ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd26c07
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1ref|NM_187463.1| Oryza sativa (japonica cultivar-group), predic... 345 1e-91
2dbj|AK058507.1| Oryza sativa (japonica cultivar-group) cDNA clon... 345 1e-91
3gb|AY103686.1| Zea mays PCO076793 mRNA sequence 287 2e-74
4gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 204 3e-49
5gb|AC135208.3| Oryza sativa (japonica cultivar-group) chromosome... 204 3e-49
6dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic D... 204 3e-49
7emb|Y11002.1|NTLIMDOM N.tabacum mRNA for LIM-domain protein 115 2e-22
8ref|NM_001035793.1| Arabidopsis thaliana zinc ion binding AT3G55... 107 5e-20
9ref|NM_148878.2| Arabidopsis thaliana zinc ion binding AT3G55770... 107 5e-20
10ref|NM_001035791.1| Arabidopsis thaliana zinc ion binding AT3G55... 107 5e-20
11ref|NM_001035792.1| Arabidopsis thaliana zinc ion binding AT3G55... 107 5e-20
12ref|NM_115435.3| Arabidopsis thaliana zinc ion binding AT3G55770... 107 5e-20
13gb|AY091249.1| Arabidopsis thaliana putative transcription facto... 107 5e-20
14gb|AY063924.1| Arabidopsis thaliana putative transcription facto... 107 5e-20
15gb|AF370574.1|AF370574 Arabidopsis thaliana transcription factor... 107 5e-20
16emb|BX822878.1|CNS0A5VL Arabidopsis thaliana Full-length cDNA Co... 107 5e-20
17emb|BX824310.1|CNS0A5HL Arabidopsis thaliana Full-length cDNA Co... 107 5e-20
18gb|AY084361.1| Arabidopsis thaliana clone 105441 mRNA, complete ... 107 5e-20
19emb|AL161667.1|ATF1I16 Arabidopsis thaliana DNA chromosome 3, BA... 101 3e-18
20emb|X91398.1|ATRNAATL2 A.thaliana mRNA for transcription factor L2 92 3e-15
21gb|AF184886.1|AF184886 Nicotiana tabacum LIM domain protein WLIM... 92 3e-15
22gb|AF443117.1|AF443117 Gossypium hirsutum LIM domain protein (LI... 88 4e-14
23gb|AC135205.4| Oryza sativa (japonica cultivar-group) chromosome... 84 7e-13
24emb|BX842219.1|CNS09YBU Arabidopsis thaliana Full-length cDNA Co... 84 7e-13
25ref|XM_466988.1| Oryza sativa (japonica cultivar-group), mRNA 78 4e-11
26dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic D... 78 4e-11
27dbj|AP004768.3| Oryza sativa (japonica cultivar-group) genomic D... 78 4e-11
28dbj|AP004133.3| Oryza sativa (japonica cultivar-group) genomic D... 78 4e-11
29dbj|AP006402.1| Lotus japonicus genomic DNA, chromosome 1, clone... 72 3e-09
30ref|NM_129548.2| Arabidopsis thaliana zinc ion binding AT2G39900... 68 4e-08
31gb|AY122901.1| Arabidopsis thaliana At2g39900/T28M21.6 mRNA, com... 68 4e-08
32gb|AY094448.1| Arabidopsis thaliana At2g39900/T28M21.6 mRNA, com... 68 4e-08
33gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 ma... 68 4e-08
34emb|BX842053.1|CNS09Y9O Arabidopsis thaliana Full-length cDNA Co... 68 4e-08
35emb|BX842049.1|CNS09Y98 Arabidopsis thaliana Full-length cDNA Co... 58 4e-05
36ref|XM_473290.1| Oryza sativa (japonica cultivar-group), predic... 56 2e-04
37emb|AL663006.3|OSJN00204 Oryza sativa genomic DNA, chromosome 4,... 56 2e-04
38emb|AL662984.3|OSJN00183 Oryza sativa genomic DNA, chromosome 4,... 56 2e-04
39dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 56 2e-04
40emb|BX822901.1|CNS0A5ZC Arabidopsis thaliana Full-length cDNA Co... 56 2e-04
41dbj|AK069907.1| Oryza sativa (japonica cultivar-group) cDNA clon... 56 2e-04
42gb|AY117114.1| Gossypioides kirkii putative LIM-domain transcrip... 50 0.009
43gb|AF116851.1|AF116851 Nicotiana tabacum LIM domain protein PLIM... 50 0.009
44gb|AY117110.1| Gossypium herbaceum putative LIM-domain transcrip... 48 0.037
45gb|AY109812.1| Zea mays CL4474_1 mRNA sequence 48 0.037
46ref|XM_422730.1| PREDICTED: Gallus gallus similar to mKIAA0226 p... 44 0.58
47gb|AF055071.1| Anopheles oswaldoi clone PE1 5.8S ribosomal RNA g... 44 0.58
48gb|AF184885.1|AF184885 Nicotiana tabacum LIM domain protein PLIM... 44 0.58
49gb|AF197567.1|AF197567 Nicotiana tabacum pollen specific LIM dom... 44 0.58
50gb|AY684984.1| Anopheles benarrochi B isolate CO315-26 5.8S ribo... 44 0.58
51gb|AY684983.1| Anopheles benarrochi B isolate CO314-1-4 5.8S rib... 44 0.58
52gb|AY684982.1| Anopheles benarrochi B isolate CO314-1 5.8S ribos... 44 0.58
53gb|AY684981.1| Anopheles benarrochi B isolate CO313-20-1 5.8S ri... 44 0.58
54gb|AY684980.1| Anopheles benarrochi B isolate CO172-12-4 5.8S ri... 44 0.58
55gb|AY684979.1| Anopheles benarrochi B isolate CO168-13 5.8S ribo... 44 0.58
56gb|AY684978.1| Anopheles benarrochi B isolate CO235-31 5.8S ribo... 44 0.58
57gb|AY684977.1| Anopheles benarrochi B isolate CO235-18 5.8S ribo... 44 0.58
58gb|AY684976.1| Anopheles benarrochi B isolate CO235-12 5.8S ribo... 44 0.58
59gb|DQ020137.1| Anopheles aquasalis isolate AqITS2AUC9117-53 5.8S... 42 2.3
60gb|DQ020136.1| Anopheles aquasalis isolate AqITS2AUC9117-41 5.8S... 42 2.3
61gb|DQ020135.1| Anopheles aquasalis isolate AqITS2WNZ9116-45 5.8S... 42 2.3
62gb|DQ020134.1| Anopheles aquasalis isolate AqITS2WNZ9115-47 5.8S... 42 2.3
63gb|DQ020133.1| Anopheles aquasalis isolate AqITS2WNZ9115-44 5.8S... 42 2.3
64gb|DQ020132.1| Anopheles aquasalis isolate AqITS2WNZ9115-42 5.8S... 42 2.3
65gb|DQ020131.1| Anopheles aquasalis isolate AqITS2ZVZ7005-48 5.8S... 42 2.3
66gb|DQ020130.1| Anopheles aquasalis isolate AqITS2ZVZ7004-40 5.8S... 42 2.3
67gb|DQ020129.1| Anopheles aquasalis isolate AqITS2ZVZ7003-43 5.8S... 42 2.3
68gb|DQ020128.1| Anopheles aquasalis isolate AqITS2SNF6095-49 5.8S... 42 2.3
69gb|DQ020127.1| Anopheles aquasalis isolate AqITS2SNF6095-51 5.8S... 42 2.3
70gb|DQ020126.1| Anopheles aquasalis isolate AqITS2SNF7007-60 5.8S... 42 2.3
71gb|DQ020125.1| Anopheles aquasalis isolate AqITS2SNF7006-52 5.8S... 42 2.3
72gb|DQ020124.1| Anopheles aquasalis isolate AqITS2SNF7006-50 5.8S... 42 2.3
73gb|DQ020123.1| Anopheles aquasalis isolate AqITS2SNF7006-46 5.8S... 42 2.3
74ref|XM_962778.1| PREDICTED: Tribolium castaneum similar to CG101... 42 2.3
75ref|XM_971072.1| PREDICTED: Tribolium castaneum similar to CG101... 42 2.3
76ref|XM_971066.1| PREDICTED: Tribolium castaneum similar to CG101... 42 2.3
77gb|AC149594.2| Xenopus tropicalis chromosome CH216-62P2, complet... 42 2.3
78gb|AY028128.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
79gb|AY028126.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
80gb|AY028125.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
81gb|AY028124.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
82gb|AY028123.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
83gb|AY028122.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
84gb|AY028121.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
