: 304     gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 363
               |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 7297471 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 7297412

                                     
Query: 364     ttggccccgacgatgaagccga 385
               ||||| ||||||| || |||||
Sbjct: 7297411 ttggcgccgacgacgaggccga 7297390

---

>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
              clone:P0459B04
          Length = 142475

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Plus

                                                                          
Query: 298    acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 357
              |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 105833 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 105892

                                                           
Query: 358    aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 402
              ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 105893 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 105937

---

>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full
           insert sequence
          Length = 1346

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 357
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 647 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 588

                                                        
Query: 358 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 402
           ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 587 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 543

---

>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full
           insert sequence
          Length = 1149

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 357
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 696 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 637

                                                        
Query: 358 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 402
           ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 636 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 592

---

>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast
           intrinsic protein, complete cds
          Length = 970

 Score = 97.6 bits (49), Expect = 3e-17
 Identities = 91/105 (86%)
 Strand = Plus / Minus

                                                                       
Query: 298 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 357
           |||||||||||||| |||   || |||||||||||  |||||  ||||| |||| |  ||
Sbjct: 633 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 574

                                                        
Query: 358 aggatgttggccccgacgatgaagccgatggcgatgggggcgatg 402
           ||||||||||| |||||||||||||||||||||||||||||||||
Sbjct: 573 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatg 529

---

>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence
          Length = 1112

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||  |||||  ||||| |||| | || ||||||||||| || |||||||||
Sbjct: 693 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcgcccacgatgaag 634

                                                          
Query: 382 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           |||||||||||||||||||||||||| |||   |||||||| |||||
Sbjct: 633 ccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtc 587



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
           ||||| || |||||||||||| ||||||||||| || ||| |||||||
Sbjct: 796 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 749

---

>gb|AY104464.1| Zea mays PCO114899 mRNA sequence
          Length = 1167

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||  |||||  ||||| |||| | || |||||||||||||| |||||||||
Sbjct: 692 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 633

                                                          
Query: 382 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           |||||||| ||||||||||||||||| |||   |||||||| |||||
Sbjct: 632 ccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtc 586



 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 43/48 (89%)
 Strand = Plus / Minus

                                                           
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
           ||||| || |||||||||||| ||||||||||| |||||| |||||||
Sbjct: 795 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 748

---

>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds
          Length = 1097

 Score = 93.7 bits (47), Expect = 4e-16
 Identities = 92/107 (85%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||  |||||  ||||| |||| | || |||||||||||||| |||||||||
Sbjct: 689 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 630

                                                          
Query: 382 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           |||||||| ||||||||||||||||| |||   |||||||| |||||
Sbjct: 629 ccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtc 583



 Score = 48.1 bits (24), Expect = 0.024
 Identities = 42/48 (87%)
 Strand = Plus / Minus

                                                           
Query: 219 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 266
           ||||| || |||||||||||| ||||||||||| || ||| |||||||
Sbjct: 792 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 745

---

>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1)
           mRNA, complete cds
          Length = 1057

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 91/106 (85%)
 Strand = Plus / Minus

                                                                       
Query: 260 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 319
           |||||||||||||| |||   |||||||||||||| | |||||||||||||| ||||| |
Sbjct: 697 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 638

                                                         
Query: 320 cagggttcatggaaccgccggagaaggggccggcaacgaggatgtt 365
           | |||||||| || || |||||||| ||||||||| | ||||||||
Sbjct: 637 cggggttcattgatccaccggagaatgggccggcagccaggatgtt 592

---

>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA,
           complete cds
          Length = 1021

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Minus

                                                                       
Query: 358 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 417
           ||||||||||| |||||||||||||||||||||||||| ||||||  |||||||   |||
Sbjct: 577 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgccc 518

                      
Query: 418 ttcttggggtc 428
           |||||||||||
Sbjct: 517 ttcttggggtc 507

---

>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence
          Length = 833

 Score = 85.7 bits (43), Expect = 1e-13
 Identities = 64/71 (90%)
 Strand = Plus / Plus

                                                                       
Query: 358 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 417
           ||||||||||| |||||||||||||||||||||||||| ||||||  |||||||   |||
Sbjct: 434 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgccc 493

                      
Query: 418 ttcttggggtc 428
           |||||||||||
Sbjct: 494 ttcttggggtc 504

---

>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene)
          Length = 1017

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 90/106 (84%)
 Strand = Plus / Minus

                                                                       
Query: 260 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 319
           |||||||||||||| |||   |||||||||||||| | |||||||||||||| ||||| |
Sbjct: 655 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 596

                                                         
Query: 320 cagggttcatggaaccgccggagaaggggccggcaacgaggatgtt 365
           | |||||||| || || |||||||| ||||| ||| | ||||||||
Sbjct: 595 cggggttcattgatccaccggagaatgggcctgcagccaggatgtt 550

