ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd26e01 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AC023706.4| Drosophila melanogaster X BAC RP98-4D11 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 172854 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||||| Sbjct: 68248 tgggccgccgctgctgccgccgctg 68224
>ref|NM_001031889.1| Drosophila melanogaster CG33691-RA, transcript variant A (CG33691), mRNA Length = 4383 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||||| Sbjct: 3618 tgggccgccgctgctgccgccgctg 3594
>ref|NM_001031888.1| Drosophila melanogaster CG33691-RB, transcript variant B (CG33691), mRNA Length = 4754 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||||| Sbjct: 3989 tgggccgccgctgctgccgccgctg 3965
>ref|NM_001031887.1| Drosophila melanogaster CG33691-RC, transcript variant C (CG33691), mRNA Length = 4186 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||||| Sbjct: 3421 tgggccgccgctgctgccgccgctg 3397
>ref|NM_001031886.1| Drosophila melanogaster CG33692-RA, transcript variant A (CG33692), mRNA Length = 4383 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||||| Sbjct: 3618 tgggccgccgctgctgccgccgctg 3594
>ref|NM_001031885.1| Drosophila melanogaster CG33692-RB, transcript variant B (CG33692), mRNA Length = 4754 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||||| Sbjct: 3989 tgggccgccgctgctgccgccgctg 3965
>ref|NM_001031884.1| Drosophila melanogaster CG33692-RC, transcript variant C (CG33692), mRNA Length = 2210 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||||| Sbjct: 1445 tgggccgccgctgctgccgccgctg 1421
>gb|AY069694.1| Drosophila melanogaster LD46629 full length cDNA Length = 4375 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||||| Sbjct: 3977 tgggccgccgctgctgccgccgctg 3953
>gb|AY060337.1| Drosophila melanogaster GH23604 full length cDNA Length = 2216 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||||| Sbjct: 1444 tgggccgccgctgctgccgccgctg 1420
>gb|BT021376.1| Drosophila melanogaster LD46788 full insert cDNA Length = 4311 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||||| Sbjct: 3618 tgggccgccgctgctgccgccgctg 3594
>gb|AE003439.3| Drosophila melanogaster chromosome X, section 23 of 74 of the complete sequence Length = 331952 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||||| Sbjct: 40220 tgggccgccgctgctgccgccgctg 40196
>ref|XM_493940.1| Oryza sativa (japonica cultivar-group), Ozsa8005 predicted mRNA Length = 1449 Score = 46.1 bits (23), Expect = 0.079 Identities = 35/39 (89%) Strand = Plus / Minus Query: 264 ggtgggtacggcatgcgaggcggggccatataaccgcca 302 |||||||| ||||||||||| |||| ||| ||||||||| Sbjct: 1313 ggtgggtatggcatgcgaggtgggggcatgtaaccgcca 1275
>gb|BC082582.1| Mus musculus trans-acting transcription factor 8, mRNA (cDNA clone MGC:105193 IMAGE:30653287), complete cds Length = 4210 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 424 ggccgccgctgctgccgccgctg 402
>gb|BC061968.1| Rattus norvegicus ATPase, Na+/K+ transporting, alpha 1 polypeptide, mRNA (cDNA clone MGC:72546 IMAGE:5598014), complete cds Length = 3700 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 89 ggccgccgctgctgccgccgctg 67
>gb|BC042435.1| Mus musculus ATPase, Na+/K+ transporting, alpha 1 polypeptide, mRNA (cDNA clone MGC:37076 IMAGE:4951288), complete cds Length = 3678 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 84 ggccgccgctgctgccgccgctg 62 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 71 gccgccgctgctgccgccgctg 50
>gb|BC033471.1| Mus musculus ATPase, Na+/K+ transporting, alpha 1 polypeptide, mRNA (cDNA clone MGC:37176 IMAGE:4954119), complete cds Length = 3651 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 74 ggccgccgctgctgccgccgctg 52 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 61 gccgccgctgctgccgccgctg 40
>gb|BC033435.1| Mus musculus ATPase, Na+/K+ transporting, alpha 1 polypeptide, mRNA (cDNA clone MGC:37056 IMAGE:4950746), complete cds Length = 3608 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 30 ggccgccgctgctgccgccgctg 8
>gb|BC025627.1| Mus musculus ATPase, Na+/K+ transporting, alpha 1 polypeptide, mRNA (cDNA clone MGC:38117 IMAGE:5320513), complete cds Length = 3670 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 84 ggccgccgctgctgccgccgctg 62 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 71 gccgccgctgctgccgccgctg 50
>gb|BC021496.1| Mus musculus ATPase, Na+/K+ transporting, alpha 1 polypeptide, mRNA (cDNA clone MGC:38419 IMAGE:5346159), complete cds Length = 3669 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 84 ggccgccgctgctgccgccgctg 62 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 71 gccgccgctgctgccgccgctg 50
>gb|BC025618.1| Mus musculus ATPase, Na+/K+ transporting, alpha 1 polypeptide, mRNA (cDNA clone MGC:38134 IMAGE:5320976), complete cds Length = 3686 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 93 ggccgccgctgctgccgccgctg 71 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 80 gccgccgctgctgccgccgctg 59
>gb|BC025811.1| Mus musculus ATPase, Na+/K+ transporting, alpha 1 polypeptide, mRNA (cDNA clone MGC:37763 IMAGE:5096872), complete cds Length = 3648 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 71 ggccgccgctgctgccgccgctg 49 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 58 gccgccgctgctgccgccgctg 37
>ref|NM_177082.3| Mus musculus trans-acting transcription factor 8 (Sp8), mRNA Length = 4301 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 369 ggccgccgctgctgccgccgctg 347
>ref|NM_144900.1| Mus musculus ATPase, Na+/K+ transporting, alpha 1 polypeptide (Atp1a1), mRNA Length = 3686 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 93 ggccgccgctgctgccgccgctg 71 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 80 gccgccgctgctgccgccgctg 59
>gb|BC069867.1| Mus musculus cDNA sequence BC020402, mRNA (cDNA clone IMAGE:4949173), partial cds Length = 1940 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 72 ggccgccgctgctgccgccgctg 50 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 59 gccgccgctgctgccgccgctg 38
>gb|AC131717.3| Mus musculus chromosome 12 clone RP23-167A18, complete sequence Length = 190372 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 159876 ggccgccgctgctgccgccgctg 159854
>gb|BT011116.1| Drosophila melanogaster LD16337 full insert cDNA Length = 3622 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgc 139 ||||||||||||||||||||||| Sbjct: 763 tgggccgccgctgctgccgccgc 741
>gb|BC023964.1| Mus musculus ATPase, Na+/K+ transporting, alpha 1 polypeptide, mRNA (cDNA clone IMAGE:5324408), containing frame-shift errors Length = 3678 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 74 ggccgccgctgctgccgccgctg 52 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 61 gccgccgctgctgccgccgctg 40
>gb|AC126277.3| Mus musculus BAC clone RP23-161L22 from 12, complete sequence Length = 191231 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 15624 ggccgccgctgctgccgccgctg 15602
>emb|CR555306.1| Azoarcus sp. EbN1 complete genome Length = 4296230 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 125 cgctgctgccgccgctggcggtg 147 ||||||||||||||||||||||| Sbjct: 3544791 cgctgctgccgccgctggcggtg 3544813
>emb|BX640440.1| Bordetella bronchiseptica strain RB50, complete genome; segment 4/16 Length = 349497 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctgg 142 ||||||||||||||||||||||| Sbjct: 278514 gccgccgctgctgccgccgctgg 278536
>emb|BX640426.1| Bordetella parapertussis strain 12822, complete genome; segment 4/14 Length = 348866 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctgg 142 ||||||||||||||||||||||| Sbjct: 43221 gccgccgctgctgccgccgctgg 43243