85gb|AY028120.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
86gb|AY028119.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
87gb|AY028118.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
88gb|AY028117.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
89gb|AY028116.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
90gb|AY028115.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
91gb|AY028114.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
92gb|AY028113.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
93gb|AY028112.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
94gb|AY028111.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
95gb|AY028110.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
96gb|AY028109.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
97gb|AY028108.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
98gb|AY028107.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
99gb|AY028106.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
100gb|AY028105.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
101gb|AY028104.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
102gb|AY028103.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
103gb|AY028102.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
104gb|AY028101.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
105gb|AY028100.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
106gb|AY028099.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
107gb|AY028098.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
108gb|AY028097.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
109gb|AY028096.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
110gb|AY028095.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
111gb|AY028094.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
112gb|AY028093.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
113gb|AY028092.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
114gb|AY028091.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
115gb|AY028090.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
116gb|AY028089.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
117gb|AY028087.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
118gb|AY028088.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
119gb|AY028083.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
120gb|AY028086.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
121gb|AY028085.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
122gb|AY028084.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
123gb|AY028082.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
124gb|AY028081.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
125gb|AY117112.1| Gossypium barbadense A-subgenome putative LIM-dom... 42 2.3
126gb|AF461750.1| Anopheles evansae 5.8S ribosomal RNA gene, partia... 42 2.3
127gb|AF461749.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, pa... 42 2.3
128gb|AF462384.1| Anopheles benarrochi 2 5.8S ribosomal RNA gene, p... 42 2.3
129gb|AF462383.1| Anopheles benarrochi 1 5.8S ribosomal RNA gene, p... 42 2.3
130gb|AF462376.1| Anopheles aquasalis 5.8S ribosomal RNA gene, part... 42 2.3
131gb|U92355.1|ATU92355 Anopheles trinkae internal transcribed spac... 42 2.3
132gb|U92351.1|ANU92351 Anopheles nuneztovari internal transcribed ... 42 2.3
133gb|U92350.1|ANU92350 Anopheles nuneztovari internal transcribed ... 42 2.3
134gb|U92346.1|ATU92346 Anopheles trinkae internal transcribed spac... 42 2.3
135gb|U92343.1|ANU92343 Anopheles nuneztovari internal transcribed ... 42 2.3
136gb|U92328.1|AGU92328 Anopheles galvaoi internal transcribed spac... 42 2.3
137gb|U92326.1|ADU92326 Anopheles dunhami internal transcribed spac... 42 2.3
138gb|U92325.1|ABU92325 Anopheles benarrochi internal transcribed s... 42 2.3
139gb|U92324.1|AAU92324 Anopheles aquasalis internal transcribed sp... 42 2.3
140gb|U92323.1|AAU92323 Anopheles albimanus internal transcribed sp... 42 2.3
141gb|L78065.1|MSQINSP Anopheles albimanus ribosomal RNA (rRNA) gene 42 2.3
142emb|Y09075.1|ATITS2DNA A.trinkae internal transcribed spacer 2 DNA 42 2.3
143gb|L22462.1|MSQITS2BN Anopheles nuneztovari 5.8S ribosomal RNA, ... 42 2.3
144gb|AC004226.1| Homo sapiens chromosome 5, BAC clone 313n8 (LBNL ... 40 9.1
145gb|AF051274.1| Anopheles darlingi internal transcribed spacer 2,... 40 9.1
146ref|XM_455236.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F03443g ... 40 9.1
147gb|AC084386.2| Mus musculus BAC clone RP23-61O2 from 17, complet... 40 9.1
148gb|AC006404.25| Mus musculus strain 129/Sv clone ct7-141k23 map ... 40 9.1
149emb|AL023285.1|HS474A14 Human DNA sequence from clone RP3-474A14... 40 9.1
150gb|AC110594.5| Homo sapiens chromosome 17, clone CTD-2193J24, co... 40 9.1
151emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromoso... 40 9.1
152emb|AL663115.11| Mouse DNA sequence from clone RP23-452C23 on ch... 40 9.1
153gb|AC122178.2| Homo sapiens chromosome 3 clone RP11-340I14, comp... 40 9.1
154dbj|AB072914.1| Expression vector pMFXU4 DNA, complete sequence 40 9.1
155ref|NM_176104.1| Drosophila melanogaster CG33087-RC (CG33087), mRNA 40 9.1
156gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome 40 9.1
157gb|AC155636.3| Mus musculus BAC clone RP23-345F5 from chromosome... 40 9.1
158gb|AF462389.1| Anopheles darlingi 5.8S ribosomal RNA gene, parti... 40 9.1
159gb|AF462388.1| Anopheles darlingi 5.8S ribosomal RNA gene, parti... 40 9.1
160gb|AC126327.6| Homo sapiens chromosome 17, clone RP11-428O23, co... 40 9.1
161emb|CT030184.14| Mouse DNA sequence from clone RP23-9C19 on chro... 40 9.1
162gb|AC008370.1|AC008370 Drosophila melanogaster, chromosome 2R, r... 40 9.1
163gb|AE003838.3| Drosophila melanogaster chromosome 2R, section 12... 40 9.1
164gb|AC131029.6| Mus musculus chromosome 14, clone RP23-304N24, co... 40 9.1
165dbj|D85624.1|CNASA Citrullus lanatus serine acetyltransferase (S... 40 9.1
166emb|CT030187.6| Mouse DNA sequence from clone RP23-38L5 on chrom... 40 9.1
167emb|AL929576.7| Zebrafish DNA sequence from clone CH211-188M17, ... 40 9.1
168gb|U92337.1|ADU92337 Anopheles darlingi internal transcribed spa... 40 9.1
169gb|AC083894.21| Mus musculus strain C57BL/6J chromosome 6 clone ... 40 9.1
170gb|U36780.1|ADU36780 Anopheles darlingi rDNA internal transcribe... 40 9.1
171gb|M86236.1|YSAURAIII Candida boidinii orotidine-5'-phosphate de... 40 9.1
172dbj|AB006530.1| Citrullus lanatus Sat gene for serine acetyltran... 40 9.1