---

>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete
           cds
          Length = 997

 Score = 81.8 bits (41), Expect = 2e-12
 Identities = 137/169 (81%)
 Strand = Plus / Minus

                                                                       
Query: 260 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 319
           ||||||||||||| |||  | |||||||||| || || || || || ||||| ||||| |
Sbjct: 692 cccagtagatccatatgccgttgaagtcgccactagccactgctggtccgaaggagcgag 633

                                                                       
Query: 320 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 379
           | ||||||||||| || || ||||| || || ||  | | ||||||||| || || ||||
Sbjct: 632 ctgggttcatggatccaccagagaatggaccagcggccaagatgttggcaccaacaatga 573

                                                            
Query: 380 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           |||||||||| ||||| || ||||| ||||| ||||||||||| |||||
Sbjct: 572 agccgatggcaatgggtgcaatggtcccgagtgatcccttctttgggtc 524

---

>ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel AT3G16240 (DELTA-TIP)
           mRNA, complete cds
          Length = 1125

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 316 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 375
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 709 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 650

                                                             
Query: 376 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 425
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 649 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 600

---

>ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron transporter/ iron ion
            binding AT3G16250 mRNA, complete cds
          Length = 1538

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Plus

                                                                        
Query: 316  cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 375
            ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 1166 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 1225

                                                              
Query: 376  atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 425
            || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 1226 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 1275

---

>gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230)
           mRNA, complete cds
          Length = 853

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 316 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 375
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 599 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 540

                                                             
Query: 376 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 425
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 539 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 490

---

>gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230;
           MYA6.5) mRNA, complete cds
          Length = 929

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 316 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 375
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 670 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 611

                                                             
Query: 376 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 425
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 610 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 561

---

>emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZE06 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 903

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 316 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 375
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 647 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 588

                                                             
Query: 376 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 425
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 587 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 538

---

>emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB88ZH07 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 957

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 316 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 375
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 652 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 593

                                                             
Query: 376 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 425
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 592 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 543

---

>emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS72ZD10 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 945

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 316 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 375
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 649 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 590

                                                             
Query: 376 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 425
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 589 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 540

---

>gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete sequence
          Length = 978

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 316 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 375
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 671 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 612

                                                             
Query: 376 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 425
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 611 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 562

---

>dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6
          Length = 75289

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                         
Query: 316   cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 375
             ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 19498 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 19439

                                                               
Query: 376   atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 425
             || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 19438 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 19389

---

>gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integral protein mRNA,
           complete cds
          Length = 939

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 316 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 375
           ||||| ||||||||||| || |||||||| || |||||  ||||||||||||| || |||
Sbjct: 616 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 557

                                                             
Query: 376 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 425
           || |  || |||||||  || |||||||| ||||| || |||||||||||
Sbjct: 556 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttggg 507

---

>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds
          Length = 911

 Score = 67.9 bits (34), Expect = 3e-08
 Identities = 91/110 (82%)
 Strand = Plus / Minus

                                                                       
Query: 316 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 375
           ||||| ||||||||||| || || ||||| || |||||  | ||||||||||| ||||||
Sbjct: 640 cgtgctgggttcatggatccaccagagaatggaccggcggctaggatgttggcaccgacg 581

                                                             
Query: 376 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggg 425
           ||||  || ||||||| ||| |||||||| ||||| || ||||| |||||
Sbjct: 580 atgagaccaatggcgaggggagcgatggttccgagagaaccctttttggg 531

---

>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds
          Length = 316

 Score = 65.9 bits (33), Expect = 1e-07
 Identities = 60/69 (86%)
 Strand = Plus / Minus

                                                                       
Query: 360 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 419
           ||||||||| || || |||||||||||||| ||||| || ||||| ||||| ||||||||
Sbjct: 289 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggtcccgagtgatccctt 230

                    
Query: 420 cttggggtc 428
           ||| |||||
Sbjct: 229 ctttgggtc 221

---

>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein
           (TIP1) mRNA, partial cds
          Length = 662

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 41/44 (93%)
 Strand = Plus / Minus

                                                       
Query: 358 aggatgttggccccgacgatgaagccgatggcgatgggggcgat 401
           |||||||||||||| |||||||||||||| |||||||| |||||
Sbjct: 556 aggatgttggcccccacgatgaagccgatcgcgatgggcgcgat 513

---

>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK)
           mRNA, complete cds
          Length = 1076

 Score = 63.9 bits (32), Expect = 4e-07
 Identities = 104/128 (81%)
 Strand = Plus / Minus

                                                                       
Query: 301 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 360
           ||||| ||||||||||| || ||||||||||| || || ||||| ||||||||  | | |
Sbjct: 696 gcgggcccgaatgagcgggctgggttcatggatccaccagagaatgggccggcggccaag 637