>emb|AJ844914.1| Mus musculus mRNA for transcription factor Sp8 (Sp8 gene) Length = 1511 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 237 ggccgccgctgctgccgccgctg 215
>gb|AC011905.4| Drosophila melanogaster 3L BAC RP98-27A3 (Roswell Park Cancer Institute Drosophila BAC Library) complete sequence Length = 192681 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 117 tgggccgccgctgctgccgccgc 139 ||||||||||||||||||||||| Sbjct: 105255 tgggccgccgctgctgccgccgc 105277
>ref|NM_206252.2| Drosophila melanogaster misshapen CG16973-RB, transcript variant B (msn), mRNA Length = 4578 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgc 139 ||||||||||||||||||||||| Sbjct: 1444 tgggccgccgctgctgccgccgc 1422
>ref|NM_206251.2| Drosophila melanogaster misshapen CG16973-RD, transcript variant D (msn), mRNA Length = 4284 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgc 139 ||||||||||||||||||||||| Sbjct: 1444 tgggccgccgctgctgccgccgc 1422
>ref|NM_206250.2| Drosophila melanogaster misshapen CG16973-RC, transcript variant C (msn), mRNA Length = 4267 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgc 139 ||||||||||||||||||||||| Sbjct: 1427 tgggccgccgctgctgccgccgc 1405
>ref|NM_206249.2| Drosophila melanogaster misshapen CG16973-RE, transcript variant E (msn), mRNA Length = 4104 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgc 139 ||||||||||||||||||||||| Sbjct: 1444 tgggccgccgctgctgccgccgc 1422
>ref|NM_079940.4| Drosophila melanogaster misshapen CG16973-RA, transcript variant A (msn), mRNA Length = 5490 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 117 tgggccgccgctgctgccgccgc 139 ||||||||||||||||||||||| Sbjct: 1444 tgggccgccgctgctgccgccgc 1422
>dbj|AK137001.1| Mus musculus 12 days embryo embryonic body between diaphragm region and neck cDNA, RIKEN full-length enriched library, clone:9430031E02 product:ATPase, Na+/K+ transporting, alpha 1 polypeptide, full insert sequence Length = 3656 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 93 ggccgccgctgctgccgccgctg 71 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 80 gccgccgctgctgccgccgctg 59
>ref|NM_012504.1| Rattus norvegicus ATPase, Na+/K+ transporting, alpha 1 polypeptide (Atp1a1), mRNA Length = 3636 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 78 ggccgccgctgctgccgccgctg 56
>dbj|AK159306.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420015E23 product:ATPase, Na+/K+ transporting, alpha 1 polypeptide, full insert sequence Length = 3650 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 91 ggccgccgctgctgccgccgctg 69 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 78 gccgccgctgctgccgccgctg 57
>dbj|AK159279.1| Mus musculus osteoclast-like cell cDNA, RIKEN full-length enriched library, clone:I420013N16 product:ATPase, Na+/K+ transporting, alpha 1 polypeptide, full insert sequence Length = 3653 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 91 ggccgccgctgctgccgccgctg 69 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 78 gccgccgctgctgccgccgctg 57
>dbj|AK147554.1| Mus musculus cDNA, RIKEN full-length enriched library, clone:M5C1075M18 product:Warning: possibly chimeric clone, full insert sequence Length = 7118 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 3557 ggccgccgctgctgccgccgctg 3535 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 3544 gccgccgctgctgccgccgctg 3523
>dbj|AK088000.1| Mus musculus 2 days neonate thymus thymic cells cDNA, RIKEN full-length enriched library, clone:E430002A21 product:ATPase, Na+/K+ transporting, alpha 1 polypeptide, full insert sequence Length = 3657 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 95 ggccgccgctgctgccgccgctg 73 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 82 gccgccgctgctgccgccgctg 61
>dbj|AK030745.1| Mus musculus 8 days embryo whole body cDNA, RIKEN full-length enriched library, clone:5730507L14 product:hypothetical Protein kinase-like (PK-like) structure containing protein, full insert sequence Length = 4301 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 369 ggccgccgctgctgccgccgctg 347
>dbj|AK053093.1| Mus musculus 15 days embryo head cDNA, RIKEN full-length enriched library, clone:D930049B17 product:weakly similar to C2H2 ZINC FINGER TRANSCRIPTION FACTOR [Drosophila melanogaster], full insert sequence Length = 3659 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 550 ggccgccgctgctgccgccgctg 528
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 46.1 bits (23), Expect = 0.079 Identities = 35/39 (89%) Strand = Plus / Plus Query: 264 ggtgggtacggcatgcgaggcggggccatataaccgcca 302 |||||||| ||||||||||| |||| ||| ||||||||| Sbjct: 3536343 ggtgggtatggcatgcgaggtgggggcatgtaaccgcca 3536381 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgct 140 ||||||||||||||||||||| Sbjct: 17300461 gccgccgctgctgccgccgct 17300441
>dbj|AP002071.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0675A05 Length = 131972 Score = 46.1 bits (23), Expect = 0.079 Identities = 35/39 (89%) Strand = Plus / Plus Query: 264 ggtgggtacggcatgcgaggcggggccatataaccgcca 302 |||||||| ||||||||||| |||| ||| ||||||||| Sbjct: 28180 ggtgggtatggcatgcgaggtgggggcatgtaaccgcca 28218
>dbj|AK120360.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013067M02, full insert sequence Length = 2047 Score = 46.1 bits (23), Expect = 0.079 Identities = 35/39 (89%) Strand = Plus / Minus Query: 264 ggtgggtacggcatgcgaggcggggccatataaccgcca 302 |||||||| ||||||||||| |||| ||| ||||||||| Sbjct: 1379 ggtgggtatggcatgcgaggtgggggcatgtaaccgcca 1341
>dbj|AK111997.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-D10, full insert sequence Length = 1637 Score = 46.1 bits (23), Expect = 0.079 Identities = 35/39 (89%) Strand = Plus / Minus Query: 264 ggtgggtacggcatgcgaggcggggccatataaccgcca 302 |||||||| ||||||||||| |||| ||| ||||||||| Sbjct: 1087 ggtgggtatggcatgcgaggtgggggcatgtaaccgcca 1049
>gb|BC032187.1| Mus musculus ATPase, Na+/K+ transporting, alpha 1 polypeptide, mRNA (cDNA clone MGC:38145 IMAGE:5321268), complete cds Length = 3733 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 134 ggccgccgctgctgccgccgctg 112 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 121 gccgccgctgctgccgccgctg 100
>emb|X53233.1|RNNKAA1A Rat NKAA1 gene for Na+/K+ -ATPase alpha1 subunit 5' flank and exon 1 Length = 2070 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 1640 ggccgccgctgctgccgccgctg 1618
>gb|AE003475.4| Drosophila melanogaster chromosome 3L, section 9 of 83 of the complete sequence Length = 301691 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 117 tgggccgccgctgctgccgccgc 139 ||||||||||||||||||||||| Sbjct: 101627 tgggccgccgctgctgccgccgc 101649
>gb|AC131658.3| Mus musculus BAC clone RP23-239F24 from 3, complete sequence Length = 200955 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Plus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 107645 ggccgccgctgctgccgccgctg 107667 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 107658 gccgccgctgctgccgccgctg 107679
>gb|M14511.1|RATATPA1 Rat Na+,K+-ATPase alpha isoform catalytic subunit mRNA, complete cds Length = 3636 Score = 46.1 bits (23), Expect = 0.079 Identities = 23/23 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgctg 141 ||||||||||||||||||||||| Sbjct: 78 ggccgccgctgctgccgccgctg 56
>gb|AY821556.1| Macaca mulatta tissue inhibitor of metalloproteinase 3 (TIMP3) mRNA, complete cds Length = 704 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 41 gccgctgctgccgccgctgccgg-ggctgctgct 9
