ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd25n10 |
|---|---|
| Clone Library Name | barley_pub |
>emb|Z66528.1|HVGLTP4X3 H.vulgare ltp4.3 gene Length = 1862 Score = 414 bits (209), Expect = e-113 Identities = 227/236 (96%) Strand = Plus / Minus Query: 124 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 183 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1454 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 1395 Query: 184 tgacagcaagnggncgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtan 243 |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 1394 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 1335 Query: 244 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttancccaccc 303 |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| Sbjct: 1334 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccaccc 1275 Query: 304 gcagcgctcttgatgcacttgcacnccgnttgcttgncancggngctctgggctgc 359 |||||||||||||||||||||||| ||| ||||||| || ||| |||||||||||| Sbjct: 1274 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgc 1219 Score = 83.8 bits (42), Expect = 4e-13 Identities = 44/45 (97%) Strand = Plus / Minus Query: 1 tacaacagtgtgccggccatgcagngctggctcaacgtacgtact 45 |||||||||||||||||||||||| |||||||||||||||||||| Sbjct: 1577 tacaacagtgtgccggccatgcagagctggctcaacgtacgtact 1533 Score = 79.8 bits (40), Expect = 6e-12 Identities = 40/40 (100%) Strand = Plus / Minus Query: 66 ccacatggagataatatatgagagcatttattcatatata 105 |||||||||||||||||||||||||||||||||||||||| Sbjct: 1512 ccacatggagataatatatgagagcatttattcatatata 1473
>emb|Z37115.1|HVLTPPB H.vulgare (clone pKG285) mRNA for lipid transfer protein precursor Length = 691 Score = 383 bits (193), Expect = e-103 Identities = 223/236 (94%) Strand = Plus / Minus Query: 124 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 183 ||||||||||||||||||||| ||||||| |||||||||||||||||||||||||||||| Sbjct: 439 aaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggcagcaagga 380 Query: 184 tgacagcaagnggncgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtan 243 |||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 379 tgacagcaagtggtcgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtag 320 Query: 244 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttancccaccc 303 ||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||| Sbjct: 319 gggacgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccc 260 Query: 304 gcagcgctcttgatgcacttgcacnccgnttgcttgncancggngctctgggctgc 359 |||||||||||||||||||||||| ||| ||||||| || ||| |||||| ||||| Sbjct: 259 gcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgcgctgc 204 Score = 79.8 bits (40), Expect = 6e-12 Identities = 40/40 (100%) Strand = Plus / Minus Query: 66 ccacatggagataatatatgagagcatttattcatatata 105 |||||||||||||||||||||||||||||||||||||||| Sbjct: 510 ccacatggagataatatatgagagcatttattcatatata 471 Score = 60.0 bits (30), Expect = 5e-06 Identities = 41/45 (91%) Strand = Plus / Minus Query: 1 tacaacagtgtgccggccatgcagngctggctcaacgtacgtact 45 |||||||| ||| |||||||||| |||||||||||||||||||| Sbjct: 571 tacaacagagtgttggccatgcagagctggctcaacgtacgtact 527
>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene, complete cds Length = 573 Score = 303 bits (153), Expect = 2e-79 Identities = 213/236 (90%) Strand = Plus / Minus Query: 124 aaataacctcaacgtactcagtgtctcaggatcgatagctggagctataggcagcaagga 183 ||||||||||||||||||||| ||||||| |||||||||||||||||||||||| || || Sbjct: 510 aaataacctcaacgtactcagcgtctcagcatcgatagctggagctataggcagaaacga 451 Query: 184 tgacagcaagnggncgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtan 243 | ||||||| || ||||||| |||||||||||||||||||||||| |||||||| ||| Sbjct: 450 cggcagcaagtggtcgatcagtgaatcttagagcagtcgacggaagtgctgatggagtag 391 Query: 244 gggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttancccaccc 303 |||||||||||||||||| |||||||||| |||||||||||||||||||||| |||| | Sbjct: 390 gggacgctgacgccgcacttggaggggatgccggcggccttgccagcgtttaacccagcg 331 Query: 304 gcagcgctcttgatgcacttgcacnccgnttgcttgncancggngctctgggctgc 359 |||||||||||||||||||||||| ||| ||||||| || ||| |||||| ||||| Sbjct: 330 gcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctctgcgctgc 275 Score = 60.0 bits (30), Expect = 5e-06 Identities = 33/34 (97%) Strand = Plus / Minus Query: 72 ggagataatatatgagagcatttattcatatata 105 ||||||||||||||||| |||||||||||||||| Sbjct: 573 ggagataatatatgagatcatttattcatatata 540
>emb|Z66529.1|HVGLTP4X9 H.vulgare Ltp4.2 gene Length = 1567 Score = 266 bits (134), Expect = 5e-68 Identities = 161/173 (93%) Strand = Plus / Minus Query: 187 cagcaagnggncgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtanggg 246 ||||||| || ||||||||||||||||||||||| |||||||| ||||||||||| ||| Sbjct: 1026 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 967 Query: 247 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttancccacccgca 306 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 966 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 907 Query: 307 gcgctcttgatgcacttgcacnccgnttgcttgncancggngctctgggctgc 359 ||||||||||||||||||||| ||| ||||||| || ||| |||||||||||| Sbjct: 906 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgc 854
>gb|U63993.1|HVU63993 Hordeum vulgare lipid transfer protein (blt4.9) gene, complete cds Length = 3238 Score = 266 bits (134), Expect = 5e-68 Identities = 161/173 (93%) Strand = Plus / Minus Query: 187 cagcaagnggncgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtanggg 246 ||||||| || ||||||||||||||||||||||| |||||||| ||||||||||| ||| Sbjct: 2422 cagcaagtggttgatcagcgaatcttagagcagtccacggaagcactgatggcgtagggg 2363 Query: 247 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttancccacccgca 306 ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| Sbjct: 2362 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttagcccacccgca 2303 Query: 307 gcgctcttgatgcacttgcacnccgnttgcttgncancggngctctgggctgc 359 ||||||||||||||||||||| ||| ||||||| || ||| |||||||||||| Sbjct: 2302 gcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctctgggctgc 2250