                                                                       
Query: 361 atgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttc 420
           |||||||| || || ||||| || || || |||||||| |||||||| |  || ||| ||
Sbjct: 636 atgttggctccaacaatgaacccaatagcaatgggggcaatggtgcccactgagcccctc 577

                   
Query: 421 ttggggtc 428
           ||||||||
Sbjct: 576 ttggggtc 569

---

>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3)
           mRNA, complete cds
          Length = 1051

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 356 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
           ||||||||||||| || || ||||||||||||||||| || |||||||| || || ||||
Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 538

                  
Query: 416 ccttctt 422
           | |||||
Sbjct: 537 ctttctt 531

---

>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds
          Length = 753

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 356 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
           ||||||||||||| || || ||||||||||||||||| || |||||||| || || ||||
Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 500

                  
Query: 416 ccttctt 422
           | |||||
Sbjct: 499 ctttctt 493

---

>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds
          Length = 853

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Minus

                                                                       
Query: 356 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
           ||||||||||||| || || ||||||||||||||||| || |||||||| || || ||||
Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 528

                  
Query: 416 ccttctt 422
           | |||||
Sbjct: 527 ctttctt 521

---

>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA,
           complete cds
          Length = 1125

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 112/139 (80%)
 Strand = Plus / Minus

                                                                       
Query: 241 ccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctggcaacg 300
           |||||||  |||||||||  |||||||| ||||  ||| ||  |||| ||| |||| | |
Sbjct: 825 ccgccgagcagcgggccgatccagtagacccagtggtttgtccagtccccggtggccagg 766

                                                                       
Query: 301 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 360
           || |||||||| |||||||| |||||||||||  |||||| ||||  |||| |  |||||
Sbjct: 765 gccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcgagg 706

                              
Query: 361 atgttggccccgacgatga 379
            ||||||| ||||||||||
Sbjct: 705 ctgttggcgccgacgatga 687

---

>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7
          Length = 80117

 Score = 61.9 bits (31), Expect = 2e-06
 Identities = 58/67 (86%)
 Strand = Plus / Plus

                                                                        
Query: 356  cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
            ||||||||||||| || || ||||||||||||||||| || |||||||| || || ||||
Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 8706

                   
Query: 416  ccttctt 422
            | |||||
Sbjct: 8707 ctttctt 8713

---

>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA
          Length = 756

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 304 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 363
           |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 608 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 549

                                 
Query: 364 ttggccccgacgatgaagccga 385
           ||||| ||||||| || |||||
Sbjct: 548 ttggcgccgacgacgaggccga 527

---

>gb|AF290618.1|AF290618 Nicotiana glauca putative delta TIP (MIP2) mRNA, complete cds
          Length = 1072

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 81/98 (82%)
 Strand = Plus / Minus

                                                                       
Query: 256 ccggcccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgag 315
           ||||||||||| |||||| |||| ||||||||||| ||||| || || || || ||||| 
Sbjct: 719 ccggcccagtaaatccagttgttagtgaagtcgccactggccacagcaggcccaaatgaa 660

                                                 
Query: 316 cgtgcagggttcatggaaccgccggagaaggggccggc 353
           || || || ||||| || || |||||||| ||||||||
Sbjct: 659 cgggccggattcattgatccaccggagaatgggccggc 622

---

>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC
             clone:P0431F01
          Length = 143209

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                         
Query: 304   gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 363
             |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 98901 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 98842

                                   
Query: 364   ttggccccgacgatgaagccga 385
             ||||| ||||||| || |||||
Sbjct: 98841 ttggcgccgacgacgaggccga 98820

---

>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full
           insert sequence
          Length = 1112

 Score = 60.0 bits (30), Expect = 6e-06
 Identities = 69/82 (84%)
 Strand = Plus / Minus

                                                                       
Query: 304 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 363
           |||||||| ||||| || |||||||||||  |||||||| |||| ||| |  ||||||||
Sbjct: 611 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 552

                                 
Query: 364 ttggccccgacgatgaagccga 385
           ||||| ||||||| || |||||
Sbjct: 551 ttggcgccgacgacgaggccga 530

---

>gb|AF047173.1| Vernicia fordii aquaporin mRNA, complete cds
          Length = 1049

 Score = 58.0 bits (29), Expect = 2e-05
 Identities = 134/169 (79%)
 Strand = Plus / Minus

                                                                       
Query: 260 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 319
           |||||||||||||| ||| |  |||||| |||||  | || || || ||||| ||||| |
Sbjct: 736 cccagtagatccagttgtcgtggaagtcaccgcttaccacagctggcccgaaggagcggg 677