>ref|XM_515097.1| PREDICTED: Pan troglodytes similar to tissue inhibitor of metalloproteinase 3; Tissue inhibitor of metalloproteinase-3; K222 expressed in degenerative retinas (LOC458784), mRNA Length = 1767 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 962 gccgctgctgccgccgctgccgg-ggctgctgct 930
>ref|XM_472404.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1347 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 191 gccgccgctgctgccgccgctg 170
>ref|XM_524650.1| PREDICTED: Pan troglodytes similar to ZBTB8 protein (LOC469265), mRNA Length = 4248 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 1745 gccgccgctgctgccgccgctg 1724
>gb|AC168278.2| Mus musculus BAC RP24-83C9 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 247493 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 16177 gccgccgctgctgccgccgctg 16156
>ref|NM_008900.1| Mus musculus POU domain, class 3, transcription factor 3 (Pou3f3), mRNA Length = 1488 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 313 gccgccgctgctgccgccgctg 334
>gb|AC100208.16| Mus musculus chromosome 7, clone RP23-59J14, complete sequence Length = 280763 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 60149 gccgccgctgctgccgccgctg 60128
>ref|NM_001032956.1| Macaca mulatta tissue inhibitor of metalloproteinase 3 (TIMP3), mRNA Length = 704 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 41 gccgctgctgccgccgctgccgg-ggctgctgct 9
>gb|AC129300.3| Mus musculus BAC clone RP24-427A8 from chromosome 7, complete sequence Length = 155123 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 21714 gccgccgctgctgccgccgctg 21735
>gb|AC122898.4| Mus musculus BAC clone RP23-71K9 from 1, complete sequence Length = 230945 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 35246 gccgccgctgctgccgccgctg 35225
>gb|BC013086.1| Homo sapiens mRNA similar to tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory) (cDNA clone IMAGE:4154199) Length = 1417 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 288 gccgctgctgccgccgctgccgg-ggctgctgct 256
>gb|BC107101.1| Homo sapiens neuropeptides B/W receptor 1, mRNA (cDNA clone MGC:129755 IMAGE:40015959), complete cds Length = 995 Score = 44.1 bits (22), Expect = 0.31 Identities = 28/30 (93%) Strand = Plus / Plus Query: 122 cgccgctgctgccgccgctggcggtggctg 151 ||||||||| | |||||||||||||||||| Sbjct: 89 cgccgctgccggcgccgctggcggtggctg 118
>emb|AL356986.11| Human DNA sequence from clone RP11-395N6 on chromosome 1 Contains the 5' end of a known gene (FLJ10276), a glyceraldehyde-3-phosphate dehydrogenase (GAPD) pseudogene, a novel pseudogene, the 5' end of the ZBTB8 gene for zinc finger and BTB domain containing 8 and five CpG islands, complete sequence Length = 98390 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 78613 gccgccgctgctgccgccgctg 78592
>emb|AL023282.1|HS766E1 Human DNA sequence from clone CTA-766E1 on chromosome 22q12.1-12.3 Contains the 5' end of the TIMP3 gene for tissue inhibitor of metalloproteinase 3 (Sorsby fundus dystrophy, pseudoinflammatory) and a CpG island, complete sequence Length = 8983 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 5554 gccgctgctgccgccgctgccgg-ggctgctgct 5522
>emb|X76227.1|HSTIMP3 H.sapiens TIMP3 mRNA for tissue inhibitor of metalloproteinases-3 Length = 1021 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 69 gccgctgctgccgccgctgccgg-ggctgctgct 37
>emb|AL662947.3|OSJN00148 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0073L04, complete sequence Length = 143301 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 133534 gccgccgctgctgccgccgctg 133513
>emb|AL662945.3|OSJN00141 Oryza sativa genomic DNA, chromosome 4, BAC clone: OJ000126_13, complete sequence Length = 113960 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 16321 gccgccgctgctgccgccgctg 16300
>gb|AC009800.13| Homo sapiens chromosome 8, clone RP11-182E14, complete sequence Length = 167249 Score = 44.1 bits (22), Expect = 0.31 Identities = 28/30 (93%) Strand = Plus / Plus Query: 122 cgccgctgctgccgccgctggcggtggctg 151 ||||||||| | |||||||||||||||||| Sbjct: 76754 cgccgctgccggcgccgctggcggtggctg 76783
>gb|AC087348.6| Homo sapiens chromosome 8, clone RP11-333H13, complete sequence Length = 173380 Score = 44.1 bits (22), Expect = 0.31 Identities = 28/30 (93%) Strand = Plus / Minus Query: 122 cgccgctgctgccgccgctggcggtggctg 151 ||||||||| | |||||||||||||||||| Sbjct: 33471 cgccgctgccggcgccgctggcggtggctg 33442
>gb|CP000301.1| Rhodopseudomonas palustris BisB18, complete genome Length = 5513844 Score = 44.1 bits (22), Expect = 0.31 Identities = 25/26 (96%) Strand = Plus / Plus Query: 122 cgccgctgctgccgccgctggcggtg 147 ||||||||| |||||||||||||||| Sbjct: 890723 cgccgctgcagccgccgctggcggtg 890748 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggc 143 ||||||||||||||||||||| Sbjct: 1142238 gccgctgctgccgccgctggc 1142218
>gb|AC183302.2| Pan troglodytes BAC clone CH251-258O5 from chromosome unknown, complete sequence Length = 211208 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Plus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 193637 gccgctgctgccgccgctgccgg-ggctgctgct 193669
>emb|CR625951.1| full-length cDNA clone CS0DE012YE03 of Placenta of Homo sapiens (human) Length = 2070 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 283 gccgctgctgccgccgctgccgg-ggctgctgct 251
>emb|CR625847.1| full-length cDNA clone CS0DE009YI03 of Placenta of Homo sapiens (human) Length = 2093 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 283 gccgctgctgccgccgctgccgg-ggctgctgct 251
>emb|CR625842.1| full-length cDNA clone CS0DI026YM10 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2065 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 283 gccgctgctgccgccgctgccgg-ggctgctgct 251
>emb|CR623084.1| full-length cDNA clone CS0DE007YK08 of Placenta of Homo sapiens (human) Length = 1724 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 274 gccgctgctgccgccgctgccgg-ggctgctgct 242
>ref|NM_000362.4| Homo sapiens TIMP metallopeptidase inhibitor 3 (Sorsby fundus dystrophy, pseudoinflammatory) (TIMP3), mRNA Length = 5496 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 1185 gccgctgctgccgccgctgccgg-ggctgctgct 1153
>emb|CR621505.1| full-length cDNA clone CS0DC014YN16 of Neuroblastoma Cot 25-normalized of Homo sapiens (human) Length = 2485 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 281 gccgctgctgccgccgctgccgg-ggctgctgct 249
>emb|CR620436.1| full-length cDNA clone CS0DI061YH12 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2079 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 284 gccgctgctgccgccgctgccgg-ggctgctgct 252
>emb|CR617989.1| full-length cDNA clone CS0DI053YK05 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2099 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 283 gccgctgctgccgccgctgccgg-ggctgctgct 251
>emb|CR615534.1| full-length cDNA clone CS0DI081YA05 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2094 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 292 gccgctgctgccgccgctgccgg-ggctgctgct 260
>emb|CR615393.1| full-length cDNA clone CS0DE011YB19 of Placenta of Homo sapiens (human) Length = 2069 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 284 gccgctgctgccgccgctgccgg-ggctgctgct 252
>emb|CR616306.1| full-length cDNA clone CS0DI070YK11 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2056 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 284 gccgctgctgccgccgctgccgg-ggctgctgct 252
>emb|CR613766.1| full-length cDNA clone CS0DK004YG15 of HeLa cells Cot 25-normalized of Homo sapiens (human) Length = 2101 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 281 gccgctgctgccgccgctgccgg-ggctgctgct 249