>emb|X68654.1|HVCW21 H.vulgare Cw-21 mRNA Length = 705 Score = 252 bits (127), Expect = 7e-64 Identities = 157/170 (92%) Strand = Plus / Minus Query: 187 cagcaagnggncgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtanggg 246 ||||||| || |||||||||||||||||||||||||||||||||||||||||||| ||| Sbjct: 421 cagcaagtggttgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtagggg 362 Query: 247 acgctgacgccgcacatggaggggattccggcggccttgccagcgtttancccacccgca 306 |||||||||||||||||||||||||| |||||||||||||||||||||| |||||| ||| Sbjct: 361 acgctgacgccgcacatggaggggatgccggcggccttgccagcgtttagcccaccagca 302 Query: 307 gcgctcttgatgcacttgcacnccgnttgcttgncancggngctctgggc 356 ||||||||||||||||||||| ||| ||| ||| || ||| ||||||||| Sbjct: 301 gcgctcttgatgcacttgcacgccgcttgtttgtcagcggtgctctgggc 252 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Minus Query: 81 atatgagagcatttattcatatata 105 ||||||||||||||||||||||||| Sbjct: 498 atatgagagcatttattcatatata 474
>emb|AJ784903.1| Triticum turgidum subsp. durum partial mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 604 Score = 194 bits (98), Expect = 1e-46 Identities = 155/177 (87%) Strand = Plus / Minus Query: 182 gatgacagcaagnggncgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 241 |||| ||||||| | ||||||||||||||||||||||||||| |||| ||||||||||| Sbjct: 332 gatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 273 Query: 242 angggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttancccac 301 | |||||||| ||||||||| | | |||||| |||||||||||||||||||| | |||| Sbjct: 272 aagggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 213 Query: 302 ccgcagcgctcttgatgcacttgcacnccgnttgcttgncancggngctctgggctg 358 | |||||||||||||||||||||||| ||| ||||||| || ||| |||| |||||| Sbjct: 212 cagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctg 156 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Minus Query: 81 atatgagagcatttattcatatata 105 ||||||||||||||||||||||||| Sbjct: 437 atatgagagcatttattcatatata 413
>emb|AJ852555.1| Triticum aestivum ltp9.2c gene for type 1 non specific lipid transfer protein precursor Length = 2122 Score = 194 bits (98), Expect = 1e-46 Identities = 155/177 (87%) Strand = Plus / Minus Query: 182 gatgacagcaagnggncgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 241 |||| ||||||| | ||||||||||||||||||||||||||| |||| ||||||||||| Sbjct: 1636 gatggcagcaagtgctcgatcagcgaatcttagagcagtcgaccgaagagctgatggcgt 1577 Query: 242 angggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttancccac 301 | |||||||| ||||||||| | | |||||| |||||||||||||||||||| | |||| Sbjct: 1576 aggggacgctaacgccgcactttgtggggatgccggcggccttgccagcgttgagcccag 1517 Query: 302 ccgcagcgctcttgatgcacttgcacnccgnttgcttgncancggngctctgggctg 358 | |||||||||||||||||||||||| ||| ||||||| || ||| |||| |||||| Sbjct: 1516 cagcagcgctcttgatgcacttgcacgccgcttgcttgtcagcggtgctccgggctg 1460 Score = 42.1 bits (21), Expect = 1.2 Identities = 21/21 (100%) Strand = Plus / Minus Query: 81 atatgagagcatttattcata 101 ||||||||||||||||||||| Sbjct: 1745 atatgagagcatttattcata 1725
>emb|AJ852556.1| Triticum aestivum ltp9.2d gene for type 1 non specific lipid transfer protein precursor Length = 2087 Score = 178 bits (90), Expect = 8e-42 Identities = 153/177 (86%) Strand = Plus / Minus Query: 182 gatgacagcaagnggncgatcagcgaatcttagagcagtcgacggaagcgctgatggcgt 241 |||| ||||||| | ||||||| ||||||||||||||||||| |||| ||||||||||| Sbjct: 1624 gatggcagcaagtgctcgatcagtgaatcttagagcagtcgaccgaagagctgatggcgt 1565 Query: 242 angggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttancccac 301 | |||||||| ||||||||| | | |||||| ||||||||||||||||| || | |||| Sbjct: 1564 aggggacgctaacgccgcactttgtggggatgccggcggccttgccagcattgagcccag 1505 Query: 302 ccgcagcgctcttgatgcacttgcacnccgnttgcttgncancggngctctgggctg 358 | |||||||||||||||||||||||| ||| ||||||| || ||| |||| |||||| Sbjct: 1504 cagcagcgctcttgatgcacttgcacaccgcttgcttgtcagcggtgctccgggctg 1448 Score = 50.1 bits (25), Expect = 0.005 Identities = 25/25 (100%) Strand = Plus / Minus Query: 81 atatgagagcatttattcatatata 105 ||||||||||||||||||||||||| Sbjct: 1733 atatgagagcatttattcatatata 1709
>emb|AJ784901.1| Triticum aestivum mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.2 gene) Length = 708 Score = 174 bits (88), Expect = 1e-40 Identities = 141/161 (87%) Strand = Plus / Minus Query: 198 cgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgcc 257 ||||||||||||||||||||||||||| |||| |||||||||||| |||| ||| ||||| Sbjct: 417 cgatcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggatgctaacgcc 358 Query: 258 gcacatggaggggattccggcggccttgccagcgtttancccacccgcagcgctcttgat 317 |||| | | |||||| |||||||||||||||||||| | |||| | |||||||||||||| Sbjct: 357 gcactttgtggggatgccggcggccttgccagcgttgagcccagcagcagcgctcttgat 298 Query: 318 gcacttgcacnccgnttgcttgncancggngctctgggctg 358 ||||||||| ||| ||||||| || ||| |||| |||||| Sbjct: 297 acacttgcacgccgcttgcttgtcagcggtgctccgggctg 257 Score = 54.0 bits (27), Expect = 3e-04 Identities = 27/27 (100%) Strand = Plus / Minus Query: 79 atatatgagagcatttattcatatata 105 ||||||||||||||||||||||||||| Sbjct: 542 atatatgagagcatttattcatatata 516
>gb|DQ465676.1| Triticum aestivum clone Lt10F9 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 168 bits (85), Expect = 8e-39 Identities = 138/158 (87%) Strand = Plus / Minus Query: 201 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgca 260 |||||||||||||||||||||||| |||| |||||||||||| |||||||| |||||||| Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289 Query: 261 catggaggggattccggcggccttgccagcgtttancccacccgcagcgctcttgatgca 320 | | | |||||| || ||||||||||||||||| | |||| | |||||||||||||| || Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229 Query: 321 cttgcacnccgnttgcttgncancggngctctgggctg 358 ||||||| ||| ||||||| || ||| |||| |||||| Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctg 191