>ref|NM_187463.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 591

 Score =  345 bits (174), Expect = 1e-91
 Identities = 328/380 (86%), Gaps = 6/380 (1%)
 Strand = Plus / Minus

                                                                       
Query: 281 gcgcgcttgaccgatgcgcacttgatcagatggttgtagctccccttctccttgaaaagc 340
           ||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||| 
Sbjct: 545 gcgcgcttgactgatgcgcatttgatcagatggttgtagctccctttctccttgaaaagt 486

                                                                       
Query: 341 tgtgagaaatggtgcttgcagtagaggatgccttccaaagccgcgtaattggagggcgag 400
           || |||||||||||||||||||| ||||| ||||||||||| || |||||||| ||||| 
Sbjct: 485 tgggagaaatggtgcttgcagtataggataccttccaaagctgcataattggatggcgaa 426

                                                                       
Query: 401 agggcgcagcctccatgagagcatttgaagcaggacttgtggtaagacttctcttcaact 460
           | ||| ||||| || ||||| ||||||||||||||||||||||| | ||   ||||||||
Sbjct: 425 atggcacagccaccgtgagaacatttgaagcaggacttgtggtaggcctgtccttcaact 366

                                                                       
Query: 461 gtcaccttctcaagagggtatgctgttttaccacaagtggcgcacttgtcctgcgttcca 520
           ||||||||||| ||||| || ||||||||||  |||||||| ||||| ||||| || || 
Sbjct: 365 gtcaccttctctagaggatacgctgttttactgcaagtggcacacttctcctgtgtccct 306

                                                                       
Query: 521 gaaaacatgccagcagctttgcttggcgatctagtcagctcaggagtcaacttgtccgtt 580
           ||||||||||  || |||||||| || ||||| |||||||||||||||||||| |||| |
Sbjct: 305 gaaaacatgcgtgcggctttgctaggtgatcttgtcagctcaggagtcaacttctccgat 246

                                                                       
Query: 581 gcagatttcgcgggggattgtgactggaagctcttattgtagctnccggtctccttgaac 640
           || | ||||||||      |||| ||||||||||| |||||||| |||||||||||||||
Sbjct: 245 gcgggtttcgcgg------gtgattggaagctcttgttgtagctcccggtctccttgaac 192

                               
Query: 641 agctgcgcgaaatggggctt 660
           || ||| |||||||||||||
Sbjct: 191 agttgctcgaaatggggctt 172



to top

>dbj|AK058507.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-G03, full
           insert sequence
          Length = 962

 Score =  345 bits (174), Expect = 1e-91
 Identities = 328/380 (86%), Gaps = 6/380 (1%)
 Strand = Plus / Minus

                                                                       
Query: 281 gcgcgcttgaccgatgcgcacttgatcagatggttgtagctccccttctccttgaaaagc 340
           ||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||| 
Sbjct: 721 gcgcgcttgactgatgcgcatttgatcagatggttgtagctccctttctccttgaaaagt 662

                                                                       
Query: 341 tgtgagaaatggtgcttgcagtagaggatgccttccaaagccgcgtaattggagggcgag 400
           || |||||||||||||||||||| ||||| ||||||||||| || |||||||| ||||| 
Sbjct: 661 tgggagaaatggtgcttgcagtataggataccttccaaagctgcataattggatggcgaa 602

                                                                       
Query: 401 agggcgcagcctccatgagagcatttgaagcaggacttgtggtaagacttctcttcaact 460
           | ||| ||||| || ||||| ||||||||||||||||||||||| | ||   ||||||||
Sbjct: 601 atggcacagccaccgtgagaacatttgaagcaggacttgtggtaggcctgtccttcaact 542

                                                                       
Query: 461 gtcaccttctcaagagggtatgctgttttaccacaagtggcgcacttgtcctgcgttcca 520
           ||||||||||| ||||| || ||||||||||  |||||||| ||||| ||||| || || 
Sbjct: 541 gtcaccttctctagaggatacgctgttttactgcaagtggcacacttctcctgtgtccct 482

                                                                       
Query: 521 gaaaacatgccagcagctttgcttggcgatctagtcagctcaggagtcaacttgtccgtt 580
           ||||||||||  || |||||||| || ||||| |||||||||||||||||||| |||| |
Sbjct: 481 gaaaacatgcgtgcggctttgctaggtgatcttgtcagctcaggagtcaacttctccgat 422

                                                                       
Query: 581 gcagatttcgcgggggattgtgactggaagctcttattgtagctnccggtctccttgaac 640
           || | ||||||||      |||| ||||||||||| |||||||| |||||||||||||||
Sbjct: 421 gcgggtttcgcgg------gtgattggaagctcttgttgtagctcccggtctccttgaac 368

                               
Query: 641 agctgcgcgaaatggggctt 660
           || ||| |||||||||||||
Sbjct: 367 agttgctcgaaatggggctt 348



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 56/66 (84%), Gaps = 1/66 (1%)
 Strand = Plus / Minus

                                                                       
Query: 52  catggttcaacaacgtgatccag-ctagcacacaaggagatacgaaattgataggtcctg 110
           ||||||||| ||| |||||| || ||||||||  ||  || ||||||||||||||||| |
Sbjct: 921 catggttcaccaatgtgatcgagtctagcacagcagaggacacgaaattgataggtcccg 862

                 
Query: 111 gtatcc 116
           ||||||
Sbjct: 861 gtatcc 856



to top

>gb|AY103686.1| Zea mays PCO076793 mRNA sequence
          Length = 1188

 Score =  287 bits (145), Expect = 2e-74
 Identities = 318/376 (84%)
 Strand = Plus / Minus

                                                                       
Query: 281 gcgcgcttgaccgatgcgcacttgatcagatggttgtagctccccttctccttgaaaagc 340
           ||||||||||| || |||||||||||||  ||||||||||| ||||||||||||||||| 
Sbjct: 814 gcgcgcttgacggacgcgcacttgatcaagtggttgtagcttcccttctccttgaaaagt 755