>emb|CR610281.1| full-length cDNA clone CS0DI016YC12 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 1499 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 292 gccgctgctgccgccgctgccgg-ggctgctgct 260
>dbj|AK092326.1| Homo sapiens cDNA FLJ35007 fis, clone OCBBF2012095, weakly similar to ZINC FINGER PROTEIN 151 Length = 3036 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 548 gccgccgctgctgccgccgctg 527
>emb|CR607327.1| full-length cDNA clone CS0DI066YH11 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2431 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 279 gccgctgctgccgccgctgccgg-ggctgctgct 247
>emb|CR605518.1| full-length cDNA clone CS0DI020YH01 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2067 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 279 gccgctgctgccgccgctgccgg-ggctgctgct 247
>emb|CR604843.1| full-length cDNA clone CS0DI078YL02 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2460 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 283 gccgctgctgccgccgctgccgg-ggctgctgct 251
>emb|CR603101.1| full-length cDNA clone CS0DI005YK02 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2441 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 281 gccgctgctgccgccgctgccgg-ggctgctgct 249
>emb|CR602193.1| full-length cDNA clone CS0DI073YH01 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2087 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 288 gccgctgctgccgccgctgccgg-ggctgctgct 256
>emb|CR597142.1| full-length cDNA clone CS0DI082YB07 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2077 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 281 gccgctgctgccgccgctgccgg-ggctgctgct 249
>emb|CR596287.1| full-length cDNA clone CS0DI035YO15 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2074 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 283 gccgctgctgccgccgctgccgg-ggctgctgct 251
>emb|CR595938.1| full-length cDNA clone CS0DE001YH11 of Placenta of Homo sapiens (human) Length = 2091 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 284 gccgctgctgccgccgctgccgg-ggctgctgct 252
>emb|CR595883.1| full-length cDNA clone CS0DE010YF23 of Placenta of Homo sapiens (human) Length = 2077 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 279 gccgctgctgccgccgctgccgg-ggctgctgct 247
>emb|CR594958.1| full-length cDNA clone CS0DE007YE10 of Placenta of Homo sapiens (human) Length = 2107 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 282 gccgctgctgccgccgctgccgg-ggctgctgct 250
>emb|CR594502.1| full-length cDNA clone CS0DI061YO10 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2506 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 288 gccgctgctgccgccgctgccgg-ggctgctgct 256
>emb|CR593651.1| full-length cDNA clone CS0DI030YL09 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2086 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 279 gccgctgctgccgccgctgccgg-ggctgctgct 247
>emb|CR593019.1| full-length cDNA clone CS0DI026YP18 of Placenta Cot 25-normalized of Homo sapiens (human) Length = 2099 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 283 gccgctgctgccgccgctgccgg-ggctgctgct 251
>gb|AC116608.1| Papio hamadryas chromosome , clone RP41-155I24, complete sequence Length = 161654 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 62797 gccgccgctgctgccgccgctg 62818
>dbj|AK141224.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:C330017C24 product:dedicator of cyto-kinesis 1, full insert sequence Length = 977 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 82 gccgccgctgctgccgccgctg 61
>ref|NM_001033420.1| Mus musculus dedicator of cyto-kinesis 1 (Dock1), mRNA Length = 6815 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 86 gccgccgctgctgccgccgctg 65
>dbj|AK164963.1| Mus musculus 0 day neonate eyeball cDNA, RIKEN full-length enriched library, clone:E130009E04 product:dedicator of cyto-kinesis 1, full insert sequence Length = 3719 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 68 gccgccgctgctgccgccgctg 47
>dbj|AK163853.1| Mus musculus 16 days embryo head cDNA, RIKEN full-length enriched library, clone:C130086K10 product:dedicator of cyto-kinesis 1, full insert sequence Length = 2586 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 87 gccgccgctgctgccgccgctg 66
>ref|NM_005285.3| Homo sapiens neuropeptides B/W receptor 1 (NPBWR1), mRNA Length = 987 Score = 44.1 bits (22), Expect = 0.31 Identities = 28/30 (93%) Strand = Plus / Plus Query: 122 cgccgctgctgccgccgctggcggtggctg 151 ||||||||| | |||||||||||||||||| Sbjct: 89 cgccgctgccggcgccgctggcggtggctg 118
>gb|AC155321.2| Pan troglodytes BAC clone CH251-489N11 from chromosome unknown, complete sequence Length = 202104 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Plus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 15067 gccgctgctgccgccgctgccgg-ggctgctgct 15099
>gb|S78453.1| TIMP-3=tissue inhibitor of metalloproteinases-3 [human, THP-1 cells, mRNA, 1284 nt] Length = 1284 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 275 gccgctgctgccgccgctgccgg-ggctgctgct 243
>dbj|AK052606.1| Mus musculus 0 day neonate kidney cDNA, RIKEN full-length enriched library, clone:D630004B07 product:DOCK180 PROTEIN homolog [Homo sapiens], full insert sequence Length = 3282 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 120 gccgccgctgctgccgccgctg 99
>dbj|AK041914.1| Mus musculus 3 days neonate thymus cDNA, RIKEN full-length enriched library, clone:A630046J22 product:DOCK180 PROTEIN homolog [Homo sapiens], full insert sequence Length = 3803 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 83 gccgccgctgctgccgccgctg 62
>dbj|AK082835.1| Mus musculus ES cells cDNA, RIKEN full-length enriched library, clone:C330037G01 product:hypothetical Src homology 3 (SH3) domain profile/Repeat in HS1/Cortactin/Src homology 3 (SH3) domain containing protein, full insert sequence Length = 977 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 82 gccgccgctgctgccgccgctg 61
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 20402901 gccgccgctgctgccgccgctg 20402880 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 22921451 gccgccgctgctgccgccgc 22921470
>gb|AY207381.1|AY207381S1 Macaca fascicularis tissue inhibitor of metalloproteinase 3 (TIMP3) gene, exon 1 Length = 666 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 334 gccgctgctgccgccgctgccgg-ggctgctgct 302
>ref|XM_223485.3| PREDICTED: Rattus norvegicus G protein-coupled receptor 125 (predicted) (Gpr125_predicted), mRNA Length = 4689 Score = 44.1 bits (22), Expect = 0.31 Identities = 25/26 (96%) Strand = Plus / Plus Query: 119 ggccgccgctgctgccgccgctggcg 144 ||||||||||||||| |||||||||| Sbjct: 461 ggccgccgctgctgctgccgctggcg 486
>ref|XM_236346.3| PREDICTED: Rattus norvegicus putative neuronal cell adhesion molecule (predicted) (Punc_predicted), mRNA Length = 2757 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 420 gccgccgctgctgccgccgctg 441
>gb|AF546188.1| Contiguous genomic DNA sequence comprising the 19-kDa-zein gene family from Zea mays, complete sequence Length = 203363 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 17101 gccgccgctgctgccgccgctg 17080
>dbj|AK110395.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-F01, full insert sequence Length = 2844 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 379 gccgccgctgctgccgccgctg 400
>gb|BC033145.1| Homo sapiens cDNA clone IMAGE:4040710, with apparent retained intron Length = 2724 Score = 44.1 bits (22), Expect = 0.31 Identities = 28/30 (93%) Strand = Plus / Minus Query: 122 cgccgctgctgccgccgctggcggtggctg 151 ||||||||| | |||||||||||||||||| Sbjct: 1122 cgccgctgccggcgccgctggcggtggctg 1093