>gb|DQ465678.1| Triticum aestivum clone Lt10E10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 168 bits (85), Expect = 8e-39 Identities = 138/158 (87%) Strand = Plus / Minus Query: 201 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgca 260 |||||||||||||||||||||||| |||| |||||||||||| |||||||| |||||||| Sbjct: 348 tcagcgaatcttagagcagtcgaccgaagagctgatggcgtaggggacgctaacgccgca 289 Query: 261 catggaggggattccggcggccttgccagcgtttancccacccgcagcgctcttgatgca 320 | | | |||||| || ||||||||||||||||| | |||| | |||||||||||||| || Sbjct: 288 ctttgtggggatgcccgcggccttgccagcgttgagcccagcagcagcgctcttgataca 229 Query: 321 cttgcacnccgnttgcttgncancggngctctgggctg 358 ||||||| ||| ||||||| || ||| |||| |||||| Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctccgggctg 191
>gb|DQ465679.1| Triticum aestivum clone Lt19C10 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 155 bits (78), Expect = 1e-34 Identities = 131/151 (86%) Strand = Plus / Minus Query: 201 tcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgca 260 ||||||||||||||||||||| ||||| | ||| |||||||| |||| |||||||||||| Sbjct: 348 tcagcgaatcttagagcagtccacggatgagctaatggcgtaggggatgctgacgccgca 289 Query: 261 catggaggggattccggcggccttgccagcgtttancccacccgcagcgctcttgatgca 320 | |||||||||| || |||||||| |||||||| | |||||| ||||| ||||| ||||| Sbjct: 288 cttggaggggatgcctgcggcctttccagcgttgagcccaccagcagcactcttaatgca 229 Query: 321 cttgcacnccgnttgcttgncancggngctc 351 ||||||| ||| ||||||| || ||| |||| Sbjct: 228 cttgcacgccgcttgcttgtcagcggtgctc 198
>gb|AY566607.1| Triticum aestivum lipid transfer protein (LPT1) gene, complete cds Length = 3448 Score = 107 bits (54), Expect = 3e-20 Identities = 119/142 (83%) Strand = Plus / Minus Query: 198 cgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgcc 257 ||||||| | |||||||||||||| ||||| |||||||||| ||| |||| ||||||||| Sbjct: 3207 cgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgcc 3148 Query: 258 gcacatggaggggattccggcggccttgccagcgtttancccacccgcagcgctcttgat 317 |||| |||||||||| | || ||||| || | ||| | |||||| ||||| |||||||| Sbjct: 3147 gcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgat 3088 Query: 318 gcacttgcacnccgnttgcttg 339 |||| |||| ||| ||||||| Sbjct: 3087 gcacctgcatgccgcttgcttg 3066 Score = 52.0 bits (26), Expect = 0.001 Identities = 41/45 (91%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 1 tacaacagtgtgccggccatgcagngctggctcaacgtacgtact 45 |||||||||| |||||| |||||| |||||||| ||||||||||| Sbjct: 3392 tacaacagtg-gccggctatgcagagctggctcgacgtacgtact 3349
>gb|AF302788.1|AF302788 Triticum aestivum lipid transfer protein precursor (LTP1) mRNA, complete cds Length = 737 Score = 107 bits (54), Expect = 3e-20 Identities = 119/142 (83%) Strand = Plus / Minus Query: 198 cgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgcc 257 ||||||| | |||||||||||||| ||||| |||||||||| ||| |||| ||||||||| Sbjct: 411 cgatcagtggatcttagagcagtccacggatgcgctgatggagtaggggatgctgacgcc 352 Query: 258 gcacatggaggggattccggcggccttgccagcgtttancccacccgcagcgctcttgat 317 |||| |||||||||| | || ||||| || | ||| | |||||| ||||| |||||||| Sbjct: 351 gcacttggaggggatacttgcagcctttccggggttgagcccaccggcagcactcttgat 292 Query: 318 gcacttgcacnccgnttgcttg 339 |||| |||| ||| ||||||| Sbjct: 291 gcacctgcatgccgcttgcttg 270 Score = 52.0 bits (26), Expect = 0.001 Identities = 41/45 (91%), Gaps = 1/45 (2%) Strand = Plus / Minus Query: 1 tacaacagtgtgccggccatgcagngctggctcaacgtacgtact 45 |||||||||| |||||| |||||| |||||||| ||||||||||| Sbjct: 596 tacaacagtg-gccggctatgcagagctggctcgacgtacgtact 553
>gb|AY796184.1| Triticum aestivum lipid transfer protein (LTP1) mRNA, complete cds Length = 348 Score = 103 bits (52), Expect = 4e-19 Identities = 111/132 (84%) Strand = Plus / Minus Query: 208 atcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggag 267 |||||||||||||| ||||| |||||||||| ||| |||| ||||||||||||| ||||| Sbjct: 341 atcttagagcagtccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282 Query: 268 gggattccggcggccttgccagcgtttancccacccgcagcgctcttgatgcacttgcac 327 ||||| | || ||||| || | ||| | |||||| ||||| |||||||||||| |||| Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222 Query: 328 nccgnttgcttg 339 ||| ||||||| Sbjct: 221 gccgcttgcttg 210
>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0086N07 map S790A, complete sequence Length = 178523 Score = 101 bits (51), Expect = 2e-18 Identities = 74/82 (90%) Strand = Plus / Plus Query: 212 tagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggagggga 271 |||||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||| Sbjct: 94021 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 94080 Query: 272 ttccggcggccttgccagcgtt 293 | | |||||| ||||| ||||| Sbjct: 94081 tgctggcggcgttgccggcgtt 94102
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 101 bits (51), Expect = 2e-18 Identities = 74/82 (90%) Strand = Plus / Minus Query: 212 tagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggagggga 271 |||||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||| Sbjct: 13090059 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13090000 Query: 272 ttccggcggccttgccagcgtt 293 | | |||||| ||||| ||||| Sbjct: 13089999 tgctggcggcgttgccggcgtt 13089978 Score = 89.7 bits (45), Expect = 6e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| |||||||||||||| ||| |||||||||||||||||| | |||||||| Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 702381 ctggcggcgttgccggcgtt 702362 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 692704 ctggcggcattgccggcgtt 692685 Score = 61.9 bits (31), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||||| |||||||||||| |||| | ||||| ||||| |||||||||| Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410 Query: 274 ccggcg 279 |||||| Sbjct: 679409 ccggcg 679404