                                                                       
Query: 320 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 379
           | |||| |||||| || || ||||| ||||| ||| | |  |||||||| || || ||||
Sbjct: 676 ctgggtacatggatccaccagagaatgggcctgcagccaaaatgttggcaccaacaatga 617

                                                            
Query: 380 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           | || ||||| ||||| || |||||||| || ||||| |||||||||||
Sbjct: 616 aaccaatggcaatgggagcaatggtgcctagtgatcctttcttggggtc 568

---

>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA,
           complete cds
          Length = 955

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 64/76 (84%)
 Strand = Plus / Minus

                                                                       
Query: 301 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 360
           ||||||||||| ||||| || |||||||||||  ||||||||||||| ||| |  |||| 
Sbjct: 708 gcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccggcgagc 649

                           
Query: 361 atgttggccccgacga 376
           | |||||| |||||||
Sbjct: 648 acgttggcgccgacga 633

---

>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds
          Length = 1047

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           ||||| |||||||| |||||||||||||||||||||
Sbjct: 788 ccacctccgatgagagggccggcccagtagatccag 753

---

>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds
          Length = 321

 Score = 56.0 bits (28), Expect = 1e-04
 Identities = 34/36 (94%)
 Strand = Plus / Minus

                                               
Query: 360 gatgttggccccgacgatgaagccgatggcgatggg 395
           ||||||||| |||||||||||||||||||| |||||
Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatggg 286

---

>gb|AC183494.1| Brassica oleracea Contig C, complete sequence
          Length = 285752

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 57/67 (85%)
 Strand = Plus / Minus

                                                                          
Query: 356    cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
              ||||||||||||| || |||||||| || || ||||| || |||||||| ||||| ||||
Sbjct: 123743 cgaggatgttggcaccaacgatgaaaccaatagcgattggtgcgatggttccgagcgatc 123684

                     
Query: 416    ccttctt 422
              | |||||
Sbjct: 123683 ctttctt 123677

---

>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds
          Length = 321

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                      
Query: 370 ccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           ||||||||||||||||||||||  || || ||||| ||||  || ||||||||||||||
Sbjct: 311 ccgacgatgaagccgatggcgactggtgcaatggttccgaacgagcccttcttggggtc 253

---

>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein
           (tip1 gene)
          Length = 1112

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 381 gccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcg 429
           ||||||||||| ||| ||||| ||||||| || ||| ||||||||||||
Sbjct: 616 gccgatggcgaggggagcgatagtgccgatggctcctttcttggggtcg 568



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 47/56 (83%)
 Strand = Plus / Minus

                                                                   
Query: 218 ggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||||||||||| | |  | ||||  || |||||| ||||||||||||||
Sbjct: 779 ggtagacgatgccggcgatggctgcaccgactagtgggccgacccagtagatccag 724

---

>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene)
          Length = 428

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 381 gccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcg 429
           ||||||||||| ||| ||||| ||||||| || ||| ||||||||||||
Sbjct: 304 gccgatggcgaggggagcgatagtgccgatggctcctttcttggggtcg 256

---

>dbj|AB206106.1| Mimosa pudica tip2;1 mRNA for tonoplast intrinsic protein 2;1,
           complete cds
          Length = 1001

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 133/169 (78%)
 Strand = Plus / Minus

                                                                       
Query: 260 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 319
           ||||||||||||||  |||||||||||| |||    |  |||| ||||||||||| || |
Sbjct: 707 cccagtagatccagtagttggtgaagtcaccggatacggcggctgggccgaatgaacggg 648

                                                                       
Query: 320 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 379
           | |||||||| ||||||||    || ||||||||| | | ||||||||| || || ||||
Sbjct: 647 ccgggttcattgaaccgccactaaatgggccggcagccaagatgttggcaccaacaatga 588

                                                            
Query: 380 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 428
           |||| || || ||||| || ||  |||| |  |||||||| ||||||||
Sbjct: 587 agcctattgcaatgggtgcaataatgcccaatgatccctttttggggtc 539

---

>gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integral protein gene, partial
            cds
          Length = 2235

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                        
Query: 337  ccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggg 396
            |||||||| || |||||  ||||||||||||| || ||||| |  || |||||||  || 
Sbjct: 2228 ccggagaatggaccggcggcgaggatgttggcaccaacgataagaccaatggcgagagga 2169

                                         
Query: 397  gcgatggtgccgagggatcccttcttggg 425
            |||||||| ||||| || |||||||||||
Sbjct: 2168 gcgatggttccgagagaacccttcttggg 2140

---

>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 58/69 (84%)
 Strand = Plus / Minus

                                                                       
Query: 360 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 419
           ||||||||| |||||||| |||||||||||||| || || || ||||| |  |  |||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggcgatcggtgcaattgtgcccaatgcaccctt 262

