Clone Name | rbasd26d09 |
---|---|
Clone Library Name | barley_pub |
>gb|AF475119.1| Triticum aestivum succinate dehydrogenase subunit 3 mRNA, partial cds Length = 399 Score = 630 bits (318), Expect = e-177 Identities = 373/392 (95%) Strand = Plus / Minus Query: 172 tcagacctcaaacatgacgccgaacctggtagcaagaggaatggatatgatggcagcacc 231 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 399 tcagacctcaaacatgacgccgaacctggtagcaagaggaatggatatgatggcagcacc 340 Query: 232 cagcgcaacgccaaatatacggtgtgagatggagaatgtagcgctcagctgtggcttctt 291 ||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||| Sbjct: 339 cagcgcagcgccaaatatacggtgtgagatggagaacgtagcgctcagctgtggcttctt 280 Query: 292 cagaggaagatggggagacagtgggcggttcgcaacaggagccgacaggggacggcttgt 351 ||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||| Sbjct: 279 cagaggaagatggggagacagtgggcggttcgcaacaggagtcgacaggggacgacttgt 220 Query: 352 atgtagggatcggtttccagatggaggcatcttctgtcgcagggctcctaacagagaaga 411 ||| |||||||||||||||||||||||||||||||||||||| |||||||| ||||||| Sbjct: 219 atgcagggatcggtttccagatggaggcatcttctgtcgcagagctcctaagggagaaga 160 Query: 412 tgtgtagctctttgcttgcccaatgcgtgaggagtgtctaagggcatccatgttgttgaa 471 |||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||| Sbjct: 159 tgtgtagctccttgcttgcccaatgcttgaggagtgtctaaggccatccatgttgttgaa 100 Query: 472 agacgagttgggggtaccaaccgcaccacggagagcaaatggagcatctctcangggtgc 531 ||||||||||| |||||||| ||||||||||||||||||||||| | | ||| |||||| Sbjct: 99 agacgagttggaggtaccaaaggcaccacggagagcaaatggagcgtntatcaggggtgc 40 Query: 532 aaagcgggtgttgctgtgatacttgtccattc 563 |||||||||| ||||||||||||||||||||| Sbjct: 39 aaagcgggtgctgctgtgatacttgtccattc 8
>dbj|AK058482.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-D05, full insert sequence Length = 595 Score = 260 bits (131), Expect = 5e-66 Identities = 328/394 (83%) Strand = Plus / Minus Query: 171 ctcagacctcaaacatgacgccgaacctggtagcaagaggaatggatatgatggcagcac 230 ||||||| |||||||||| || ||| |||| ||||||||||||||||| ||| |||| | Sbjct: 502 ctcagacatcaaacatgaggctgaatttggtggcaagaggaatggatataatgacagctc 443 Query: 231 ccagcgcaacgccaaatatacggtgtgagatggagaatgtagcgctcagctgtggcttct 290 |||| ||| | ||||| |||||||||||||| ||||| ||||| |||||||| ||||||| Sbjct: 442 ccagggcagcaccaaaaatacggtgtgagattgagaacgtagcactcagctgcggcttct 383 Query: 291 tcagaggaagatggggagacagtgggcggttcgcaacaggagccgacaggggacggcttg 350 ||| ||| |||||||| |||||||||||||||||||||||||||||||||||||| |||| Sbjct: 382 tcaaagggagatggggtgacagtgggcggttcgcaacaggagccgacaggggacgacttg 323 Query: 351 tatgtagggatcggtttccagatggaggcatcttctgtcgcagggctcctaacagagaag 410 | || ||| ||||||||||||||| |||||| ||| ||| ||||||| | |||| Sbjct: 322 tgtgcaggagtcggtttccagatgggaacatctttggtctcagagctcctaggggtgaag 263 Query: 411 atgtgtagctctttgcttgcccaatgcgtgaggagtgtctaagggcatccatgttgttga 470 ||||||||||| | ||||| ||| | |||||| ||||| || ||| |||||||||| Sbjct: 262 atgtgtagctcctagcttgtccagaacttgaggattgtctcagatgatctatgttgttga 203 Query: 471 aagacgagttgggggtaccaaccgcaccacggagagcaaatggagcatctctcangggtg 530 | || ||||| | | |||||| ||||| |||||||||||||||||||| || | ||||| Sbjct: 202 aggatgagtttgagctaccaagggcaccgcggagagcaaatggagcatcactgaggggtg 143 Query: 531 caaagcgggtgttgctgtgatacttgtccattcc 564 |||| |||| ||||| || ||||| |||||||| Sbjct: 142 caaaccgggccttgctctggtacttctccattcc 109