                                                                       
Query: 341 tgtgagaaatggtgcttgcagtagaggatgccttccaaagccgcgtaattggagggcgag 400
           || ||||||||||| ||||||||||||||||| ||||| || || || ||||| || |  
Sbjct: 754 tgggagaaatggtgtttgcagtagaggatgccctccaaggctgcatagttggaaggtgta 695

                                                                       
Query: 401 agggcgcagcctccatgagagcatttgaagcaggacttgtggtaagacttctcttcaact 460
           |  |||||||| || || |||||||||||||| ||||| ||||| ||||||||||| |||
Sbjct: 694 atcgcgcagcccccgtgggagcatttgaagcatgacttatggtaggacttctcttcgact 635

                                                                       
Query: 461 gtcaccttctcaagagggtatgctgttttaccacaagtggcgcacttgtcctgcgttcca 520
           || |||||||||||||| || || |||||||||||||| || |||||||| || ||||| 
Sbjct: 634 gttaccttctcaagaggatacgcagttttaccacaagtcgcacacttgtcttgtgttcct 575

                                                                       
Query: 521 gaaaacatgccagcagctttgcttggcgatctagtcagctcaggagtcaacttgtccgtt 580
           |||||||| |  |||||||||||||| ||||| ||||||||||| | |||||| ||||  
Sbjct: 574 gaaaacatccttgcagctttgcttggtgatctggtcagctcaggggccaacttttccgga 515

                                                                       
Query: 581 gcagatttcgcgggggattgtgactggaagctcttattgtagctnccggtctccttgaac 640
           | |   || || || || ||||| ||||||||||| ||||| || |||||||||||||||
Sbjct: 514 gtaatctttgcaggtgactgtgattggaagctcttgttgtaactcccggtctccttgaac 455

                           
Query: 641 agctgcgcgaaatggg 656
           |||||| |||||||||
Sbjct: 454 agctgctcgaaatggg 439



to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score =  204 bits (103), Expect = 3e-49
 Identities = 166/187 (88%)
 Strand = Plus / Minus

                                                                           
Query: 281     gcgcgcttgaccgatgcgcacttgatcagatggttgtagctccccttctccttgaaaagc 340
               ||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||| 
Sbjct: 8771814 gcgcgcttgactgatgcgcatttgatcagatggttgtagctccctttctccttgaaaagt 8771755

                                                                           
Query: 341     tgtgagaaatggtgcttgcagtagaggatgccttccaaagccgcgtaattggagggcgag 400
               || |||||||||||||||||||| ||||| ||||||||||| || |||||||| ||||| 
Sbjct: 8771754 tgggagaaatggtgcttgcagtataggataccttccaaagctgcataattggatggcgaa 8771695

                                                                           
Query: 401     agggcgcagcctccatgagagcatttgaagcaggacttgtggtaagacttctcttcaact 460
               | ||| ||||| || ||||| ||||||||||||||||||||||| | ||   ||||||||
Sbjct: 8771694 atggcacagccaccgtgagaacatttgaagcaggacttgtggtaggcctgtccttcaact 8771635

                      
Query: 461     gtcacct 467
               |||||||
Sbjct: 8771634 gtcacct 8771628



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 56/61 (91%)
 Strand = Plus / Minus

                                                                           
Query: 600     gtgactggaagctcttattgtagctnccggtctccttgaacagctgcgcgaaatggggct 659
               |||| ||||||||||| |||||||| ||||||||||||||||| ||| ||||||||||||
Sbjct: 8770998 gtgattggaagctcttgttgtagctcccggtctccttgaacagttgctcgaaatggggct 8770939

                
Query: 660     t 660
               |
Sbjct: 8770938 t 8770938



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 56/66 (84%), Gaps = 1/66 (1%)
 Strand = Plus / Minus

                                                                           
Query: 52      catggttcaacaacgtgatccag-ctagcacacaaggagatacgaaattgataggtcctg 110
               ||||||||| ||| |||||| || ||||||||  ||  || ||||||||||||||||| |
Sbjct: 8772014 catggttcaccaatgtgatcgagtctagcacagcagaggacacgaaattgataggtcccg 8771955

                     
Query: 111     gtatcc 116
               ||||||
Sbjct: 8771954 gtatcc 8771949



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                     
Query: 556     cagctcaggagtcaacttgtccgttgcagatttcgcgg 593
               |||||||||||||||||| |||| ||| | ||||||||
Sbjct: 8771151 cagctcaggagtcaacttctccgatgcgggtttcgcgg 8771114



to top

>gb|AC135208.3| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1364E02,
             complete sequence
          Length = 112265

 Score =  204 bits (103), Expect = 3e-49
 Identities = 166/187 (88%)
 Strand = Plus / Minus

                                                                         
Query: 281   gcgcgcttgaccgatgcgcacttgatcagatggttgtagctccccttctccttgaaaagc 340
             ||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||| 
Sbjct: 14967 gcgcgcttgactgatgcgcatttgatcagatggttgtagctccctttctccttgaaaagt 14908

                                                                         
Query: 341   tgtgagaaatggtgcttgcagtagaggatgccttccaaagccgcgtaattggagggcgag 400
             || |||||||||||||||||||| ||||| ||||||||||| || |||||||| ||||| 
Sbjct: 14907 tgggagaaatggtgcttgcagtataggataccttccaaagctgcataattggatggcgaa 14848

                                                                         
Query: 401   agggcgcagcctccatgagagcatttgaagcaggacttgtggtaagacttctcttcaact 460
             | ||| ||||| || ||||| ||||||||||||||||||||||| | ||   ||||||||
Sbjct: 14847 atggcacagccaccgtgagaacatttgaagcaggacttgtggtaggcctgtccttcaact 14788

                    
Query: 461   gtcacct 467
             |||||||
Sbjct: 14787 gtcacct 14781



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 56/61 (91%)
 Strand = Plus / Minus

                                                                         
Query: 600   gtgactggaagctcttattgtagctnccggtctccttgaacagctgcgcgaaatggggct 659
             |||| ||||||||||| |||||||| ||||||||||||||||| ||| ||||||||||||
Sbjct: 14151 gtgattggaagctcttgttgtagctcccggtctccttgaacagttgctcgaaatggggct 14092

              
Query: 660   t 660
             |
Sbjct: 14091 t 14091



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 56/66 (84%), Gaps = 1/66 (1%)
 Strand = Plus / Minus

                                                                         
Query: 52    catggttcaacaacgtgatccag-ctagcacacaaggagatacgaaattgataggtcctg 110
             ||||||||| ||| |||||| || ||||||||  ||  || ||||||||||||||||| |
Sbjct: 15167 catggttcaccaatgtgatcgagtctagcacagcagaggacacgaaattgataggtcccg 15108