>gb|AC133952.4| Mus musculus BAC clone RP23-114H2 from 1, complete sequence Length = 236382 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 71270 gccgccgctgctgccgccgctg 71291
>dbj|AK060508.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-B12, full insert sequence Length = 1751 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 379 gccgccgctgctgccgccgctg 358
>gb|AC154011.3| Mus musculus 6 BAC RP24-261O15 (Roswell Park Cancer Institute (C57BL/6J Male) Mouse BAC Library) complete sequence Length = 146781 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 89772 gccgccgctgctgccgccgctg 89793
>emb|CR456593.1| Homo sapiens TIMP3 full length open reading frame (ORF) cDNA clone (cDNA clone C22ORF:pGEM.TIMP3.V2) Length = 863 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 47 gccgctgctgccgccgctgccgg-ggctgctgct 15
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 127 ctgctgccgccgctggcggtgg 148 |||||||||||||||||||||| Sbjct: 3953217 ctgctgccgccgctggcggtgg 3953196 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Minus Query: 128 tgctgccgccgctggcggtggc 149 |||||||||||||||||||||| Sbjct: 480815 tgctgccgccgctggcggtggc 480794 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 129 gctgccgccgctggcggtggc 149 ||||||||||||||||||||| Sbjct: 481246 gctgccgccgctggcggtggc 481226 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 122 cgccgctgctgccgccgctg 141 |||||||||||||||||||| Sbjct: 4660664 cgccgctgctgccgccgctg 4660645 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 127 ctgctgccgccgctggcggtggct 150 |||||||||| ||||||||||||| Sbjct: 4597861 ctgctgccgcggctggcggtggct 4597838 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 2188341 gccgccgctgctgccgccgc 2188360
>gb|U33110.1|HSTIMP3G1 Human tissue inhibitor of metalloproteinases-3 (TIMP3) gene, exon 1 Length = 1344 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 1182 gccgctgctgccgccgctgccgg-ggctgctgct 1150
>gb|U22491.1|HSU22491 Human G protein-coupled receptor (GPR7), complete cds Length = 1596 Score = 44.1 bits (22), Expect = 0.31 Identities = 28/30 (93%) Strand = Plus / Plus Query: 122 cgccgctgctgccgccgctggcggtggctg 151 ||||||||| | |||||||||||||||||| Sbjct: 614 cgccgctgccggcgccgctggcggtggctg 643
>gb|BC014277.2| Homo sapiens TIMP metallopeptidase inhibitor 3 (Sorsby fundus dystrophy, pseudoinflammatory), mRNA (cDNA clone MGC:11079 IMAGE:3689386), complete cds Length = 2533 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 242 gccgctgctgccgccgctgccgg-ggctgctgct 210
>gb|AF001361.1|AF001361 Homo sapiens tissue inhibitor of metalloproteinases-3 (TIMP-3) gene, 5' flanking region and partial cds Length = 1300 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 1293 gccgctgctgccgccgctgccgg-ggctgctgct 1261
>gb|U14394.1|HSU14394 Human tissue inhibitor of metalloproteinases-3 mRNA, complete cds Length = 4587 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 286 gccgctgctgccgccgctgccgg-ggctgctgct 254
>gb|U67195.1|HSU67195 Human tissue inhibitor of metalloproteinase-3 mRNA, complete cds Length = 1240 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 277 gccgctgctgccgccgctgccgg-ggctgctgct 245
>gb|M88299.1|MUSPOUDOMA Mouse brain-1 POU-domain protein, complete cds Length = 4000 Score = 44.1 bits (22), Expect = 0.31 Identities = 22/22 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctg 141 |||||||||||||||||||||| Sbjct: 2313 gccgccgctgctgccgccgctg 2334
>gb|U02571.1|HSU02571 Human tissue inhibitor of metalloproteinase-3 precursor (TIMP-3) mRNA, complete cds Length = 1222 Score = 44.1 bits (22), Expect = 0.31 Identities = 32/34 (94%), Gaps = 1/34 (2%) Strand = Plus / Minus Query: 123 gccgctgctgccgccgctggcggtggctgctgct 156 ||||||||||||||||||| ||| |||||||||| Sbjct: 280 gccgctgctgccgccgctgccgg-ggctgctgct 248
>gb|AC126606.16| Mus musculus chromosome 1, clone RP24-68C1, complete sequence Length = 192150 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctggcg 144 |||||||| |||||||||||||||| Sbjct: 43016 gccgccgccgctgccgccgctggcg 43040
>gb|BC067670.1| Danio rerio purine-rich element binding protein B, mRNA (cDNA clone IMAGE:6966440), partial cds Length = 1824 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 48 ggccgccgctgctgccgccgc 28
>gb|AC133004.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0046F10, complete sequence Length = 184041 Score = 42.1 bits (21), Expect = 1.2 Identities = 27/29 (93%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctggcggtgg 148 |||||||| || ||||||||||||||||| Sbjct: 64856 gccgccgccgccgccgccgctggcggtgg 64884
>gb|AC009462.7| Drosophila melanogaster clone BACR27G04, complete sequence Length = 151609 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 73644 ggccgccgctgctgccgccgc 73624
>gb|BC003243.1| Mus musculus zinc finger protein 281, mRNA (cDNA clone MGC:7737 IMAGE:3498439), complete cds Length = 3146 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctggcg 144 |||||||| |||||||||||||||| Sbjct: 234 gccgccgccgctgccgccgctggcg 210
>ref|XM_957476.1| Neurospora crassa OR74A hypothetical protein (NCU06307.1) partial mRNA Length = 1260 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 411 ggccgccgctgctgccgccgc 431
>ref|XM_326161.1| Neurospora crassa OR74A hypothetical protein (NCU06307.1) partial mRNA Length = 1260 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 411 ggccgccgctgctgccgccgc 431
>ref|NM_024496.2| Homo sapiens chromosome 14 open reading frame 4 (C14orf4), mRNA Length = 4166 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 1190 ggccgccgctgctgccgccgc 1170
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 121 ccgccgctgctgccgccgctg 141 ||||||||||||||||||||| Sbjct: 10878494 ccgccgctgctgccgccgctg 10878514
>ref|XM_534002.2| PREDICTED: Canis familiaris similar to remodeling and spacing factor 1, transcript variant 1 (LOC476797), mRNA Length = 5105 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 141 ggccgccgctgctgccgccgc 121
>emb|AJ277365.1|HSA277365 Homo sapiens polyglutamine-containing C14ORF4 gene Length = 4959 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 1298 ggccgccgctgctgccgccgc 1278
>gb|AC130538.4| Mus musculus BAC clone RP23-450E2 from chromosome 7, complete sequence Length = 169082 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 203 tgaactcccttgtggctgctg 223 ||||||||||||||||||||| Sbjct: 29162 tgaactcccttgtggctgctg 29142
>emb|CT010200.1| Mus musculus full open reading frame cDNA clone RZPDo836F0850D for gene Zfp281, Zinc finger protein 281; complete cds, incl. stopcodon Length = 2682 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctggcg 144 |||||||| |||||||||||||||| Sbjct: 108 gccgccgccgctgccgccgctggcg 84
>ref|XM_723587.1| Plasmodium yoelii yoelii str. 17XNL hypothetical protein (PY07723) partial mRNA Length = 982 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 129 gctgccgccgctggcggtggc 149 ||||||||||||||||||||| Sbjct: 831 gctgccgccgctggcggtggc 851
>emb|AL591890.31| Human DNA sequence from clone RP11-54A22 on chromosome 9 Contains three novel genes, and the 5' end of the COL5A1 gene for collagen (type V) alpha 1, and a CpG island, complete sequence Length = 173415 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 310 gtgggggtgggtagtatggag 330 ||||||||||||||||||||| Sbjct: 12327 gtgggggtgggtagtatggag 12307
>emb|AL355341.19| Human DNA sequence from clone RP11-146P21 on chromosome 10 Contains the 3'end of the PLCE1 gene for phospholipase C, epsilon 1 (PLCE, KIAA1516), the gene for AD24 protein (FLJ12820), the 5'end of a novel gene (KIAA0608) and a CpG island, complete sequence Length = 153449 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 309 ggtgggggtgggtagtatgga 329 ||||||||||||||||||||| Sbjct: 23562 ggtgggggtgggtagtatgga 23542