>ref|XM_478436.1| Oryza sativa (japonica cultivar-group), mRNA Length = 595 Score = 252 bits (127), Expect = 1e-63 Identities = 327/394 (82%) Strand = Plus / Minus Query: 171 ctcagacctcaaacatgacgccgaacctggtagcaagaggaatggatatgatggcagcac 230 ||||||| |||||||||| || ||| |||| ||||||||||||||||| ||| |||| | Sbjct: 502 ctcagacatcaaacatgaggctgaatttggtggcaagaggaatggatataatgacagctc 443 Query: 231 ccagcgcaacgccaaatatacggtgtgagatggagaatgtagcgctcagctgtggcttct 290 |||| ||| | ||||| |||||||||||||| ||||| ||||| |||||||| ||||||| Sbjct: 442 ccagggcagcaccaaaaatacggtgtgagattgagaacgtagcactcagctgcggcttct 383 Query: 291 tcagaggaagatggggagacagtgggcggttcgcaacaggagccgacaggggacggcttg 350 ||| ||| |||||||| |||||||||||||| ||||||||||||||||||||||| |||| Sbjct: 382 tcaaagggagatggggtgacagtgggcggtttgcaacaggagccgacaggggacgacttg 323 Query: 351 tatgtagggatcggtttccagatggaggcatcttctgtcgcagggctcctaacagagaag 410 | || ||| ||||||||||||||| |||||| ||| ||| ||||||| | |||| Sbjct: 322 tgtgcaggagtcggtttccagatgggaacatctttggtctcagagctcctaggggtgaag 263 Query: 411 atgtgtagctctttgcttgcccaatgcgtgaggagtgtctaagggcatccatgttgttga 470 ||||||||||| | ||||| ||| | |||||| ||||| || ||| |||||||||| Sbjct: 262 atgtgtagctcctagcttgtccagaacttgaggattgtctcagatgatctatgttgttga 203 Query: 471 aagacgagttgggggtaccaaccgcaccacggagagcaaatggagcatctctcangggtg 530 | || ||||| | | |||||| ||||| |||||||||||||||||||| || | ||||| Sbjct: 202 aggatgagtttgagctaccaagggcaccgcggagagcaaatggagcatcactgaggggtg 143 Query: 531 caaagcgggtgttgctgtgatacttgtccattcc 564 |||| |||| ||||| || ||||| |||||||| Sbjct: 142 caaaccgggccttgctctggtacttctccattcc 109
>ref|XM_463920.1| Oryza sativa (japonica cultivar-group), mRNA Length = 744 Score = 218 bits (110), Expect = 2e-53 Identities = 188/214 (87%) Strand = Plus / Minus Query: 171 ctcagacctcaaacatgacgccgaacctggtagcaagaggaatggatatgatggcagcac 230 ||||||| |||||||||| || |||| |||| || |||||||||||||| |||||||||| Sbjct: 557 ctcagacatcaaacatgaggctgaacttggtggcgagaggaatggatataatggcagcac 498 Query: 231 ccagcgcaacgccaaatatacggtgtgagatggagaatgtagcgctcagctgtggcttct 290 ||| |||| | |||||||||||||| ||||| ||||||||||| |||||||||||||||| Sbjct: 497 ccaacgcagcaccaaatatacggtgcgagatagagaatgtagcactcagctgtggcttct 438 Query: 291 tcagaggaagatggggagacagtgggcggttcgcaacaggagccgacaggggacggcttg 350 |||||||||| ||||| ||||| |||||||| ||||||||||||||||| ||| |||||| Sbjct: 437 tcagaggaaggtggggtgacagggggcggttagcaacaggagccgacagaggatggcttg 378 Query: 351 tatgtagggatcggtttccagatggaggcatctt 384 | || |||| |||| ||||||||| ||||||| Sbjct: 377 tgtgcaggggtcggcatccagatgggagcatctt 344 Score = 97.6 bits (49), Expect = 4e-17 Identities = 66/72 (91%) Strand = Plus / Minus Query: 494 gcaccacggagagcaaatggagcatctctcangggtgcaaagcgggtgttgctgtgatac 553 ||||||||||||||||||||||||||||| | ||| ||||| |||| ||||||||||||| Sbjct: 234 gcaccacggagagcaaatggagcatctctgaagggagcaaatcgggagttgctgtgatac 175 Query: 554 ttgtccattcct 565 || ||||||||| Sbjct: 174 ttctccattcct 163