                    
Query: 420 cttggggtc 428
           |||||||||
Sbjct: 261 cttggggtc 253

---

>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds
          Length = 321

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 55/65 (84%)
 Strand = Plus / Minus

                                                                       
Query: 364 ttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttg 423
           ||||| |||||||| |||||||||||||| || || ||||| || || |||||||| || 
Sbjct: 317 ttggcgccgacgataaagccgatggcgattggtgcaatggttcctagtgatcccttttta 258

                
Query: 424 gggtc 428
           |||||
Sbjct: 257 gggtc 253

---

>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein
          Length = 992

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 39/44 (88%)
 Strand = Plus / Minus

                                                       
Query: 361 atgttggccccgacgatgaagccgatggcgatgggggcgatggt 404
           |||||||| ||||||||||| ||||| || ||||| ||||||||
Sbjct: 580 atgttggcaccgacgatgaatccgatcgcaatgggagcgatggt 537

---

>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene
           tip1-1)
          Length = 1104

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           ||||| ||||| || |||||||||||||||||||||
Sbjct: 755 ccaccaccgataagtgggccggcccagtagatccag 720

---

>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA,
           complete cds
          Length = 1021

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 45/52 (86%)
 Strand = Plus / Minus

                                                               
Query: 281 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 332
           |||||| ||||||| | ||||| |||||||| ||||| || |||||||||||
Sbjct: 719 tgaagtggccgctgacgacggccgggccgaacgagcgggccgggttcatgga 668

---

>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome
          Length = 4751080

 Score = 48.1 bits (24), Expect = 0.024
 Identities = 33/36 (91%)
 Strand = Plus / Minus

                                                   
Query: 365     tggccccgacgatgaagccgatggcgatgggggcga 400
               |||| ||||||||||||||| || ||||||||||||
Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981

---

>ref|XM_470886.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 1812

 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                  
Query: 272 agatgttggtgaagtcgccgctg 294
           |||||||||||||||||||||||
Sbjct: 877 agatgttggtgaagtcgccgctg 855

---

>gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone
             OSJNBa0087G11, complete sequence
          Length = 169728

 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                    
Query: 272   agatgttggtgaagtcgccgctg 294
             |||||||||||||||||||||||
Sbjct: 59831 agatgttggtgaagtcgccgctg 59853

---

>emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0004N05,
              complete sequence
          Length = 158601

 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                     
Query: 272    agatgttggtgaagtcgccgctg 294
              |||||||||||||||||||||||
Sbjct: 106408 agatgttggtgaagtcgccgctg 106430

---

>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome
          Length = 5331656

 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                     
Query: 228    gccggcgaggccaccgccgatga 250
              |||||||||||||||||||||||
Sbjct: 505313 gccggcgaggccaccgccgatga 505291



 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 228     gccggcgaggccaccgccga 247
               ||||||||||||||||||||
Sbjct: 1274146 gccggcgaggccaccgccga 1274165

---

>dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C11, full
           insert sequence
          Length = 1679

 Score = 46.1 bits (23), Expect = 0.094
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                  
Query: 272 agatgttggtgaagtcgccgctg 294
           |||||||||||||||||||||||
Sbjct: 794 agatgttggtgaagtcgccgctg 816

---

>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full
           insert sequence
          Length = 870

 Score = 46.1 bits (23), Expect = 0.094
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 219 gtagacgatgccggcgaggccaccgccgatg 249
           ||||| || ||||||||||||||||||||||
Sbjct: 622 gtagatgacgccggcgaggccaccgccgatg 592

---

>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 2 (LOC607978), mRNA
          Length = 1082

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 300 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 345
           |||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 588 ggcggggccgaaggagcgggccgggttcatggagcagccggtgaag 543

---

>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript
           variant 1 (LOC607978), mRNA
          Length = 1067

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 40/46 (86%)
 Strand = Plus / Minus

                                                         
Query: 300 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 345
           |||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 573 ggcggggccgaaggagcgggccgggttcatggagcagccggtgaag 528

---

>emb|AJ245953.1|SOL245953 Spinacia oleracea mRNA for delta tonoplast intrinsic protein (dtip
           gene)
          Length = 1101

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 43/50 (86%)
 Strand = Plus / Minus

                                                             
Query: 304 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggc 353
           ||||||||||| || || |||||||| ||||| || ||||| ||||||||
Sbjct: 713 gggccgaatgaacgggctgggttcattgaaccaccagagaacgggccggc 664

---

>dbj|AB000506.1| Carrot mRNA for root specific gene, complete cds
          Length = 992

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 97/122 (79%)
 Strand = Plus / Minus

                                                                       
Query: 304 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 363
           ||||||||||| || || |||||||| || || |||  ||| ||||| ||| | |  |||
Sbjct: 639 gggccgaatgatcgggccgggttcattgagccaccgctgaatgggccagcagccaaaatg 580