>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full insert sequence Length = 843 Score = 101 bits (51), Expect = 2e-18 Identities = 74/82 (90%) Strand = Plus / Minus Query: 212 tagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggagggga 271 |||||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||| Sbjct: 459 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 400 Query: 272 ttccggcggccttgccagcgtt 293 | | |||||| ||||| ||||| Sbjct: 399 tgctggcggcgttgccggcgtt 378
>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full insert sequence Length = 846 Score = 101 bits (51), Expect = 2e-18 Identities = 74/82 (90%) Strand = Plus / Minus Query: 212 tagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggagggga 271 |||||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||| Sbjct: 458 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 399 Query: 272 ttccggcggccttgccagcgtt 293 | | |||||| ||||| ||||| Sbjct: 398 tgctggcggcgttgccggcgtt 377
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 101 bits (51), Expect = 2e-18 Identities = 74/82 (90%) Strand = Plus / Minus Query: 212 tagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggagggga 271 |||||||||||| |||||||||||||| ||| |||||||||||||||||| ||||||||| Sbjct: 13170238 tagagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggagggga 13170179 Query: 272 ttccggcggccttgccagcgtt 293 | | |||||| ||||| ||||| Sbjct: 13170178 tgctggcggcgttgccggcgtt 13170157 Score = 89.7 bits (45), Expect = 6e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| |||||||||||||| ||| |||||||||||||||||| | |||||||| Sbjct: 702441 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 702382 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 702381 ctggcggcgttgccggcgtt 702362 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 692764 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 692705 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 692704 ctggcggcattgccggcgtt 692685 Score = 61.9 bits (31), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||||| |||||||||||| |||| | ||||| ||||| |||||||||| Sbjct: 679469 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 679410 Query: 274 ccggcg 279 |||||| Sbjct: 679409 ccggcg 679404
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 97.6 bits (49), Expect = 2e-17 Identities = 72/80 (90%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||| Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 736683 ctggcggcgttgccggcgtt 736664 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 732556 ctggcggcattgccggcgtt 732537 Score = 61.9 bits (31), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||||| |||||| ||||| |||| | ||||||||||| |||||||||| Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668 Query: 274 ccggcg 279 |||||| Sbjct: 722667 ccggcg 722662
>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 Length = 511 Score = 97.6 bits (49), Expect = 2e-17 Identities = 72/80 (90%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||| Sbjct: 413 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 354 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 353 ctggcggcgttgccggcgtt 334
>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full insert sequence Length = 995 Score = 97.6 bits (49), Expect = 2e-17 Identities = 72/80 (90%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||| Sbjct: 670 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 611 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 610 ctggcggcgttgccggcgtt 591
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 97.6 bits (49), Expect = 2e-17 Identities = 72/80 (90%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||| Sbjct: 736743 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 736684 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 736683 ctggcggcgttgccggcgtt 736664 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 732616 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 732557 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 732556 ctggcggcattgccggcgtt 732537 Score = 61.9 bits (31), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||||| |||||| ||||| |||| | ||||||||||| |||||||||| Sbjct: 722727 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 722668 Query: 274 ccggcg 279 |||||| Sbjct: 722667 ccggcg 722662
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118211 Score = 97.6 bits (49), Expect = 2e-17 Identities = 72/80 (90%) Strand = Plus / Plus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||| Sbjct: 42391 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 42450 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 42451 ctggcggcgttgccggcgtt 42470 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Plus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 46518 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 46577 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 46578 ctggcggcattgccggcgtt 46597 Score = 61.9 bits (31), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||||| |||||| ||||| |||| | ||||||||||| |||||||||| Sbjct: 56407 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 56466 Query: 274 ccggcg 279 |||||| Sbjct: 56467 ccggcg 56472
>gb|DQ465677.1| Triticum aestivum clone Lt10B6 non-specific lipid transfer protein 1 precursor, mRNA, complete cds Length = 348 Score = 95.6 bits (48), Expect = 1e-16 Identities = 110/132 (83%) Strand = Plus / Minus Query: 208 atcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggag 267 ||||||||||| || ||||| |||||||||| ||| |||| ||||||||||||| ||||| Sbjct: 341 atcttagagcaatccacggatgcgctgatggagtaggggatgctgacgccgcacttggag 282 Query: 268 gggattccggcggccttgccagcgtttancccacccgcagcgctcttgatgcacttgcac 327 ||||| | || ||||| || | ||| | |||||| ||||| |||||||||||| |||| Sbjct: 281 gggatacttgcagcctttccggggttgagcccaccggcagcactcttgatgcacctgcat 222 Query: 328 nccgnttgcttg 339 ||| ||||||| Sbjct: 221 gccgcttgcttg 210