>gb|AF362741.1|AF362741 Oryza sativa succinate dehydrogenase subunit 3 (sdh3) gene, complete cds; nuclear gene for mitochondrial product Length = 2864 Score = 218 bits (110), Expect = 2e-53 Identities = 188/214 (87%) Strand = Plus / Minus Query: 171 ctcagacctcaaacatgacgccgaacctggtagcaagaggaatggatatgatggcagcac 230 ||||||| |||||||||| || |||| |||| || |||||||||||||| |||||||||| Sbjct: 2660 ctcagacatcaaacatgaggctgaacttggtggcgagaggaatggatataatggcagcac 2601 Query: 231 ccagcgcaacgccaaatatacggtgtgagatggagaatgtagcgctcagctgtggcttct 290 ||| |||| | |||||||||||||| ||||| ||||||||||| |||||||||||||||| Sbjct: 2600 ccaacgcagcaccaaatatacggtgcgagatagagaatgtagcactcagctgtggcttct 2541 Query: 291 tcagaggaagatggggagacagtgggcggttcgcaacaggagccgacaggggacggcttg 350 |||||||||| ||||| ||||| |||||||| ||||||||||||||||| ||| |||||| Sbjct: 2540 tcagaggaaggtggggtgacagggggcggttagcaacaggagccgacagaggatggcttg 2481 Query: 351 tatgtagggatcggtttccagatggaggcatctt 384 | || |||| |||| ||||||||| ||||||| Sbjct: 2480 tgtgcaggggtcggcatccagatgggagcatctt 2447 Score = 93.7 bits (47), Expect = 6e-16 Identities = 64/70 (91%) Strand = Plus / Minus Query: 496 accacggagagcaaatggagcatctctcangggtgcaaagcgggtgttgctgtgatactt 555 ||||||||||||||||||||||||||| | ||| ||||| |||| ||||||||||||||| Sbjct: 1656 accacggagagcaaatggagcatctctgaagggagcaaatcgggagttgctgtgatactt 1597 Query: 556 gtccattcct 565 ||||||||| Sbjct: 1596 ctccattcct 1587
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 218 bits (110), Expect = 2e-53 Identities = 188/214 (87%) Strand = Plus / Minus Query: 171 ctcagacctcaaacatgacgccgaacctggtagcaagaggaatggatatgatggcagcac 230 ||||||| |||||||||| || |||| |||| || |||||||||||||| |||||||||| Sbjct: 1154066 ctcagacatcaaacatgaggctgaacttggtggcgagaggaatggatataatggcagcac 1154007 Query: 231 ccagcgcaacgccaaatatacggtgtgagatggagaatgtagcgctcagctgtggcttct 290 ||| |||| | |||||||||||||| ||||| ||||||||||| |||||||||||||||| Sbjct: 1154006 ccaacgcagcaccaaatatacggtgcgagatagagaatgtagcactcagctgtggcttct 1153947 Query: 291 tcagaggaagatggggagacagtgggcggttcgcaacaggagccgacaggggacggcttg 350 |||||||||| ||||| ||||| |||||||| ||||||||||||||||| ||| |||||| Sbjct: 1153946 tcagaggaaggtggggtgacagggggcggttagcaacaggagccgacagaggatggcttg 1153887 Query: 351 tatgtagggatcggtttccagatggaggcatctt 384 | || |||| |||| ||||||||| ||||||| Sbjct: 1153886 tgtgcaggggtcggcatccagatgggagcatctt 1153853 Score = 93.7 bits (47), Expect = 6e-16 Identities = 64/70 (91%) Strand = Plus / Minus Query: 496 accacggagagcaaatggagcatctctcangggtgcaaagcgggtgttgctgtgatactt 555 ||||||||||||||||||||||||||| | ||| ||||| |||| ||||||||||||||| Sbjct: 1153062 accacggagagcaaatggagcatctctgaagggagcaaatcgggagttgctgtgatactt 1153003 Query: 556 gtccattcct 565 ||||||||| Sbjct: 1153002 ctccattcct 1152993