                                                                       
Query: 364 ttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttg 423
           ||||| || |||||||| || ||||| ||||| || |||||||| || || ||||| |||
Sbjct: 579 ttggcaccaacgatgaaaccaatggcaatgggtgcaatggtgcctagtgagccctttttg 520

             
Query: 424 gg 425
           ||
Sbjct: 519 gg 518

---

>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds
          Length = 321

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 360 gatgttggccccgacgatgaagccgatggc 389
           ||||||||| |||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292

---

>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds
          Length = 321

 Score = 44.1 bits (22), Expect = 0.37
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 360 gatgttggccccgacgatgaagccgatggc 389
           ||||||||| |||||||| |||||||||||
Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292

---

>ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water channel AT4G17340
           (DELTA-TIP2/TIP2;2) mRNA, complete cds
          Length = 977

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 658 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 599

                
Query: 382 ccgat 386
           |||||
Sbjct: 598 ccgat 594

---

>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence
          Length = 980

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 229 ccggcgaggccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||  |||||||||| ||| || ||||||||||||| ||||
Sbjct: 705 ccggcgattccaccgccgacgagaggtccggcccagtagacccag 661

---

>ref|XM_001003742.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 890

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 298 acggcggggccgaatgagcgtgcagggttcatggaac 334
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577

---

>ref|XM_994651.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 890

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 298 acggcggggccgaatgagcgtgcagggttcatggaac 334
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577

---

>ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquaporin 5 (LOC486551),
           mRNA
          Length = 1556

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 301 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 345
           ||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 794 gcggggccgaaagagcgggccgggttcatggagcagccggtgaag 750

---

>gb|DQ450071.1| Arachis hypogaea clone 8A4R19G1 putative major intrinsic protein
           mRNA, partial cds
          Length = 770

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 260 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 319
           ||||||||||||||   || |||||||| || |||  ||| || || || || |||||||
Sbjct: 484 cccagtagatccagtgattagtgaagtctccactgataacagcaggtccaaaggagcgtg 425

                                    
Query: 320 cagggttcatggaaccgccggagaa 344
           |||||||||| || ||||| |||||
Sbjct: 424 cagggttcattgagccgccagagaa 400

---

>gb|DQ450067.1| Arachis hypogaea clone 2A1R19GZ delta-TIP-like protein mRNA,
           partial cds
          Length = 684

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 69/85 (81%)
 Strand = Plus / Minus

                                                                       
Query: 260 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 319
           ||||||||||||||   || |||||||| || |||  ||| || || || || |||||||
Sbjct: 397 cccagtagatccagtgattagtgaagtctccactgataacagcaggtccaaaggagcgtg 338

                                    
Query: 320 cagggttcatggaaccgccggagaa 344
           |||||||||| || ||||| |||||
Sbjct: 337 cagggttcattgagccgccagagaa 313

---

>emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 8
          Length = 207674

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                         
Query: 322   gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
             |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 64861 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 64802

                  
Query: 382   ccgat 386
             |||||
Sbjct: 64801 ccgat 64797

---

>emb|Z29946.1|TRGTIPLP T.repens (Huia) mRNA for gamma-Tip-like protein
          Length = 991

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 253 gggccggcccagtagatccag 273
           |||||||||||||||||||||
Sbjct: 655 gggccggcccagtagatccag 635

---

>emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 46
          Length = 198788

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                         
Query: 322   gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
             |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 54226 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 54167

                  
Query: 382   ccgat 386
             |||||
Sbjct: 54166 ccgat 54162

---

>gb|AY056063.1| Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds
          Length = 753

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 593 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 534

                
Query: 382 ccgat 386
           |||||
Sbjct: 533 ccgat 529

---

>gb|AF367283.1|AF367283 Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds
          Length = 972

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 655 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 596

                
Query: 382 ccgat 386
           |||||
Sbjct: 595 ccgat 591

---

>dbj|AK082699.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length
           enriched library, clone:C230090D02 product:aquaporin 6,
           full insert sequence
          Length = 2066

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 298 acggcggggccgaatgagcgtgcagggttcatggaac 334
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578

---

>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 887

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 60/73 (82%)
 Strand = Plus / Minus

                                                                       
Query: 356 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 415
           |||||||||| || || |||||||| || |||||||| || ||||| || ||||| |  |
Sbjct: 448 cgaggatgttcgctccaacgatgaaacctatggcgattggtgcgattgttccgagagtgc 389

                        
Query: 416 ccttcttggggtc 428
           | |||||||||||
Sbjct: 388 cgttcttggggtc 376

---

>emb|BX825196.1|CNS0A4OU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL1ZB11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 954

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 641 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 582