                   
Query: 111   gtatcc 116
             ||||||
Sbjct: 15107 gtatcc 15102



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                   
Query: 556   cagctcaggagtcaacttgtccgttgcagatttcgcgg 593
             |||||||||||||||||| |||| ||| | ||||||||
Sbjct: 14304 cagctcaggagtcaacttctccgatgcgggtttcgcgg 14267



to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
               sequence
          Length = 36192742

 Score =  204 bits (103), Expect = 3e-49
 Identities = 166/187 (88%)
 Strand = Plus / Minus

                                                                           
Query: 281     gcgcgcttgaccgatgcgcacttgatcagatggttgtagctccccttctccttgaaaagc 340
               ||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||| 
Sbjct: 8769649 gcgcgcttgactgatgcgcatttgatcagatggttgtagctccctttctccttgaaaagt 8769590

                                                                           
Query: 341     tgtgagaaatggtgcttgcagtagaggatgccttccaaagccgcgtaattggagggcgag 400
               || |||||||||||||||||||| ||||| ||||||||||| || |||||||| ||||| 
Sbjct: 8769589 tgggagaaatggtgcttgcagtataggataccttccaaagctgcataattggatggcgaa 8769530

                                                                           
Query: 401     agggcgcagcctccatgagagcatttgaagcaggacttgtggtaagacttctcttcaact 460
               | ||| ||||| || ||||| ||||||||||||||||||||||| | ||   ||||||||
Sbjct: 8769529 atggcacagccaccgtgagaacatttgaagcaggacttgtggtaggcctgtccttcaact 8769470

                      
Query: 461     gtcacct 467
               |||||||
Sbjct: 8769469 gtcacct 8769463



 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 56/61 (91%)
 Strand = Plus / Minus

                                                                           
Query: 600     gtgactggaagctcttattgtagctnccggtctccttgaacagctgcgcgaaatggggct 659
               |||| ||||||||||| |||||||| ||||||||||||||||| ||| ||||||||||||
Sbjct: 8768833 gtgattggaagctcttgttgtagctcccggtctccttgaacagttgctcgaaatggggct 8768774

                
Query: 660     t 660
               |
Sbjct: 8768773 t 8768773



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 56/66 (84%), Gaps = 1/66 (1%)
 Strand = Plus / Minus

                                                                           
Query: 52      catggttcaacaacgtgatccag-ctagcacacaaggagatacgaaattgataggtcctg 110
               ||||||||| ||| |||||| || ||||||||  ||  || ||||||||||||||||| |
Sbjct: 8769849 catggttcaccaatgtgatcgagtctagcacagcagaggacacgaaattgataggtcccg 8769790

                     
Query: 111     gtatcc 116
               ||||||
Sbjct: 8769789 gtatcc 8769784



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                     
Query: 556     cagctcaggagtcaacttgtccgttgcagatttcgcgg 593
               |||||||||||||||||| |||| ||| | ||||||||
Sbjct: 8768986 cagctcaggagtcaacttctccgatgcgggtttcgcgg 8768949



to top

>emb|Y11002.1|NTLIMDOM N.tabacum mRNA for LIM-domain protein
          Length = 966

 Score =  115 bits (58), Expect = 2e-22
 Identities = 97/110 (88%)
 Strand = Plus / Minus

                                                                       
Query: 458 actgtcaccttctcaagagggtatgctgttttaccacaagtggcgcacttgtcctgcgtt 517
           ||||||||||||||||| ||||| ||||||||||||||||| || || || ||||| || 
Sbjct: 491 actgtcaccttctcaagtgggtaagctgttttaccacaagtcgcacatttttcctgtgtg 432

                                                             
Query: 518 ccagaaaacatgccagcagctttgcttggcgatctagtcagctcaggagt 567
           |||||||||||||| |||||||| || |||||||| |||||||| |||||
Sbjct: 431 ccagaaaacatgccggcagctttactaggcgatcttgtcagctccggagt 382



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                               
Query: 300 acttgatcagatggttgtagctccccttctccttgaaaagctgtgagaaatg 351
           ||||||||| ||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 649 acttgatcaaatgattgtagctgcctttctccttgaaaagctgtgaaaaatg 598



to top

>ref|NM_001035793.1| Arabidopsis thaliana zinc ion binding AT3G55770 transcript variant
           AT3G55770.5 mRNA, complete cds
          Length = 1046

 Score =  107 bits (54), Expect = 5e-20
 Identities = 209/258 (81%), Gaps = 2/258 (0%)
 Strand = Plus / Minus

                                                                       
Query: 311 tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggatg 370
           |||||||| || |||||||||||||| ||||| | |||||||||||||||||| ||||| 
Sbjct: 756 tggttgtaacttcccttctccttgaagagctgagcgaaatggtgcttgcagtacaggatt 697

                                                                       
Query: 371 ccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcatttgaag 430
           ||||| | ||| ||||| ||||| || || |  | ||| |||||||| ||||| ||||||
Sbjct: 696 ccttcaagagctgcgtagttggaaggtgaaattgggcaacctccatgtgagcacttgaag 637

                                                                       
Query: 431 caggacttgtggtaagact-tctcttcaactgtcaccttctcaagagggtatgctgtttt 489
           ||||||||||| || | ||  ||| || ||||| ||||| |||| ||| ||  | |||||
Sbjct: 636 caggacttgtgatatgtctggctc-tcgactgttaccttttcaataggatacacagtttt 578

                                                                       
Query: 490 accacaagtggcgcacttgtcctgcgttccagaaaacatgccagcagctttgcttggcga 549
           || |||||||||||| || || || || ||||| ||| |||||||| ||  ||| |||| 
Sbjct: 577 actacaagtggcgcatttctcttgtgtaccagagaacctgccagcaactcggctaggcgt 518

                             
Query: 550 tctagtcagctcaggagt 567
            || ||||||||||||||
Sbjct: 517 ccttgtcagctcaggagt 500



to top

>ref|NM_148878.2| Arabidopsis thaliana zinc ion binding AT3G55770 transcript variant
           AT3G55770.2 mRNA, complete cds
          Length = 943

 Score =  107 bits (54), Expect = 5e-20
 Identities = 209/258 (81%), Gaps = 2/258 (0%)
 Strand = Plus / Minus

                                                                       
Query: 311 tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggatg 370
           |||||||| || |||||||||||||| ||||| | |||||||||||||||||| ||||| 
Sbjct: 653 tggttgtaacttcccttctccttgaagagctgagcgaaatggtgcttgcagtacaggatt 594

                                                                       
Query: 371 ccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcatttgaag 430
           ||||| | ||| ||||| ||||| || || |  | ||| |||||||| ||||| ||||||
Sbjct: 593 ccttcaagagctgcgtagttggaaggtgaaattgggcaacctccatgtgagcacttgaag 534

                                                                       
Query: 431 caggacttgtggtaagact-tctcttcaactgtcaccttctcaagagggtatgctgtttt 489
           ||||||||||| || | ||  ||| || ||||| ||||| |||| ||| ||  | |||||
Sbjct: 533 caggacttgtgatatgtctggctc-tcgactgttaccttttcaataggatacacagtttt 475