>gb|AC134769.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1145F05, from chromosome 3, complete sequence Length = 127348 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 121 ccgccgctgctgccgccgctg 141 ||||||||||||||||||||| Sbjct: 102535 ccgccgctgctgccgccgctg 102515
>gb|BC062153.1| Mus musculus zinc finger protein 281, mRNA (cDNA clone MGC:70044 IMAGE:6335572), complete cds Length = 3155 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctggcg 144 |||||||| |||||||||||||||| Sbjct: 227 gccgccgccgctgccgccgctggcg 203
>gb|AY714498.1| Paracentrotus lividus PITX2 mRNA, complete cds Length = 3030 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctggcg 144 ||||||||||||||||||| ||||| Sbjct: 952 gccgccgctgctgccgccgttggcg 976
>dbj|AP008229.1| Xanthomonas oryzae pv. oryzae MAFF 311018 DNA, complete genome Length = 4940217 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 128 tgctgccgccgctggcggtgg 148 ||||||||||||||||||||| Sbjct: 1875362 tgctgccgccgctggcggtgg 1875382
>gb|CP000239.1| Synechococcus sp. JA-3-3Ab, complete genome Length = 2932766 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgct 140 ||||||||||||||||||||| Sbjct: 1188778 gccgccgctgctgccgccgct 1188798
>gb|AY118546.1| Drosophila melanogaster LD29902 full insert cDNA Length = 3289 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 1264 ggccgccgctgctgccgccgc 1244
>gb|AE011947.1| Xanthomonas axonopodis pv. citri str. 306, section 325 of 469 of the complete genome Length = 11250 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 128 tgctgccgccgctggcggtgg 148 ||||||||||||||||||||| Sbjct: 9757 tgctgccgccgctggcggtgg 9737
>gb|AC106038.3| Homo sapiens chromosome 8, clone RP11-68L18, complete sequence Length = 159024 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 63055 ggccgccgctgctgccgccgc 63035
>ref|NM_169790.1| Drosophila melanogaster PP2A-B' CG7913-RA, transcript variant A (PP2A-B'), mRNA Length = 3269 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 1264 ggccgccgctgctgccgccgc 1244
>ref|NM_169789.1| Drosophila melanogaster PP2A-B' CG7913-RB, transcript variant B (PP2A-B'), mRNA Length = 3220 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 1264 ggccgccgctgctgccgccgc 1244
>ref|NM_137672.1| Drosophila melanogaster CG15225-RA (CG15225), mRNA Length = 720 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 308 tggtgggggtgggtagtatgg 328 ||||||||||||||||||||| Sbjct: 615 tggtgggggtgggtagtatgg 595
>gb|AC093329.6| Homo sapiens chromosome 8, clone RP11-662G23, complete sequence Length = 191820 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 12281 ggccgccgctgctgccgccgc 12301
>gb|AC068510.8| Homo sapiens chromosome 8, clone RP11-662E23, complete sequence Length = 191820 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 12281 ggccgccgctgctgccgccgc 12301
>dbj|AK157189.1| Mus musculus activated spleen cDNA, RIKEN full-length enriched library, clone:F830206E03 product:zinc finger protein 281, full insert sequence Length = 3095 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctggcg 144 |||||||| |||||||||||||||| Sbjct: 216 gccgccgccgctgccgccgctggcg 192
>dbj|AK142218.1| Mus musculus 13 days embryo heart cDNA, RIKEN full-length enriched library, clone:D330013P21 product:zinc finger protein 281, full insert sequence Length = 3049 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctggcg 144 |||||||| |||||||||||||||| Sbjct: 190 gccgccgccgctgccgccgctggcg 166
>dbj|AB168698.1| Macaca fascicularis testis cDNA clone: QtsA-14234, similar to human Ral-A exchange factor RalGPS2 (RALGPS2), mRNA, RefSeq: NM_152663.2 Length = 2246 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgct 140 ||||||||||||||||||||| Sbjct: 76 gccgccgctgctgccgccgct 56
>gb|AC012388.5| Drosophila melanogaster, chromosome 2R, region 57B-57B, BAC clone BACR10P16, complete sequence Length = 171972 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 308 tggtgggggtgggtagtatgg 328 ||||||||||||||||||||| Sbjct: 8548 tggtgggggtgggtagtatgg 8528
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctggcg 144 |||||||| |||||||||||||||| Sbjct: 16413633 gccgccgccgctgccgccgctggcg 16413609
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 42.1 bits (21), Expect = 1.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctggcggtgg 148 |||||||| || ||||||||||||||||| Sbjct: 11112754 gccgccgccgccgccgccgctggcggtgg 11112726 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 23784034 gccgccgctgctgccgccgc 23784053 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 10741678 gccgccgctgctgccgccgc 10741697
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 121 ccgccgctgctgccgccgctg 141 ||||||||||||||||||||| Sbjct: 10876595 ccgccgctgctgccgccgctg 10876615
>gb|AE017282.2| Methylococcus capsulatus str. Bath, complete genome Length = 3304561 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 129 gctgccgccgctggcggtggc 149 ||||||||||||||||||||| Sbjct: 1396287 gctgccgccgctggcggtggc 1396307
>gb|AC140366.2| Mus musculus BAC clone RP24-225H21 from chromosome 7, complete sequence Length = 145270 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 203 tgaactcccttgtggctgctg 223 ||||||||||||||||||||| Sbjct: 79296 tgaactcccttgtggctgctg 79276
>dbj|AP003620.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0596H06 Length = 142832 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgct 140 ||||||||||||||||||||| Sbjct: 37054 gccgccgctgctgccgccgct 37034
>gb|AC007686.5|AC007686 Homo sapiens chromosome 14 clones CTD-2289B16, RP11-116N21, RP11-7F17, complete sequence Length = 181386 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 89926 ggccgccgctgctgccgccgc 89946
>dbj|AK110385.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-165-D07, full insert sequence Length = 3240 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 121 ccgccgctgctgccgccgctg 141 ||||||||||||||||||||| Sbjct: 592 ccgccgctgctgccgccgctg 572
>dbj|AK109929.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-151-H09, full insert sequence Length = 1407 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 121 ccgccgctgctgccgccgctg 141 ||||||||||||||||||||| Sbjct: 1107 ccgccgctgctgccgccgctg 1127
>dbj|AK060497.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-G05, full insert sequence Length = 1719 Score = 42.1 bits (21), Expect = 1.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctggcggtgg 148 |||||||| || ||||||||||||||||| Sbjct: 1263 gccgccgccgccgccgccgctggcggtgg 1235
>gb|AE003721.3| Drosophila melanogaster chromosome 3R, section 59 of 118 of the complete sequence Length = 224889 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 14068 ggccgccgctgctgccgccgc 14048
>gb|AE003452.5| Drosophila melanogaster chromosome 2R, section 60 of 73 of the complete sequence Length = 303438 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 308 tggtgggggtgggtagtatgg 328 ||||||||||||||||||||| Sbjct: 8708 tggtgggggtgggtagtatgg 8688
>gb|AE013598.1| Xanthomonas oryzae pv. oryzae KACC10331, complete genome Length = 4941439 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Plus Query: 128 tgctgccgccgctggcggtgg 148 ||||||||||||||||||||| Sbjct: 1896228 tgctgccgccgctggcggtgg 1896248
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 42.1 bits (21), Expect = 1.2 Identities = 27/29 (93%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctggcggtgg 148 |||||||| || ||||||||||||||||| Sbjct: 11191943 gccgccgccgccgccgccgctggcggtgg 11191915 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 24095703 gccgccgctgctgccgccgc 24095722 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 10820867 gccgccgctgctgccgccgc 10820886