>dbj|AP004078.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1020_C02 Length = 124578 Score = 218 bits (110), Expect = 2e-53 Identities = 188/214 (87%) Strand = Plus / Minus Query: 171 ctcagacctcaaacatgacgccgaacctggtagcaagaggaatggatatgatggcagcac 230 ||||||| |||||||||| || |||| |||| || |||||||||||||| |||||||||| Sbjct: 106590 ctcagacatcaaacatgaggctgaacttggtggcgagaggaatggatataatggcagcac 106531 Query: 231 ccagcgcaacgccaaatatacggtgtgagatggagaatgtagcgctcagctgtggcttct 290 ||| |||| | |||||||||||||| ||||| ||||||||||| |||||||||||||||| Sbjct: 106530 ccaacgcagcaccaaatatacggtgcgagatagagaatgtagcactcagctgtggcttct 106471 Query: 291 tcagaggaagatggggagacagtgggcggttcgcaacaggagccgacaggggacggcttg 350 |||||||||| ||||| ||||| |||||||| ||||||||||||||||| ||| |||||| Sbjct: 106470 tcagaggaaggtggggtgacagggggcggttagcaacaggagccgacagaggatggcttg 106411 Query: 351 tatgtagggatcggtttccagatggaggcatctt 384 | || |||| |||| ||||||||| ||||||| Sbjct: 106410 tgtgcaggggtcggcatccagatgggagcatctt 106377 Score = 93.7 bits (47), Expect = 6e-16 Identities = 64/70 (91%) Strand = Plus / Minus Query: 496 accacggagagcaaatggagcatctctcangggtgcaaagcgggtgttgctgtgatactt 555 ||||||||||||||||||||||||||| | ||| ||||| |||| ||||||||||||||| Sbjct: 105586 accacggagagcaaatggagcatctctgaagggagcaaatcgggagttgctgtgatactt 105527 Query: 556 gtccattcct 565 ||||||||| Sbjct: 105526 ctccattcct 105517
>dbj|AK103260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033124C12, full insert sequence Length = 744 Score = 218 bits (110), Expect = 2e-53 Identities = 188/214 (87%) Strand = Plus / Minus Query: 171 ctcagacctcaaacatgacgccgaacctggtagcaagaggaatggatatgatggcagcac 230 ||||||| |||||||||| || |||| |||| || |||||||||||||| |||||||||| Sbjct: 557 ctcagacatcaaacatgaggctgaacttggtggcgagaggaatggatataatggcagcac 498 Query: 231 ccagcgcaacgccaaatatacggtgtgagatggagaatgtagcgctcagctgtggcttct 290 ||| |||| | |||||||||||||| ||||| ||||||||||| |||||||||||||||| Sbjct: 497 ccaacgcagcaccaaatatacggtgcgagatagagaatgtagcactcagctgtggcttct 438 Query: 291 tcagaggaagatggggagacagtgggcggttcgcaacaggagccgacaggggacggcttg 350 |||||||||| ||||| ||||| |||||||| ||||||||||||||||| ||| |||||| Sbjct: 437 tcagaggaaggtggggtgacagggggcggttagcaacaggagccgacagaggatggcttg 378 Query: 351 tatgtagggatcggtttccagatggaggcatctt 384 | || |||| |||| ||||||||| ||||||| Sbjct: 377 tgtgcaggggtcggcatccagatgggagcatctt 344 Score = 97.6 bits (49), Expect = 4e-17 Identities = 66/72 (91%) Strand = Plus / Minus Query: 494 gcaccacggagagcaaatggagcatctctcangggtgcaaagcgggtgttgctgtgatac 553 ||||||||||||||||||||||||||||| | ||| ||||| |||| ||||||||||||| Sbjct: 234 gcaccacggagagcaaatggagcatctctgaagggagcaaatcgggagttgctgtgatac 175 Query: 554 ttgtccattcct 565 || ||||||||| Sbjct: 174 ttctccattcct 163
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 204 bits (103), Expect = 2e-49 Identities = 214/251 (85%) Strand = Plus / Minus Query: 171 ctcagacctcaaacatgacgccgaacctggtagcaagaggaatggatatgatggcagcac 230 ||||||| |||||||||| || ||| |||| ||||||||||||||||| ||| |||| | Sbjct: 20075069 ctcagacatcaaacatgaggctgaatttggtggcaagaggaatggatataatgacagctc 20075010 Query: 231 ccagcgcaacgccaaatatacggtgtgagatggagaatgtagcgctcagctgtggcttct 290 |||| ||| | ||||| |||||||||||||| ||||| ||||| |||||||| ||||||| Sbjct: 