                                                                       
Query: 490 accacaagtggcgcacttgtcctgcgttccagaaaacatgccagcagctttgcttggcga 549
           || |||||||||||| || || || || ||||| ||| |||||||| ||  ||| |||| 
Sbjct: 474 actacaagtggcgcatttctcttgtgtaccagagaacctgccagcaactcggctaggcgt 415

                             
Query: 550 tctagtcagctcaggagt 567
            || ||||||||||||||
Sbjct: 414 ccttgtcagctcaggagt 397



to top

>ref|NM_001035791.1| Arabidopsis thaliana zinc ion binding AT3G55770 transcript variant
           AT3G55770.3 mRNA, complete cds
          Length = 1042

 Score =  107 bits (54), Expect = 5e-20
 Identities = 209/258 (81%), Gaps = 2/258 (0%)
 Strand = Plus / Minus

                                                                       
Query: 311 tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggatg 370
           |||||||| || |||||||||||||| ||||| | |||||||||||||||||| ||||| 
Sbjct: 752 tggttgtaacttcccttctccttgaagagctgagcgaaatggtgcttgcagtacaggatt 693

                                                                       
Query: 371 ccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcatttgaag 430
           ||||| | ||| ||||| ||||| || || |  | ||| |||||||| ||||| ||||||
Sbjct: 692 ccttcaagagctgcgtagttggaaggtgaaattgggcaacctccatgtgagcacttgaag 633

                                                                       
Query: 431 caggacttgtggtaagact-tctcttcaactgtcaccttctcaagagggtatgctgtttt 489
           ||||||||||| || | ||  ||| || ||||| ||||| |||| ||| ||  | |||||
Sbjct: 632 caggacttgtgatatgtctggctc-tcgactgttaccttttcaataggatacacagtttt 574

                                                                       
Query: 490 accacaagtggcgcacttgtcctgcgttccagaaaacatgccagcagctttgcttggcga 549
           || |||||||||||| || || || || ||||| ||| |||||||| ||  ||| |||| 
Sbjct: 573 actacaagtggcgcatttctcttgtgtaccagagaacctgccagcaactcggctaggcgt 514

                             
Query: 550 tctagtcagctcaggagt 567
            || ||||||||||||||
Sbjct: 513 ccttgtcagctcaggagt 496



to top

>ref|NM_001035792.1| Arabidopsis thaliana zinc ion binding AT3G55770 transcript variant
           AT3G55770.4 mRNA, complete cds
          Length = 1030

 Score =  107 bits (54), Expect = 5e-20
 Identities = 209/258 (81%), Gaps = 2/258 (0%)
 Strand = Plus / Minus

                                                                       
Query: 311 tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggatg 370
           |||||||| || |||||||||||||| ||||| | |||||||||||||||||| ||||| 
Sbjct: 740 tggttgtaacttcccttctccttgaagagctgagcgaaatggtgcttgcagtacaggatt 681

                                                                       
Query: 371 ccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcatttgaag 430
           ||||| | ||| ||||| ||||| || || |  | ||| |||||||| ||||| ||||||
Sbjct: 680 ccttcaagagctgcgtagttggaaggtgaaattgggcaacctccatgtgagcacttgaag 621

                                                                       
Query: 431 caggacttgtggtaagact-tctcttcaactgtcaccttctcaagagggtatgctgtttt 489
           ||||||||||| || | ||  ||| || ||||| ||||| |||| ||| ||  | |||||
Sbjct: 620 caggacttgtgatatgtctggctc-tcgactgttaccttttcaataggatacacagtttt 562

                                                                       
Query: 490 accacaagtggcgcacttgtcctgcgttccagaaaacatgccagcagctttgcttggcga 549
           || |||||||||||| || || || || ||||| ||| |||||||| ||  ||| |||| 
Sbjct: 561 actacaagtggcgcatttctcttgtgtaccagagaacctgccagcaactcggctaggcgt 502

                             
Query: 550 tctagtcagctcaggagt 567
            || ||||||||||||||
Sbjct: 501 ccttgtcagctcaggagt 484



to top

>ref|NM_115435.3| Arabidopsis thaliana zinc ion binding AT3G55770 transcript variant
           AT3G55770.1 mRNA, complete cds
          Length = 1010

 Score =  107 bits (54), Expect = 5e-20
 Identities = 209/258 (81%), Gaps = 2/258 (0%)
 Strand = Plus / Minus

                                                                       
Query: 311 tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggatg 370
           |||||||| || |||||||||||||| ||||| | |||||||||||||||||| ||||| 
Sbjct: 721 tggttgtaacttcccttctccttgaagagctgagcgaaatggtgcttgcagtacaggatt 662

                                                                       
Query: 371 ccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcatttgaag 430
           ||||| | ||| ||||| ||||| || || |  | ||| |||||||| ||||| ||||||
Sbjct: 661 ccttcaagagctgcgtagttggaaggtgaaattgggcaacctccatgtgagcacttgaag 602

                                                                       
Query: 431 caggacttgtggtaagact-tctcttcaactgtcaccttctcaagagggtatgctgtttt 489
           ||||||||||| || | ||  ||| || ||||| ||||| |||| ||| ||  | |||||
Sbjct: 601 caggacttgtgatatgtctggctc-tcgactgttaccttttcaataggatacacagtttt 543

                                                                       
Query: 490 accacaagtggcgcacttgtcctgcgttccagaaaacatgccagcagctttgcttggcga 549
           || |||||||||||| || || || || ||||| ||| |||||||| ||  ||| |||| 
Sbjct: 542 actacaagtggcgcatttctcttgtgtaccagagaacctgccagcaactcggctaggcgt 483

                             
Query: 550 tctagtcagctcaggagt 567
            || ||||||||||||||
Sbjct: 482 ccttgtcagctcaggagt 465



to top

>gb|AY091249.1| Arabidopsis thaliana putative transcription factor L2 (At3g55770)
           mRNA, complete cds
          Length = 631

 Score =  107 bits (54), Expect = 5e-20
 Identities = 209/258 (81%), Gaps = 2/258 (0%)
 Strand = Plus / Minus

                                                                       
Query: 311 tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggatg 370
           |||||||| || |||||||||||||| ||||| | |||||||||||||||||| ||||| 
Sbjct: 515 tggttgtaacttcccttctccttgaagagctgagcgaaatggtgcttgcagtacaggatt 456

                                                                       
Query: 371 ccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcatttgaag 430
           ||||| | ||| ||||| ||||| || || |  | ||| |||||||| ||||| ||||||
Sbjct: 455 ccttcaagagctgcgtagttggaaggtgaaattgggcaacctccatgtgagcacttgaag 396

                                                                       
Query: 431 caggacttgtggtaagact-tctcttcaactgtcaccttctcaagagggtatgctgtttt 489
           ||||||||||| || | ||  ||| || ||||| ||||| |||| ||| ||  | |||||
Sbjct: 395 caggacttgtgatatgtctggctc-tcgactgttaccttttcaataggatacacagtttt 337