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctggcg 144 |||||||| |||||||||||||||| Sbjct: 16366866 gccgccgccgctgccgccgctggcg 16366842
>emb|AL713907.3|CNS07YQ7 Oryza sativa chromosome 12, . BAC OJ1057_E03 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 127989 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctggcg 144 |||||||| |||||||||||||||| Sbjct: 38758 gccgccgccgctgccgccgctggcg 38782
>ref|NM_177643.2| Mus musculus zinc finger protein 281 (Zfp281), mRNA Length = 3146 Score = 42.1 bits (21), Expect = 1.2 Identities = 24/25 (96%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctggcg 144 |||||||| |||||||||||||||| Sbjct: 234 gccgccgccgctgccgccgctggcg 210
>gb|BC108292.1| Homo sapiens cDNA clone IMAGE:30338685 Length = 4203 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccgc 139 ||||||||||||||||||||| Sbjct: 1198 ggccgccgctgctgccgccgc 1178
>gb|AC116136.9| Mus musculus chromosome 5, clone RP23-116G17, complete sequence Length = 212184 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 118 gggccgccgctgctgccgccgctg 141 |||||||||||||| ||||||||| Sbjct: 166979 gggccgccgctgctcccgccgctg 166956
>gb|BT023949.1| Drosophila melanogaster IP03879 full insert cDNA Length = 5011 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 4513 gccgccgctgctgccgccgc 4532
>ref|XM_493922.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 1107 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccg 138 |||||||||||||||||||| Sbjct: 276 ggccgccgctgctgccgccg 257
>ref|XM_522643.1| PREDICTED: Pan troglodytes similar to Homeobox protein GSH-1 (LOC467245), mRNA Length = 1047 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 586 gccgccgctgctgccgccgc 605
>ref|XM_466220.1| Oryza sativa (japonica cultivar-group), mRNA Length = 3110 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 126 gctgctgccgccgctggcggtggc 149 |||||||||||||| ||||||||| Sbjct: 326 gctgctgccgccgccggcggtggc 349
>ref|XM_517122.1| PREDICTED: Pan troglodytes similar to transcription factor MLR1 (LOC461135), mRNA Length = 8214 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 34 gccgccgctgctgccgccgc 53
>gb|AC119834.12| Mus musculus chromosome 5, clone RP24-383P24, complete sequence Length = 223764 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 200900 gccgccgctgctgccgccgc 200881
>ref|NM_023504.1| Mus musculus NK2 transcription factor related, locus 4 (Drosophila) (Nkx2-4), mRNA Length = 1065 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 248 gccgccgctgctgccgccgc 229
>gb|BC083551.1| Rattus norvegicus squamous cell carcinoma antigen recognized by T-cells 1, mRNA (cDNA clone MGC:93355 IMAGE:7134496), complete cds Length = 2545 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 181 gccgccgctgctgccgccgc 162
>gb|AC084218.6| Oryza sativa (japonica cultivar-group) chromosome 5 clone P0001A07, complete sequence Length = 164898 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccg 138 |||||||||||||||||||| Sbjct: 51527 ggccgccgctgctgccgccg 51508
>ref|NM_174074.1| Bos taurus G protein-coupled receptor 7 (GPR7), mRNA Length = 996 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgctggc 143 ||||||||||| |||||||||||| Sbjct: 96 gccgccgctgccgccgccgctggc 119
>gb|AY016023.1| Sphoeroides nephelus alpha globin gene cluster, complete sequence Length = 167215 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 26941 gccgccgctgctgccgccgc 26922
>gb|AC136501.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0044M15, complete sequence Length = 144568 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 75924 gccgccgctgctgccgccgc 75905
>gb|AC160995.4| Mus musculus BAC clone RP23-96D5 from chromosome 13, complete sequence Length = 235237 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 80589 gccgccgctgctgccgccgc 80608
>gb|AC165141.4| Mus musculus BAC clone RP24-535G5 from chromosome 17, complete sequence Length = 187883 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 162204 gccgccgctgctgccgccgc 162223
>gb|AC113983.13| Mus musculus chromosome 5, clone RP24-95M11, complete sequence Length = 198590 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 153679 gccgccgctgctgccgccgc 153698
>gb|AY597210.1| Chlamydomonas reinhardtii katanin p80 subunit PF15p mRNA, complete cds Length = 2782 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 1207 gccgccgctgctgccgccgc 1188
>gb|AC009256.9| Drosophila melanogaster clone BACR03G18, complete sequence Length = 179931 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 75168 gccgccgctgctgccgccgc 75149
>gb|AC008284.7| Drosophila melanogaster clone BACR03M22, complete sequence Length = 161996 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 8644 gccgccgctgctgccgccgc 8663
>gb|AC007418.9| Drosophila melanogaster clone BACR16P22, complete sequence Length = 179325 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 125496 gccgccgctgctgccgccgc 125515
>gb|AC109832.2| Oryza sativa (japonica cultivar-group) chromosome 11 BAC clone P0038B07, complete sequence Length = 149697 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 120072 gccgccgctgctgccgccgc 120091
>gb|AC101651.6| Mus musculus chromosome 18, clone RP23-42D12, complete sequence Length = 198070 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 28096 gccgccgctgctgccgccgc 28077
>gb|BC079610.1| Mus musculus paired-like homeobox 2b, mRNA (cDNA clone MGC:90726 IMAGE:30360139), complete cds Length = 2857 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 663 gccgccgctgctgccgccgc 682
>gb|BC079448.1| Rattus norvegicus cDNA clone IMAGE:7115709 Length = 1458 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 13 gccgccgctgctgccgccgc 32
>gb|AC093104.2| Drosophila melanogaster clone BACR38O04, complete sequence Length = 167107 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 79829 gccgccgctgctgccgccgc 79848 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 79226 gccgccgctgctgccgccgc 79245
>gb|AC007579.5| Drosophila melanogaster clone BACR07M03, complete sequence Length = 193262 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 312 gggggtgggtagtatggagg 331 |||||||||||||||||||| Sbjct: 101589 gggggtgggtagtatggagg 101608
>gb|AC009208.6| Drosophila melanogaster clone BACR31I21, complete sequence Length = 152443 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 57675 gccgccgctgctgccgccgc 57694
>ref|XM_867580.1| PREDICTED: Bos taurus similar to squamous cell carcinoma antigen recognized by T cells 1 (LOC615704), mRNA Length = 3165 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 202 gccgccgctgctgccgccgc 183
>ref|XM_362312.1| Magnaporthe grisea 70-15 hypothetical protein (MG04757.4) partial cds Length = 1485 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 119 ggccgccgctgctgccgccg 138 |||||||||||||||||||| Sbjct: 1449 ggccgccgctgctgccgccg 1468
>ref|XM_423313.1| PREDICTED: Gallus gallus similar to hypothetical protein similar to RNA-binding protein lark (LOC425562), mRNA Length = 866 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 119 ggccgccgctgctgccgccg 138 |||||||||||||||||||| Sbjct: 841 ggccgccgctgctgccgccg 822
>ref|XM_879639.1| PREDICTED: Bos taurus hypothetical protein LOC615321 (LOC615321), mRNA Length = 643 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 312 gccgccgctgctgccgccgc 331
>ref|NM_009820.2| Mus musculus runt related transcription factor 2 (Runx2), mRNA Length = 5695 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 485 gccgccgctgctgccgccgc 466
>gb|BC052033.1| Mus musculus aristaless related homeobox gene (Drosophila), mRNA (cDNA clone MGC:62389 IMAGE:5707995), complete cds Length = 2759 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 911 gccgccgctgctgccgccgc 930