                
Query: 382 ccgat 386
           |||||
Sbjct: 581 ccgat 577

---

>emb|BX828364.1|CNS0A340 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH80ZD07 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 936

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 616 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 557

                
Query: 382 ccgat 386
           |||||
Sbjct: 556 ccgat 552

---

>gb|AY088929.1| Arabidopsis thaliana clone 99796 mRNA, complete sequence
          Length = 969

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 54/65 (83%)
 Strand = Plus / Minus

                                                                       
Query: 322 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 381
           |||||||||||||| |||   ||||| || ||  ||||||||||||| || |||||||| 
Sbjct: 659 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 600

                
Query: 382 ccgat 386
           |||||
Sbjct: 599 ccgat 595

---

>emb|AJ555456.1|ECA555456 Equus caballus partial mRNA for aquaporin 5 (aqp5 gene)
          Length = 535

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Minus

                                                        
Query: 301 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 345
           ||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 534 gcggggccgaaagagcgggctgggttcatggagcagccggtgaag 490

---

>gb|AY610211.1| Sus scrofa clone Clu_9762.scr.msk.p1.Contig1, mRNA sequence
          Length = 2291

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 39/45 (86%)
 Strand = Plus / Plus

                                                         
Query: 301  gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 345
            ||||||||||| ||||| || ||||||||||| | ||||| ||||
Sbjct: 2227 gcggggccgaaagagcgggctgggttcatggagcagccggtgaag 2271

---

>gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, complete sequence
          Length = 182415

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Plus

                                                  
Query: 298   acggcggggccgaatgagcgtgcagggttcatggaac 334
             ||||| |||||||| ||||| || |||||||||||||
Sbjct: 98545 acggcagggccgaaggagcgggctgggttcatggaac 98581

---

>ref|NM_175087.2| Mus musculus aquaporin 6 (Aqp6), mRNA
          Length = 2066

 Score = 42.1 bits (21), Expect = 1.5
 Identities = 33/37 (89%)
 Strand = Plus / Minus

                                                
Query: 298 acggcggggccgaatgagcgtgcagggttcatggaac 334
           ||||| |||||||| ||||| || |||||||||||||
Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578

---

>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP)
           mRNA, complete cds
          Length = 1058

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712

---

>ref|XM_804228.1| Trypanosoma cruzi strain CL Brener hypothetical protein
            (Tc00.1047053507837.100) partial mRNA
          Length = 4953

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 381  gccgatggcgatgggggcgatggt 404
            ||||||| ||||||||||||||||
Sbjct: 4372 gccgatgacgatgggggcgatggt 4395

---

>gb|AC137077.26| Medicago truncatula clone mth2-8g15, complete sequence
          Length = 138303

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 304   gggccgaatgagcgtgcagggttcatggaacc 335
             |||||||||||||| || |||||||| |||||
Sbjct: 90944 gggccgaatgagcgagccgggttcattgaacc 90913

---

>emb|X63552.1|ATGTIPARA A.thaliana gene for tonoplast intrinsic protein gamma-TIP(Ara)
          Length = 1398

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 238  ccaccgccgatgagcgggccggcccagtagatccag 273
            |||||||||| ||| || ||||||||||||| ||||
Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097

---

>gb|AY059134.1| Arabidopsis thaliana putative aquaporin (At2g36830) mRNA, complete
           cds
          Length = 787

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 683 ccaccgccgacgagaggtccggcccagtagacccag 648

---

>gb|AF370172.1| Arabidopsis thaliana putative tonoplast intrinsic protein gamma,
           aquaporin (At2g36830) mRNA, complete cds
          Length = 1030

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 741 ccaccgccgacgagaggtccggcccagtagacccag 706

---

>emb|X54854.1|ATROOTSP A. thaliana mRNA for root-specific gene
          Length = 993

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 725 ccaccgccgacgagaggtccggcccagtagacccag 690

---

>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome
          Length = 5513844

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 228     gccggcgaggccaccgccga 247
               ||||||||||||||||||||
Sbjct: 4535021 gccggcgaggccaccgccga 4535040

---

>gb|AC006922.7| Arabidopsis thaliana chromosome 2 clone T1J8 map g6825, complete
            sequence
          Length = 134151

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 238  ccaccgccgatgagcgggccggcccagtagatccag 273
            |||||||||| ||| || ||||||||||||| ||||
Sbjct: 7442 ccaccgccgacgagaggtccggcccagtagacccag 7407

---

>gb|AC073589.6| Mus musculus strain C57BL/6J chromosome 12 clone RP23-147E23, complete
              sequence
          Length = 222430

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 39     tctgaaccaaacaacatgac 58
              ||||||||||||||||||||
Sbjct: 111593 tctgaaccaaacaacatgac 111574