>gb|AY335485.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LT1 mRNA, complete cds Length = 530 Score = 89.7 bits (45), Expect = 6e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| |||||||||||||| ||| |||||||||||||||||| | |||||||| Sbjct: 426 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 367 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 366 ctggcggcgttgccggcgtt 347
>gb|AF334185.1|AF334185 Triticum aestivum lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 730 Score = 89.7 bits (45), Expect = 6e-15 Identities = 77/88 (87%) Strand = Plus / Minus Query: 198 cgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgcc 257 ||||||| | |||||||||||||| ||||| |||||||| | ||| |||||||||||||| Sbjct: 430 cgatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgcc 371 Query: 258 gcacatggaggggattccggcggccttg 285 |||| ||||||| || || ||||||||| Sbjct: 370 gcacttggagggaatgcctgcggccttg 343
>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein Length = 799 Score = 89.7 bits (45), Expect = 6e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||| |||| |||||||||||||| ||| |||||||||||||||||| |||||||||| Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 378 ctggcggcgttgccggcgtt 359
>dbj|AK070414.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023053H09, full insert sequence Length = 2882 Score = 89.7 bits (45), Expect = 6e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| |||||||||||||| ||| |||||||||||||||||| | |||||||| Sbjct: 2445 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 2386 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 2385 ctggcggcgttgccggcgtt 2366
>dbj|AK058805.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-003-B09, full insert sequence Length = 551 Score = 89.7 bits (45), Expect = 6e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| |||||||||||||| ||| |||||||||||||||||| | |||||||| Sbjct: 322 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 263 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 262 ctggcggcgttgccggcgtt 243
>emb|AJ852557.1| Triticum aestivum ltp9.5b gene for type 1 non specific lipid transfer protein precursor Length = 496 Score = 89.7 bits (45), Expect = 6e-15 Identities = 77/88 (87%) Strand = Plus / Minus Query: 198 cgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgcc 257 ||||||| | |||||||||||||| ||||| |||||||| | ||| |||||||||||||| Sbjct: 371 cgatcagtggatcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgcc 312 Query: 258 gcacatggaggggattccggcggccttg 285 |||| ||||||| || || ||||||||| Sbjct: 311 gcacttggagggaatgcctgcggccttg 284
>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from chromosome 11 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 181322 Score = 89.7 bits (45), Expect = 6e-15 Identities = 71/80 (88%) Strand = Plus / Plus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| |||||||||||||| ||| |||||||||||||||||| | |||||||| Sbjct: 40531 gagcagtcgatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 40590 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 40591 ctggcggcgttgccggcgtt 40610 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Plus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 50208 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 50267 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 50268 ctggcggcattgccggcgtt 50287 Score = 61.9 bits (31), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Plus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||||| |||||||||||| |||| | ||||| ||||| |||||||||| Sbjct: 63503 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 63562 Query: 274 ccggcg 279 |||||| Sbjct: 63563 ccggcg 63568
>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds Length = 799 Score = 89.7 bits (45), Expect = 6e-15 Identities = 71/80 (88%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||| |||| |||||||||||||| ||| |||||||||||||||||| |||||||||| Sbjct: 438 gagcaatcgatggaagcgctgatggtgtaggggacgctgacgccgcacttggaggggatg 379 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 378 ctggcggcgttgccggcgtt 359
>gb|AF017360.1|AF017360 Oryza sativa lipid transfer protein LPT III mRNA, complete cds Length = 805 Score = 87.7 bits (44), Expect = 2e-14 Identities = 72/80 (90%), Gaps = 1/80 (1%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| |||||||||||||| ||| |||||||||||||||||| |||||||||| Sbjct: 412 gagcagtcgatggaagcgctgatggtgta-gggacgctgacgccgcacttggaggggatg 354 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 353 ctggcggcgttgccggcgtt 334
>gb|AY754742.1| Triticum aestivum lipid transfer protein (LTP2) mRNA, complete cds Length = 348 Score = 85.7 bits (43), Expect = 9e-14 Identities = 69/78 (88%) Strand = Plus / Minus Query: 208 atcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggag 267 |||||||||||||| ||||| |||||||| | ||| |||||||||||||||||| ||||| Sbjct: 341 atcttagagcagtccacggatgcgctgatcgtgtaggggacgctgacgccgcacttggag 282 Query: 268 gggattccggcggccttg 285 || || || ||||||||| Sbjct: 281 ggaatgcctgcggccttg 264
>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA Length = 724 Score = 81.8 bits (41), Expect = 1e-12 Identities = 82/96 (85%) Strand = Plus / Minus Query: 198 cgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgcc 257 ||||||| | ||||||||||||||||| |||||||| | ||| |||||||||||||| Sbjct: 421 cgatcagtggatcttagagcagtcgacactggcgctgatcgtgtaggggacgctgacgcc 362 Query: 258 gcacatggaggggattccggcggccttgccagcgtt 293 |||| |||||||||| || |||||| |||| ||||| Sbjct: 361 gcacctggaggggatgcctgcggccctgccggcgtt 326