>gb|BC051394.1| Mus musculus squamous cell carcinoma antigen recognized by T-cells 1, mRNA (cDNA clone MGC:59155 IMAGE:5097832), complete cds Length = 2532 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 188 gccgccgctgctgccgccgc 169
>gb|BC007289.1| Homo sapiens actin related protein M1, mRNA (cDNA clone MGC:15664 IMAGE:3349184), complete cds Length = 1632 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 295 gccgccgctgctgccgccgc 276
>gb|BC037107.1| Mus musculus adenylate cyclase 2, mRNA (cDNA clone MGC:47193 IMAGE:5367175), complete cds Length = 3980 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 74 gccgccgctgctgccgccgc 55
>ref|XM_952357.1| Neurospora crassa OR74A hypothetical protein (NCU07225.1) partial mRNA Length = 882 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctggc 143 |||||||| ||||||||||||||| Sbjct: 696 gccgccgccgctgccgccgctggc 673
>gb|BC026721.1| Mus musculus cDNA clone IMAGE:3991160 Length = 1543 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 77 gccgccgctgctgccgccgc 58
>gb|BC072413.1| Homo sapiens eukaryotic translation initiation factor 4 gamma, 3, mRNA (cDNA clone IMAGE:6165611), partial cds Length = 5764 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 226 gccgccgctgctgccgccgc 207
>ref|XM_327510.1| Neurospora crassa OR74A hypothetical protein (NCU07225.1) partial mRNA Length = 882 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgctggc 143 |||||||| ||||||||||||||| Sbjct: 696 gccgccgccgctgccgccgctggc 673
>gb|AC133902.12| Mus musculus chromosome 10, clone RP24-538B17, complete sequence Length = 199604 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 83747 gccgccgctgctgccgccgc 83766
>ref|NM_001015053.1| Homo sapiens histone deacetylase 5 (HDAC5), transcript variant 3, mRNA Length = 5327 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 92 gccgccgctgctgccgccgc 111
>ref|NM_025278.3| Mus musculus guanine nucleotide binding protein (G protein), gamma 12 (Gng12), mRNA Length = 4134 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 41 gccgccgctgctgccgccgc 22
>ref|NM_027696.2| Mus musculus mesoderm induction early response 1 homolog (Xenopus laevis (Mier1), transcript variant 1, mRNA Length = 4758 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 54 gccgccgctgctgccgccgc 35
>ref|NM_005474.4| Homo sapiens histone deacetylase 5 (HDAC5), transcript variant 1, mRNA Length = 5324 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 92 gccgccgctgctgccgccgc 111
>ref|NM_009834.1| Mus musculus CCR4 carbon catabolite repression 4-like (S. cerevisiae) (Ccrn4l), mRNA Length = 2999 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 492 gccgccgctgctgccgccgc 511
>ref|NM_015739.1| Mus musculus gastrulation brain homeobox 1 (Gbx1), mRNA Length = 1452 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 118 gggccgccgctgctgccgccgctg 141 |||||||||||||| ||||||||| Sbjct: 271 gggccgccgctgctcccgccgctg 248
>gb|AC161183.10| Mus musculus chromosome 3, clone RP23-172P6, complete sequence Length = 222012 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 133079 gccgccgctgctgccgccgc 133060
>ref|NM_004634.2| Homo sapiens bromodomain and PHD finger containing, 1 (BRPF1), transcript variant 2, mRNA Length = 4710 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 5 gccgccgctgctgccgccgc 24
>ref|NM_001003694.1| Homo sapiens bromodomain and PHD finger containing, 1 (BRPF1), transcript variant 1, mRNA Length = 4728 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 5 gccgccgctgctgccgccgc 24
>gb|AY033463.1| Zea mays subsp. mays isolate phi121-B73 microsatellite sequence Length = 102 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 47 gccgccgctgctgccgccgc 66
>gb|AY319256.1| Mus musculus gastrulation brain homeobox 1 (Gbx1) mRNA, complete cds Length = 1643 Score = 40.1 bits (20), Expect = 4.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 118 gggccgccgctgctgccgccgctg 141 |||||||||||||| ||||||||| Sbjct: 625 gggccgccgctgctcccgccgctg 602
>gb|AC165142.3| Mus musculus BAC clone RP24-484I1 from chromosome 7, complete sequence Length = 165049 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 163 gaggtgcttgagcctgctgc 182 |||||||||||||||||||| Sbjct: 58576 gaggtgcttgagcctgctgc 58595
>ref|XM_979717.1| PREDICTED: Mus musculus aristaless related homeobox gene (Drosophila) (Arx), mRNA Length = 2558 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 743 gccgccgctgctgccgccgc 762
>ref|XM_983126.1| PREDICTED: Mus musculus aristaless related homeobox gene (Drosophila) (Arx), mRNA Length = 2471 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 656 gccgccgctgctgccgccgc 675
>ref|XM_990637.1| PREDICTED: Mus musculus DNA segment, Chr 17, Wayne State University 92, expressed (D17Wsu92e), mRNA Length = 1749 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 389 gccgccgctgctgccgccgc 370
>gb|BC025202.1| Mus musculus ryanodine receptor 1, skeletal muscle, mRNA (cDNA clone IMAGE:5029188), with apparent retained intron Length = 1512 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 163 gaggtgcttgagcctgctgc 182 |||||||||||||||||||| Sbjct: 196 gaggtgcttgagcctgctgc 215
>ref|XM_989547.1| PREDICTED: Mus musculus RIKEN cDNA 4930597O21 gene (4930597O21Rik), mRNA Length = 1613 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 646 gccgccgctgctgccgccgc 665
>ref|XM_991033.1| PREDICTED: Mus musculus hypothetical protein LOC672092 (LOC672092), mRNA Length = 579 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 402 gccgccgctgctgccgccgc 383
>ref|XM_976525.1| PREDICTED: Mus musculus homeo box A13 (Hoxa13), mRNA Length = 888 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 91 gccgccgctgctgccgccgc 110
>ref|XM_973047.1| PREDICTED: Mus musculus CCR4 carbon catabolite repression 4-like (S. cerevisiae) (Ccrn4l), mRNA Length = 2969 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 402 gccgccgctgctgccgccgc 421
>gb|BC065068.1| Mus musculus potassium large conductance calcium-activated channel, subfamily M, alpha member 1, mRNA (cDNA clone IMAGE:6418026), containing frame-shift errors Length = 4445 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 122 gccgccgctgctgccgccgc 103
>ref|XM_991454.1| PREDICTED: Mus musculus CCR4 carbon catabolite repression 4-like (S. cerevisiae) (Ccrn4l), mRNA Length = 2702 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 135 gccgccgctgctgccgccgc 154
>gb|AC142257.4| Mus musculus BAC clone RP24-511I4 from chromosome 18, complete sequence Length = 140990 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 84084 gccgccgctgctgccgccgc 84065
>ref|XM_856854.1| PREDICTED: Canis familiaris similar to bromodomain and PHD finger containing, 1, transcript variant 10 (LOC484667), mRNA Length = 4642 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 120 gccgccgctgctgccgccgc 139 |||||||||||||||||||| Sbjct: 9 gccgccgctgctgccgccgc 28 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 3,310,822 Number of Sequences: 3902068 Number of extensions: 3310822 Number of successful extensions: 92672 Number of sequences better than 10.0: 510 Number of HSP's better than 10.0 without gapping: 470 Number of HSP's successfully gapped in prelim test: 43 Number of HSP's that attempted gapping in prelim test: 90407 Number of HSP's gapped (non-prelim): 2307 length of query: 367 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 345 effective length of database: 17,147,199,772 effective search space: 5915783921340 effective search space used: 5915783921340 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