20075009 ccagggcagcaccaaaaatacggtgtgagattgagaacgtagcactcagctgcggcttct 20074950 Query: 291 tcagaggaagatggggagacagtgggcggttcgcaacaggagccgacaggggacggcttg 350 ||| ||| |||||||| |||||||||||||| ||||||||||||||||||||||| |||| Sbjct: 20074949 tcaaagggagatggggtgacagtgggcggtttgcaacaggagccgacaggggacgacttg 20074890 Query: 351 tatgtagggatcggtttccagatggaggcatcttctgtcgcagggctcctaacagagaag 410 | || ||| ||||||||||||||| |||||| ||| ||| ||||||| | |||| Sbjct: 20074889 tgtgcaggagtcggtttccagatgggaacatctttggtctcagagctcctaggggtgaag 20074830 Query: 411 atgtgtagctc 421 ||||||||||| Sbjct: 20074829 atgtgtagctc 20074819 Score = 61.9 bits (31), Expect = 2e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 500 cggagagcaaatggagcatctctcangggtgcaaagcgggtgttgctgtgatacttgtcc 559 |||||||||||||||||||| || | ||||||||| |||| ||||| || ||||| ||| Sbjct: 20074366 cggagagcaaatggagcatcactgaggggtgcaaaccgggccttgctctggtacttctcc 20074307 Query: 560 attcct 565 |||||| Sbjct: 20074306 attcct 20074301
>dbj|AP003930.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1657_A07 Length = 125217 Score = 204 bits (103), Expect = 2e-49 Identities = 214/251 (85%) Strand = Plus / Minus Query: 171 ctcagacctcaaacatgacgccgaacctggtagcaagaggaatggatatgatggcagcac 230 ||||||| |||||||||| || ||| |||| ||||||||||||||||| ||| |||| | Sbjct: 39672 ctcagacatcaaacatgaggctgaatttggtggcaagaggaatggatataatgacagctc 39613 Query: 231 ccagcgcaacgccaaatatacggtgtgagatggagaatgtagcgctcagctgtggcttct 290 |||| ||| | ||||| |||||||||||||| ||||| ||||| |||||||| ||||||| Sbjct: 39612 ccagggcagcaccaaaaatacggtgtgagattgagaacgtagcactcagctgcggcttct 39553 Query: 291 tcagaggaagatggggagacagtgggcggttcgcaacaggagccgacaggggacggcttg 350 ||| ||| |||||||| |||||||||||||| ||||||||||||||||||||||| |||| Sbjct: 39552 tcaaagggagatggggtgacagtgggcggtttgcaacaggagccgacaggggacgacttg 39493 Query: 351 tatgtagggatcggtttccagatggaggcatcttctgtcgcagggctcctaacagagaag 410 | || ||| ||||||||||||||| |||||| ||| ||| ||||||| | |||| Sbjct: 39492 tgtgcaggagtcggtttccagatgggaacatctttggtctcagagctcctaggggtgaag 39433 Query: 411 atgtgtagctc 421 ||||||||||| Sbjct: 39432 atgtgtagctc 39422 Score = 61.9 bits (31), Expect = 2e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 500 cggagagcaaatggagcatctctcangggtgcaaagcgggtgttgctgtgatacttgtcc 559 |||||||||||||||||||| || | ||||||||| |||| ||||| || ||||| ||| Sbjct: 38969 cggagagcaaatggagcatcactgaggggtgcaaaccgggccttgctctggtacttctcc 38910 Query: 560 attcct 565 |||||| Sbjct: 38909 attcct 38904
>gb|AF362742.1|AF362742 Oryza sativa succinate dehydrogenase subunit 3 (sdh3) gene, complete cds; nuclear gene for mitochondrial product Length = 764 Score = 202 bits (102), Expect = 9e-49 Identities = 213/250 (85%) Strand = Plus / Minus Query: 172 tcagacctcaaacatgacgccgaacctggtagcaagaggaatggatatgatggcagcacc 231 |||||| |||||||||| || ||| |||| ||||||||||||||||| ||| |||| || Sbjct: 764 tcagacatcaaacatgaggctgaatttggtggcaagaggaatggatataatgacagctcc 705 Query: 232 cagcgcaacgccaaatatacggtgtgagatggagaatgtagcgctcagctgtggcttctt 291 ||| ||| | ||||| |||||||||||||| ||||| ||||| |||||||| |||||||| Sbjct: 