>gb|AF017361.1|AF017361 Oryza sativa lipid transfer protein LPT IV mRNA, complete cds Length = 507 Score = 81.8 bits (41), Expect = 1e-12 Identities = 70/80 (87%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||| || |||||||||||||| ||| |||||||||||||||||| | |||||||| Sbjct: 373 gagcagtggatggaagcgctgatggtgtaggggacgctgacgccgcacttagaggggatg 314 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 313 ctggcggcgttgccggcgtt 294
>gb|AY327042.1| Oryza sativa (japonica cultivar-group) lipid transfer protein LPT1 mRNA, complete cds Length = 647 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 469 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 410 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 409 ctggcggcattgccggcgtt 390
>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor Length = 627 Score = 73.8 bits (37), Expect = 3e-10 Identities = 81/96 (84%) Strand = Plus / Minus Query: 198 cgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgcc 257 ||||||| | ||||| ||||||||||| |||||||| | ||| |||||||||||||| Sbjct: 353 cgatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgacgcc 294 Query: 258 gcacatggaggggattccggcggccttgccagcgtt 293 |||| |||||||||| || |||||| |||| ||||| Sbjct: 293 gcacctggaggggatgcctgcggccctgccggcgtt 258
>emb|Z23271.1|OSLPTPRA O.sativa lipid transfer protein gene, complete CDS Length = 1485 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 701 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 642 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 641 ctggcggcattgccggcgtt 622
>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA Length = 717 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||||||||||||||||| |||||||||| Sbjct: 294 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 235 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 234 ctggcggcgttgccggcgtt 215
>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene Length = 1499 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||||||||||||||||| |||||||||| Sbjct: 997 gagcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttggaggggatg 938 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 937 ctggcggcgttgccggcgtt 918
>emb|X83434.1|OSLTPB1 O.sativa mRNA for lipid transfer protein, b1 Length = 692 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 331 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 272 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 271 ctggcggcattgccggcgtt 252
>dbj|AK059819.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-C07, full insert sequence Length = 1003 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 654 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 595 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 594 ctggcggcattgccggcgtt 575
>dbj|AK058896.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-G08, full insert sequence Length = 840 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 437 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 378 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 377 ctggcggcattgccggcgtt 358
>gb|AF017359.1|AF017359 Oryza sativa lipid transfer protein LPT II mRNA, complete cds Length = 845 Score = 73.8 bits (37), Expect = 3e-10 Identities = 69/80 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 419 gagcagtcgatggaggggctgatggtgtaggggatgctgacgccgcacttggaggggatg 360 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 359 ctggcggcattgccggcgtt 340
>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene Length = 1800 Score = 69.9 bits (35), Expect = 5e-09 Identities = 64/74 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 965 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 906 Query: 274 ccggcggccttgcc 287 | |||||||||||| Sbjct: 905 ctggcggccttgcc 892
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 69.9 bits (35), Expect = 5e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||||| |||||||||||| |||| | ||||||||||| |||||||||| Sbjct: 14437064 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 14437005 Query: 274 ccggcg 279 |||||| Sbjct: 14437004 ccggcg 14436999
>dbj|AP004134.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1116_C12 Length = 116758 Score = 69.9 bits (35), Expect = 5e-09 Identities = 58/66 (87%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||||| |||||||||||| |||| | ||||||||||| |||||||||| Sbjct: 45562 gagcagtcggtggaagggctgatggcgtaggggatgttgacgccgcacttggaggggatg 45503 Query: 274 ccggcg 279 |||||| Sbjct: 45502 ccggcg 45497
>gb|AF017358.1|AF017358 Oryza sativa lipid transfer protein mRNA, complete cds Length = 695 Score = 69.9 bits (35), Expect = 5e-09 Identities = 61/70 (87%) Strand = Plus / Minus Query: 226 gaagcgctgatggcgtangggacgctgacgccgcacatggaggggattccggcggccttg 285 |||| |||||||| ||| |||| ||||||||||||| |||||||||| | |||||| ||| Sbjct: 325 gaagggctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattg 266 Query: 286 ccagcgttta 295 || ||||||| Sbjct: 265 ccggcgttta 256
>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds Length = 770 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 423 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 364 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 363 ctggcggcgttgccggcgtt 344
>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1 (plt1) gene, partial cds Length = 698 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 333 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 274 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 273 ctggcggcgttgccggcgtt 254
>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 265 ctggcggcgttgccggcgtt 246
>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 325 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 266 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 265 ctggcggcgttgccggcgtt 246
>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 804 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 374 ctggcggcgttgccggcgtt 355