                                                                       
Query: 490 accacaagtggcgcacttgtcctgcgttccagaaaacatgccagcagctttgcttggcga 549
           || |||||||||||| || || || || ||||| ||| |||||||| ||  ||| |||| 
Sbjct: 336 actacaagtggcgcatttctcttgtgtaccagagaacctgccagcaactcggctaggcgt 277

                             
Query: 550 tctagtcagctcaggagt 567
            || ||||||||||||||
Sbjct: 276 ccttgtcagctcaggagt 259



to top

>gb|AY063924.1| Arabidopsis thaliana putative transcription factor L2 (At3g55770)
           mRNA, complete cds
          Length = 977

 Score =  107 bits (54), Expect = 5e-20
 Identities = 209/258 (81%), Gaps = 2/258 (0%)
 Strand = Plus / Minus

                                                                       
Query: 311 tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggatg 370
           |||||||| || |||||||||||||| ||||| | |||||||||||||||||| ||||| 
Sbjct: 691 tggttgtaacttcccttctccttgaagagctgagcgaaatggtgcttgcagtacaggatt 632

                                                                       
Query: 371 ccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcatttgaag 430
           ||||| | ||| ||||| ||||| || || |  | ||| |||||||| ||||| ||||||
Sbjct: 631 ccttcaagagctgcgtagttggaaggtgaaattgggcaacctccatgtgagcacttgaag 572

                                                                       
Query: 431 caggacttgtggtaagact-tctcttcaactgtcaccttctcaagagggtatgctgtttt 489
           ||||||||||| || | ||  ||| || ||||| ||||| |||| ||| ||  | |||||
Sbjct: 571 caggacttgtgatatgtctggctc-tcgactgttaccttttcaataggatacacagtttt 513

                                                                       
Query: 490 accacaagtggcgcacttgtcctgcgttccagaaaacatgccagcagctttgcttggcga 549
           || |||||||||||| || || || || ||||| ||| |||||||| ||  ||| |||| 
Sbjct: 512 actacaagtggcgcatttctcttgtgtaccagagaacctgccagcaactcggctaggcgt 453

                             
Query: 550 tctagtcagctcaggagt 567
            || ||||||||||||||
Sbjct: 452 ccttgtcagctcaggagt 435



to top

>gb|AF370574.1|AF370574 Arabidopsis thaliana transcription factor L2 (F1I16_180) mRNA,
           complete cds
          Length = 694

 Score =  107 bits (54), Expect = 5e-20
 Identities = 209/258 (81%), Gaps = 2/258 (0%)
 Strand = Plus / Minus

                                                                       
Query: 311 tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggatg 370
           |||||||| || |||||||||||||| ||||| | |||||||||||||||||| ||||| 
Sbjct: 514 tggttgtaacttcccttctccttgaagagctgagcgaaatggtgcttgcagtacaggatt 455

                                                                       
Query: 371 ccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcatttgaag 430
           ||||| | ||| ||||| ||||| || || |  | ||| |||||||| ||||| ||||||
Sbjct: 454 ccttcaagagctgcgtagttggaaggtgaaattgggcaacctccatgtgagcacttgaag 395

                                                                       
Query: 431 caggacttgtggtaagact-tctcttcaactgtcaccttctcaagagggtatgctgtttt 489
           ||||||||||| || | ||  ||| || ||||| ||||| |||| ||| ||  | |||||
Sbjct: 394 caggacttgtgatatgtctggctc-tcgactgttaccttttcaataggatacacagtttt 336

                                                                       
Query: 490 accacaagtggcgcacttgtcctgcgttccagaaaacatgccagcagctttgcttggcga 549
           || |||||||||||| || || || || ||||| ||| |||||||| ||  ||| |||| 
Sbjct: 335 actacaagtggcgcatttctcttgtgtaccagagaacctgccagcaactcggctaggcgt 276

                             
Query: 550 tctagtcagctcaggagt 567
            || ||||||||||||||
Sbjct: 275 ccttgtcagctcaggagt 258



to top

>emb|BX822878.1|CNS0A5VL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTFB6ZE02 of Flowers and buds of strain col-0 of
           Arabidopsis thaliana (thale cress)
          Length = 935

 Score =  107 bits (54), Expect = 5e-20
 Identities = 209/258 (81%), Gaps = 2/258 (0%)
 Strand = Plus / Minus

                                                                       
Query: 311 tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggatg 370
           |||||||| || |||||||||||||| ||||| | |||||||||||||||||| ||||| 
Sbjct: 680 tggttgtaacttcccttctccttgaagagctgagcgaaatggtgcttgcagtacaggatt 621

                                                                       
Query: 371 ccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcatttgaag 430
           ||||| | ||| ||||| ||||| || || |  | ||| |||||||| ||||| ||||||
Sbjct: 620 ccttcaagagctgcgtagttggaaggtgaaattgggcaacctccatgtgagcacttgaag 561

                                                                       
Query: 431 caggacttgtggtaagact-tctcttcaactgtcaccttctcaagagggtatgctgtttt 489
           ||||||||||| || | ||  ||| || ||||| ||||| |||| ||| ||  | |||||
Sbjct: 560 caggacttgtgatatgtctggctc-tcgactgttaccttttcaataggatacacagtttt 502

                                                                       
Query: 490 accacaagtggcgcacttgtcctgcgttccagaaaacatgccagcagctttgcttggcga 549
           || |||||||||||| || || || || ||||| ||| |||||||| ||  ||| |||| 
Sbjct: 501 actacaagtggcgcatttctcttgtgtaccagagaacctgccagcaactcggctaggcgt 442

                             
Query: 550 tctagtcagctcaggagt 567
            || ||||||||||||||
Sbjct: 441 ccttgtcagctcaggagt 424



to top

>emb|BX824310.1|CNS0A5HL Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTPGH38ZH03 of Hormone Treated Callus of strain col-0
           of Arabidopsis thaliana (thale cress)
          Length = 883

 Score =  107 bits (54), Expect = 5e-20
 Identities = 209/258 (81%), Gaps = 2/258 (0%)
 Strand = Plus / Minus

                                                                       
Query: 311 tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggatg 370
           |||||||| || |||||||||||||| ||||| | |||||||||||||||||| ||||| 
Sbjct: 683 tggttgtaacttcccttctccttgaagagctgagcgaaatggtgcttgcagtacaggatt 624

                                                                       
Query: 371 ccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcatttgaag 430
           ||||| | ||| ||||| ||||| || || |  | ||| |||||||| ||||| ||||||
Sbjct: 623 ccttcaagagctgcgtagttggaaggtgaaattgggcaacctccatgtgagcacttgaag 564