704 cagggcagcaccaaaaatacggtgtgagattgagaacgtagcactcagctgcggcttctt 645 Query: 292 cagaggaagatggggagacagtgggcggttcgcaacaggagccgacaggggacggcttgt 351 || ||| |||||||| |||||||||||||| ||||||||||||||||||||||| ||||| Sbjct: 644 caaagggagatggggtgacagtgggcggtttgcaacaggagccgacaggggacgacttgt 585 Query: 352 atgtagggatcggtttccagatggaggcatcttctgtcgcagggctcctaacagagaaga 411 || ||| ||||||||||||||| |||||| ||| ||| ||||||| | ||||| Sbjct: 584 gtgcaggagtcggtttccagatgggaacatctttggtctcagagctcctaggggtgaaga 525 Query: 412 tgtgtagctc 421 |||||||||| Sbjct: 524 tgtgtagctc 515 Score = 54.0 bits (27), Expect = 5e-04 Identities = 53/62 (85%) Strand = Plus / Minus Query: 500 cggagagcaaatggagcatctctcangggtgcaaagcgggtgttgctgtgatacttgtcc 559 |||||||||||||||||||| || | ||||||||| |||| ||||| || ||||| ||| Sbjct: 62 cggagagcaaatggagcatcactgaggggtgcaaaccgggccttgctctggtacttctcc 3 Query: 560 at 561 || Sbjct: 2 at 1
>gb|BT017399.1| Zea mays clone EL01N0328G05.c mRNA sequence Length = 726 Score = 125 bits (63), Expect = 2e-25 Identities = 144/171 (84%) Strand = Plus / Minus Query: 214 ggatatgatggcagcacccagcgcaacgccaaatatacggtgtgagatggagaatgtagc 273 ||||||||||||| | |||||||| || || || |||||||| ||||| ||||| ||||| Sbjct: 426 ggatatgatggcaactcccagcgcgacaccgaagatacggtgcgagatagagaaagtagc 367 Query: 274 gctcagctgtggcttcttcagaggaagatggggagacagtgggcggttcgcaacaggagc 333 ||| | ||||||||||||||||||||||||||| ||||| ||||||||||| |||| || Sbjct: 366 gctgaactgtggcttcttcagaggaagatggggcgacagcgggcggttcgctacagcaga 307 Query: 334 cgacaggggacggcttgtatgtagggatcggtttccagatggaggcatctt 384 |||||||| | ||| ||||| ||| ||| ||||||| || || |||||| Sbjct: 306 tgacagggggcagctcgtatgcaggagtcgatttccaggtgtagacatctt 256 Score = 44.1 bits (22), Expect = 0.51 Identities = 57/69 (82%) Strand = Plus / Minus Query: 494 gcaccacggagagcaaatggagcatctctcangggtgcaaagcgggtgttgctgtgatac 553 ||||||||||| ||||| |||| ||||||| |||||||| | |||||||||| |||| Sbjct: 182 gcaccacggagggcaaacggagtctctctcaatggtgcaaattgagtgttgctgttatac 123 Query: 554 ttgtccatt 562 ||||||| Sbjct: 122 aggtccatt 114
>gb|AY108580.1| Zea mays PCO078974 mRNA sequence Length = 816 Score = 125 bits (63), Expect = 2e-25 Identities = 144/171 (84%) Strand = Plus / Minus Query: 214 ggatatgatggcagcacccagcgcaacgccaaatatacggtgtgagatggagaatgtagc 273 ||||||||||||| | |||||||| || || || |||||||| ||||| ||||| ||||| Sbjct: 567 ggatatgatggcaactcccagcgcgacaccgaagatacggtgcgagatagagaaagtagc 508 Query: 274 gctcagctgtggcttcttcagaggaagatggggagacagtgggcggttcgcaacaggagc 333 ||| | ||||||||||||||||||||||||||| ||||| ||||||||||| |||| || Sbjct: 507 gctgaactgtggcttcttcagaggaagatggggcgacagcgggcggttcgctacagcaga 448 Query: 334 cgacaggggacggcttgtatgtagggatcggtttccagatggaggcatctt 384 |||||||| | ||| ||||| ||| ||| ||||||| || || |||||| Sbjct: 447 tgacagggggcagctcgtatgcaggagtcgatttccaggtgtagacatctt 397 Score = 52.0 bits (26), Expect = 0.002 Identities = 58/69 (84%) Strand = Plus / Minus Query: 494 gcaccacggagagcaaatggagcatctctcangggtgcaaagcgggtgttgctgtgatac 553 ||||||||||| ||||| |||| ||||||| |||||||| | |||||||||| |||| Sbjct: 323 gcaccacggagggcaaacggagtctctctcaatggtgcaaattgagtgttgctgttatac 264 Query: 554 ttgtccatt 562 || |||||| Sbjct: 263 ttctccatt 255