>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 391 ctggcggcgttgccggcgtt 372
>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 344 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 285 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 284 ctggcggcgttgccggcgtt 265
>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 613 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 258 ctggcggcgttgccggcgtt 239
>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2) gene, partial cds Length = 613 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 259 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 258 ctggcggcgttgccggcgtt 239
>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 829 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 414 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 355 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 354 ctggcggcgttgccggcgtt 335
>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer protein 2 (plt2) gene, complete cds Length = 816 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 818 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 832 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 820 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 65.9 bits (33), Expect = 9e-08 Identities = 68/80 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 356 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>dbj|AK107447.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C01, full insert sequence Length = 718 Score = 63.9 bits (32), Expect = 3e-07 Identities = 55/63 (87%) Strand = Plus / Plus Query: 231 gctgatggcgtangggacgctgacgccgcacatggaggggattccggcggccttgccagc 290 |||||||| ||| |||| ||||||||||||| |||||||||| | |||||| ||||| || Sbjct: 97 gctgatggtgtaggggatgctgacgccgcacttggaggggatgctggcggcattgccggc 156 Query: 291 gtt 293 ||| Sbjct: 157 gtt 159
>dbj|AK104981.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-125-E10, full insert sequence Length = 793 Score = 61.9 bits (31), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||||| |||||| ||||| |||| | ||||||||||| |||||||||| Sbjct: 430 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 371 Query: 274 ccggcg 279 |||||| Sbjct: 370 ccggcg 365
>dbj|AK102455.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033094A19, full insert sequence Length = 3876 Score = 61.9 bits (31), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||||| |||||| ||||| |||| | ||||||||||| |||||||||| Sbjct: 3516 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 3457 Query: 274 ccggcg 279 |||||| Sbjct: 3456 ccggcg 3451
>dbj|AK073466.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044B21, full insert sequence Length = 792 Score = 61.9 bits (31), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||||| |||||| ||||| |||| | ||||||||||| |||||||||| Sbjct: 432 gagcagtcggtggaagggctgatagcgtaggggatgttgacgccgcacttggaggggatg 373 Query: 274 ccggcg 279 |||||| Sbjct: 372 ccggcg 367
>dbj|AK063683.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-119-E10, full insert sequence Length = 745 Score = 61.9 bits (31), Expect = 1e-06 Identities = 57/66 (86%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||||| |||||||||||| |||| | ||||| ||||| |||||||||| Sbjct: 434 gagcagtcggtggaagggctgatggcgtaggggatgttgacgtcgcacttggaggggatg 375 Query: 274 ccggcg 279 |||||| Sbjct: 374 ccggcg 369
>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA Length = 732 Score = 60.0 bits (30), Expect = 5e-06 Identities = 71/85 (83%) Strand = Plus / Minus Query: 198 cgatcagcgaatcttagagcagtcgacggaagcgctgatggcgtangggacgctgacgcc 257 ||||||| | ||||| ||||||||||| |||||||| | ||| ||||||||||| || Sbjct: 424 cgatcagtggatcttggagcagtcgacactggcgctgatcgtgtaggggacgctgacccc 365 Query: 258 gcacatggaggggattccggcggcc 282 |||| |||||||||| || |||||| Sbjct: 364 gcacctggaggggatgcctgcggcc 340
>gb|AY789644.1| Triticum aestivum lipid transfer protein 4 (LTP4) mRNA, complete cds Length = 345 Score = 58.0 bits (29), Expect = 2e-05 Identities = 86/107 (80%) Strand = Plus / Minus Query: 240 gtangggacgctgacgccgcacatggaggggattccggcggccttgccagcgtttanccc 299 ||| ||||||||||||| |||| |||||||||| | |||||| |||| | || | ||| Sbjct: 309 gtaggggacgctgacgcggcacttggaggggatctctgcggccgtgccttctttgacccc 250 Query: 300 acccgcagcgctcttgatgcacttgcacnccgnttgcttgncancgg 346 ||| ||||| |||||||||||| |||| ||| || |||| || ||| Sbjct: 249 accggcagcactcttgatgcacaggcacgccgctttcttgtcagcgg 203
>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence Length = 827 Score = 58.0 bits (29), Expect = 2e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 434 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 375 Query: 274 ccggcggc 281 | |||||| Sbjct: 374 ctggcggc 367
>gb|U31766.1|OSU31766 Oryza sativa lipid transfer protein precursor (LTP2) mRNA, complete cds Length = 840 Score = 58.0 bits (29), Expect = 2e-05 Identities = 67/80 (83%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 |||||||||| ||| | |||||||| ||| |||| ||||||||||| |||||||||| Sbjct: 414 gagcagtcgatggaggggctgatggtgtaggggatcgtgacgccgcacttggaggggatg 355 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 354 ctggcggcattgccggcgtt 335
>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 699 Score = 58.0 bits (29), Expect = 2e-05 Identities = 67/80 (83%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| ||||||| || Sbjct: 318 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggagggtatg 259 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 258 ctggcggcgttgccggcgtt 239
>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 780 Score = 58.0 bits (29), Expect = 2e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 416 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 357 Query: 274 ccggcggc 281 | |||||| Sbjct: 356 ctggcggc 349