---

>gb|CP000264.1| Jannaschia sp. CCS1, complete genome
          Length = 4317977

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 230     cggcgaggccaccgccgatg 249
               ||||||||||||||||||||
Sbjct: 1656225 cggcgaggccaccgccgatg 1656206

---

>emb|BX819301.1|CNS0AA93 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB66ZE04 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 996

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 722 ccaccgccgacgagaggtccggcccagtagacccag 687

---

>emb|BX819066.1|CNS0AA99 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB42ZA01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 1009

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 712 ccaccgccgacgagaggtccggcccagtagacccag 677

---

>emb|BX818765.1|CNS0AA8G Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB10ZD11 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 950

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 727 ccaccgccgacgagaggtccggcccagtagacccag 692

---

>emb|BX819619.1|CNS0A8TV Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB95ZA10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 885

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 728 ccaccgccgacgagaggtccggcccagtagacccag 693

---

>emb|BX819585.1|CNS0A8ZS Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB91ZD10 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 975

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 728 ccaccgccgacgagaggtccggcccagtagacccag 693

---

>emb|BX819242.1|CNS0A8YI Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB5ZD01 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 904

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 726 ccaccgccgacgagaggtccggcccagtagacccag 691

---

>emb|BX818836.1|CNS0A8V6 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB18ZB03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 995

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 727 ccaccgccgacgagaggtccggcccagtagacccag 692

---

>emb|BX818785.1|CNS0A8WQ Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB13ZC03 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 973

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 726 ccaccgccgacgagaggtccggcccagtagacccag 691

---

>emb|BX820166.1|CNS0A8IR Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTLS84ZH08 of Adult vegetative tissue of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 961

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 718 ccaccgccgacgagaggtccggcccagtagacccag 683

---

>gb|AY087558.1| Arabidopsis thaliana clone 36633 mRNA, complete sequence
          Length = 1042

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           |||||||||| ||| || ||||||||||||| ||||
Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712

---

>gb|AF497482.1| Micromonospora echinospora calicheamicin biosynthetic locus, complete
            sequence
          Length = 90348

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 241  ccgccgatgagcgggccggc 260
            ||||||||||||||||||||
Sbjct: 7090 ccgccgatgagcgggccggc 7109

---

>dbj|BA000040.2| Bradyrhizobium japonicum USDA 110 DNA, complete genome
          Length = 9105828

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                           
Query: 373     acgatgaagccgatggcgatgggggcga 400
               |||||||||||||| |||| ||||||||
Sbjct: 4744058 acgatgaagccgatcgcgacgggggcga 4744085

---

>dbj|AB126924.1| Prunus persica Pr-gTIP1 mRNA for tonoplast intrinsic protein,
           complete cds
          Length = 1143

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 238 ccaccgccgatgagcgggccggcccagtagatccag 273
           ||||||||||| |  || ||||||||||||||||||
Sbjct: 783 ccaccgccgatcaaaggcccggcccagtagatccag 748

---

>gb|AY596297.1| Haloarcula marismortui ATCC 43049 chromosome I, complete sequence
          Length = 3131724

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 239    caccgccgatgagcgggccg 258
              ||||||||||||||||||||
Sbjct: 557849 caccgccgatgagcgggccg 557868

---

>emb|AL646053.1| Ralstonia solanacearum GMI1000 megaplasmid complete sequence
          Length = 2094509

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                       
Query: 372     gacgatgaagccgatggcgatggg 395
               ||||||| ||||||||||||||||
Sbjct: 1047164 gacgatgtagccgatggcgatggg 1047141

---

>tpe|BN000872.1| TPA: TPA_exp: Mus musculus immunoglobulin heavy chain variable region
               locus, strain C57BL/6
          Length = 2500000

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 39      tctgaaccaaacaacatgac 58
               ||||||||||||||||||||
Sbjct: 1893522 tctgaaccaaacaacatgac 1893503

---

>gb|M84344.1|ATHGTIP Arabidopsis thaliana tonoplast intrinsic protein (gamma-TIP) gene,
            complete cds
          Length = 1398

 Score = 40.1 bits (20), Expect = 5.8
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                                
Query: 238  ccaccgccgatgagcgggccggcccagtagatccag 273
            |||||||||| ||| || ||||||||||||| ||||
Sbjct: 1132 ccaccgccgacgagaggtccggcccagtagacccag 1097


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,773,079
Number of Sequences: 3902068
Number of extensions: 2773079
Number of successful extensions: 50530
Number of sequences better than 10.0: 162
Number of HSP's better than 10.0 without gapping: 156
Number of HSP's successfully gapped in prelim test: 9
Number of HSP's that attempted gapping in prelim test: 49553
Number of HSP's gapped (non-prelim): 961
length of query: 430
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 408
effective length of database: 17,147,199,772
effective search space: 6996057506976
effective search space used: 6996057506976
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

---