>emb|AL049861.18|HSBK21C21 Human DNA sequence from clone CTA-21C21 on chromosome 1p22.2-31.1 Contains STSs and GSSs, complete sequence Length = 143163 Score = 44.1 bits (22), Expect = 0.51 Identities = 22/22 (100%) Strand = Plus / Plus Query: 442 ggagtgtctaagggcatccatg 463 |||||||||||||||||||||| Sbjct: 59454 ggagtgtctaagggcatccatg 59475
>ref|XM_552922.1| Anopheles gambiae str. PEST ENSANGP00000027726 (ENSANGG00000023827), partial mRNA Length = 708 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Plus Query: 106 gcattctgcccaatgacgaaa 126 ||||||||||||||||||||| Sbjct: 658 gcattctgcccaatgacgaaa 678
>emb|AM055943.1| Toxoplasma gondii, strain RH, genomic DNA chromosome Ib Length = 2013089 Score = 42.1 bits (21), Expect = 2.0 Identities = 21/21 (100%) Strand = Plus / Minus Query: 552 acttgtccattccttcctccg 572 ||||||||||||||||||||| Sbjct: 147878 acttgtccattccttcctccg 147858
>gb|AC121820.2| Mus musculus BAC clone RP23-460N4 from 6, complete sequence Length = 178653 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 369 cagatggaggcatcttctgt 388 |||||||||||||||||||| Sbjct: 24349 cagatggaggcatcttctgt 24368
>gb|AY639544.1| Cyphophthalmus teyrovskyi voucher MCZ DNA100910 16S ribosomal RNA gene, partial sequence; mitochondrial Length = 478 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 ttattattcataaaattttg 68 |||||||||||||||||||| Sbjct: 292 ttattattcataaaattttg 273
>gb|AY639543.1| Cyphophthalmus teyrovskyi voucher MCZ DNA100910 16S ribosomal RNA gene, partial sequence; mitochondrial Length = 478 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 ttattattcataaaattttg 68 |||||||||||||||||||| Sbjct: 292 ttattattcataaaattttg 273
>gb|AY639542.1| Cyphophthalmus teyrovskyi voucher MCZ DNA100501 16S ribosomal RNA gene, partial sequence; mitochondrial Length = 478 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 49 ttattattcataaaattttg 68 |||||||||||||||||||| Sbjct: 292 ttattattcataaaattttg 273
>emb|AJ884762.1| Gigaspora rosea dispersed repeat GrosRE3-T3, clone Gros10 Length = 1550 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 48 cttattattcataaaatttt 67 |||||||||||||||||||| Sbjct: 23 cttattattcataaaatttt 42
>emb|AL365202.19| Human DNA sequence from clone RP11-326A8 on chromosome 9 Contains the 5' end of the RFX3 gene for regulatory factor X, 3 (influences HLA class II expression), the 5' end of a novel gene and a CpG island, complete sequence Length = 177164 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 43 tttcccttattattcataaaattt 66 |||| ||||||||||||||||||| Sbjct: 91554 tttcacttattattcataaaattt 91531
>emb|AL354854.8| Human DNA sequence from clone RP11-572H4 on chromosome 9 Contains pseudogene similar to part of a novel gene (KIAA1688), a solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6 (SLC25A6) (ANT3) pseudogene and a CpG island, complete sequence Length = 169550 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Plus Query: 85 atgacaactgcacctacagttgca 108 ||||||| |||||||||||||||| Sbjct: 83532 atgacaaatgcacctacagttgca 83555