>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 714 Score = 58.0 bits (29), Expect = 2e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 341 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 282 Query: 274 ccggcggc 281 | |||||| Sbjct: 281 ctggcggc 274
>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 648 Score = 58.0 bits (29), Expect = 2e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 440 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 381 Query: 274 ccggcggc 281 | |||||| Sbjct: 380 ctggcggc 373
>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer protein 1 (plt1) gene, complete cds Length = 829 Score = 58.0 bits (29), Expect = 2e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394 Query: 274 ccggcggc 281 | |||||| Sbjct: 393 ctggcggc 386
>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 58.0 bits (29), Expect = 2e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 455 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 396 Query: 274 ccggcggc 281 | |||||| Sbjct: 395 ctggcggc 388
>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 821 Score = 58.0 bits (29), Expect = 2e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391 Query: 274 ccggcggc 281 | |||||| Sbjct: 390 ctggcggc 383
>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 832 Score = 58.0 bits (29), Expect = 2e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 453 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 394 Query: 274 ccggcggc 281 | |||||| Sbjct: 393 ctggcggc 386
>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 835 Score = 58.0 bits (29), Expect = 2e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391 Query: 274 ccggcggc 281 | |||||| Sbjct: 390 ctggcggc 383
>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 814 Score = 58.0 bits (29), Expect = 2e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 450 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 391 Query: 274 ccggcggc 281 | |||||| Sbjct: 390 ctggcggc 383
>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 58.0 bits (29), Expect = 2e-05 Identities = 67/80 (83%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||| ||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 58.0 bits (29), Expect = 2e-05 Identities = 67/80 (83%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||| ||||| Sbjct: 415 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggacgggatg 356 Query: 274 ccggcggccttgccagcgtt 293 | |||||| ||||| ||||| Sbjct: 355 ctggcggcgttgccggcgtt 336
>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end Length = 677 Score = 58.0 bits (29), Expect = 2e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 264 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 205 Query: 274 ccggcggc 281 | |||||| Sbjct: 204 ctggcggc 197
>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone 9C2 Length = 813 Score = 58.0 bits (29), Expect = 2e-05 Identities = 58/68 (85%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| ||| |||| ||||||||||||| |||||||||| Sbjct: 451 gagcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttggaggggatg 392 Query: 274 ccggcggc 281 | |||||| Sbjct: 391 ctggcggc 384
>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA Length = 660 Score = 56.0 bits (28), Expect = 8e-05 Identities = 44/51 (86%) Strand = Plus / Minus Query: 309 gctcttgatgcacttgcacnccgnttgcttgncancggngctctgggctgc 359 |||||||| |||| ||||| ||| ||||||| || ||| |||||||||||| Sbjct: 285 gctcttgaggcacctgcacgccgcttgcttgtcagcggtgctctgggctgc 235
>gb|DQ147200.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 709 Score = 50.1 bits (25), Expect = 0.005 Identities = 57/68 (83%) Strand = Plus / Minus Query: 214 gagcagtcgacggaagcgctgatggcgtangggacgctgacgccgcacatggaggggatt 273 ||||||||| ||| | |||||||| || |||| ||||||||||||| |||||||||| Sbjct: 319 gagcagtcggtggaggtgctgatggtataggggatgctgacgccgcacttggaggggatg 260 Query: 274 ccggcggc 281 | |||||| Sbjct: 259 ctggcggc 252
>gb|AY662492.1| Hordeum vulgare subsp. vulgare non-specific lipid transfer protein 6 (Ltp6) gene, promoter and complete cds Length = 3257 Score = 44.1 bits (22), Expect = 0.31 Identities = 42/49 (85%) Strand = Plus / Minus Query: 231 gctgatggcgtangggacgctgacgccgcacatggaggggattccggcg 279 |||||||||||| |||| | ||||||||||| || |||||| |||||| Sbjct: 2770 gctgatggcgtaggggatgttgacgccgcacttgctggggatgccggcg 2722
>emb|AL590110.11| Human DNA sequence from clone RP11-254O21 on chromosome 1 Contains the 3' end of a novel gene, complete sequence Length = 128843 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 67 cacatggagataatatatga 86 |||||||||||||||||||| Sbjct: 114026 cacatggagataatatatga 114007
>emb|AL157829.24| Human DNA sequence from clone RP11-305F14 on chromosome 9 Contains part of the ASTN2 gene for astrotactin2 (KIAA0634), and a CpG island, complete sequence Length = 162575 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 tggagataatatatgagagc 90 |||||||||||||||||||| Sbjct: 31942 tggagataatatatgagagc 31961
>emb|BX649439.8| Zebrafish DNA sequence from clone DKEY-21A8 in linkage group 2, complete sequence Length = 146298 Score = 40.1 bits (20), Expect = 4.9 Identities = 20/20 (100%) Strand = Plus / Plus Query: 71 tggagataatatatgagagc 90 |||||||||||||||||||| Sbjct: 85666 tggagataatatatgagagc 85685 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 1,509,365 Number of Sequences: 3902068 Number of extensions: 1509365 Number of successful extensions: 24255 Number of sequences better than 10.0: 110 Number of HSP's better than 10.0 without gapping: 112 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 24027 Number of HSP's gapped (non-prelim): 224 length of query: 366 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 344 effective length of database: 17,147,199,772 effective search space: 5898636721568 effective search space used: 5898636721568 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