>gb|AC129929.5| Homo sapiens chromosome 11, clone RP5-1075F20, complete sequence Length = 141449 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 41 agtttcccttattattcata 60 |||||||||||||||||||| Sbjct: 91276 agtttcccttattattcata 91295
>gb|AE010299.1| Methanosarcina acetivorans str. C2A, complete genome Length = 5751492 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 355 tagggatcggtttccagatg 374 |||||||||||||||||||| Sbjct: 711308 tagggatcggtttccagatg 711327
>gb|AC007223.5| Homo sapiens chromosome 16 clone RP11-468I15, complete sequence Length = 159520 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 298 aagatggggagacagtgggc 317 |||||||||||||||||||| Sbjct: 63113 aagatggggagacagtgggc 63132
>gb|AC091012.8| Homo sapiens chromosome 11, clone RP11-113A6, complete sequence Length = 145042 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 41 agtttcccttattattcata 60 |||||||||||||||||||| Sbjct: 11654 agtttcccttattattcata 11635
>gb|AY953190.1| Uncultured anaerobic bacterium clone A-2A 16S ribosomal RNA gene, partial sequence Length = 1304 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 563 ccttcctccgcgttgccgcg 582 |||||||||||||||||||| Sbjct: 1085 ccttcctccgcgttgccgcg 1066
>gb|AE017196.1| Wolbachia endosymbiont of Drosophila melanogaster, complete genome Length = 1267782 Score = 40.1 bits (20), Expect = 7.9 Identities = 23/24 (95%) Strand = Plus / Minus Query: 55 ttcataaaattttgcaggattgat 78 ||||||||||||||||||| |||| Sbjct: 1103477 ttcataaaattttgcaggagtgat 1103454
>gb|AC002536.1|AC002536 Human Chromosome 11 pac pDJ1075f20, complete sequence Length = 140977 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 41 agtttcccttattattcata 60 |||||||||||||||||||| Sbjct: 49694 agtttcccttattattcata 49675
>emb|AL928732.7| Mouse DNA sequence from clone RP23-403C18 on chromosome 2, complete sequence Length = 149273 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 402 acagagaagatgtgtagctc 421 |||||||||||||||||||| Sbjct: 5955 acagagaagatgtgtagctc 5974
>dbj|AB029488.1| Homo sapiens C11orf21 mRNA, complete cds Length = 2967 Score = 40.1 bits (20), Expect = 7.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 41 agtttcccttattattcata 60 |||||||||||||||||||| Sbjct: 2786 agtttcccttattattcata 2805 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,431,982 Number of Sequences: 3902068 Number of extensions: 4431982 Number of successful extensions: 85566 Number of sequences better than 10.0: 32 Number of HSP's better than 10.0 without gapping: 32 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 85403 Number of HSP's gapped (non-prelim): 156 length of query: 584 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 561 effective length of database: 17,143,297,704 effective search space: 9617390011944 effective search space used: 9617390011944 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)