                                                                       
Query: 431 caggacttgtggtaagact-tctcttcaactgtcaccttctcaagagggtatgctgtttt 489
           ||||||||||| || | ||  ||| || ||||| ||||| |||| ||| ||  | |||||
Sbjct: 563 caggacttgtgatatgtctggctc-tcgactgttaccttttcaataggatacacagtttt 505

                                                                       
Query: 490 accacaagtggcgcacttgtcctgcgttccagaaaacatgccagcagctttgcttggcga 549
           || |||||||||||| || || || || ||||| ||| |||||||| ||  ||| |||| 
Sbjct: 504 actacaagtggcgcatttctcttgtgtaccagagaacctgccagcaactcggctaggcgt 445

                             
Query: 550 tctagtcagctcaggagt 567
            || ||||||||||||||
Sbjct: 444 ccttgtcagctcaggagt 427



to top

>gb|AY084361.1| Arabidopsis thaliana clone 105441 mRNA, complete sequence
          Length = 991

 Score =  107 bits (54), Expect = 5e-20
 Identities = 209/258 (81%), Gaps = 2/258 (0%)
 Strand = Plus / Minus

                                                                       
Query: 311 tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggatg 370
           |||||||| || |||||||||||||| ||||| | |||||||||||||||||| ||||| 
Sbjct: 721 tggttgtaacttcccttctccttgaagagctgagcgaaatggtgcttgcagtacaggatt 662

                                                                       
Query: 371 ccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcatttgaag 430
           ||||| | ||| ||||| ||||| || || |  | ||| |||||||| ||||| ||||||
Sbjct: 661 ccttcaagagctgcgtagttggaaggtgaaattgggcaacctccatgtgagcacttgaag 602

                                                                       
Query: 431 caggacttgtggtaagact-tctcttcaactgtcaccttctcaagagggtatgctgtttt 489
           ||||||||||| || | ||  ||| || ||||| ||||| |||| ||| ||  | |||||
Sbjct: 601 caggacttgtgatatgtctggctc-tcgactgttaccttttcaataggatacacagtttt 543

                                                                       
Query: 490 accacaagtggcgcacttgtcctgcgttccagaaaacatgccagcagctttgcttggcga 549
           || |||||||||||| || || || || ||||| ||| |||||||| ||  ||| |||| 
Sbjct: 542 actacaagtggcgcatttctcttgtgtaccagagaacctgccagcaactcggctaggcgt 483

                             
Query: 550 tctagtcagctcaggagt 567
            || ||||||||||||||
Sbjct: 482 ccttgtcagctcaggagt 465



to top

>emb|AL161667.1|ATF1I16 Arabidopsis thaliana DNA chromosome 3, BAC clone F1I16
          Length = 103785

 Score =  101 bits (51), Expect = 3e-18
 Identities = 111/131 (84%)
 Strand = Plus / Minus

                                                                         
Query: 311   tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggatg 370
             |||||||| || |||||||||||||| ||||| | |||||||||||||||||| ||||| 
Sbjct: 93118 tggttgtaacttcccttctccttgaagagctgagcgaaatggtgcttgcagtacaggatt 93059

                                                                         
Query: 371   ccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcatttgaag 430
             ||||| | ||| ||||| ||||| || || |  | ||| |||||||| ||||| ||||||
Sbjct: 93058 ccttcaagagctgcgtagttggaaggtgaaattgggcaacctccatgtgagcacttgaag 92999

                        
Query: 431   caggacttgtg 441
             |||||||||||
Sbjct: 92998 caggacttgtg 92988



to top

>emb|X91398.1|ATRNAATL2 A.thaliana mRNA for transcription factor L2
          Length = 882

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 208/258 (80%), Gaps = 3/258 (1%)
 Strand = Plus / Minus

                                                                       
Query: 311 tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggatg 370
           |||||||| || ||||||||||| || ||||| | |||||||||||||||||| ||||| 
Sbjct: 589 tggttgtaacttcccttctcctt-aagagctgagcgaaatggtgcttgcagtacaggatt 531

                                                                       
Query: 371 ccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcatttgaag 430
           ||||| | ||| ||||| ||||| || || |  | ||| |||||||| ||||| ||||||
Sbjct: 530 ccttcaagagctgcgtagttggaaggtgaaattgggcaacctccatgtgagcacttgaag 471

                                                                       
Query: 431 caggacttgtggtaagact-tctcttcaactgtcaccttctcaagagggtatgctgtttt 489
           ||||||||||| || | ||  ||| || ||||| ||||| |||| ||| ||  | |||||
Sbjct: 470 caggacttgtgatatgtctggctc-tcgactgttaccttttcaataggatacacagtttt 412

                                                                       
Query: 490 accacaagtggcgcacttgtcctgcgttccagaaaacatgccagcagctttgcttggcga 549
           || |||||||||||| || || || || ||||| ||| |||||||| ||  ||| |||| 
Sbjct: 411 actacaagtggcgcatttctcttgtgtaccagagaacctgccagcaactcggctaggcgt 352

                             
Query: 550 tctagtcagctcaggagt 567
            || ||||||||||||||
Sbjct: 351 ccttgtcagctcaggagt 334



to top

>gb|AF184886.1|AF184886 Nicotiana tabacum LIM domain protein WLIM2 (WLIM2) gene, complete
           cds
          Length = 2821

 Score = 91.7 bits (46), Expect = 3e-15
 Identities = 76/86 (88%)
 Strand = Plus / Minus

                                                                       
Query: 464 accttctcaagagggtatgctgttttaccacaagtggcgcacttgtcctgcgttccagaa 523
           |||||||| || ||||| ||||||||||||||||| || || || |||||||| ||||||
Sbjct: 911 accttctcgagtgggtaagctgttttaccacaagttgcacatttttcctgcgtgccagaa 852

                                     
Query: 524 aacatgccagcagctttgcttggcga 549
           ||||||||||||||||| || |||||
Sbjct: 851 aacatgccagcagctttactaggcga 826



 Score = 63.9 bits (32), Expect = 6e-07
 Identities = 47/52 (90%)
 Strand = Plus / Minus

                                                                
Query: 300  acttgatcagatggttgtagctccccttctccttgaaaagctgtgagaaatg 351
            ||||||||| ||| |||||||| || |||||||||||||||||||| |||||
Sbjct: 2777 acttgatcaaatgattgtagctgcctttctccttgaaaagctgtgaaaaatg 2726



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 51/61 (83%)
 Strand = Plus / Minus

                                                                       
Query: 600 gtgactggaagctcttattgtagctnccggtctccttgaacagctgcgcgaaatggggct 659
           ||||||| ||| |||||||| || | || | ||||||||| |||||| | ||||||||||
Sbjct: 594 gtgactgaaagttcttattgaagttgccagactccttgaaaagctgctcaaaatggggct 535

            
Query: 660 t 660
           |
Sbjct: 534 t 534



to top

>gb|AF443117.1|AF443117 Gossypium hirsutum LIM domain protein (LIM-1) mRNA, complete cds
          Length = 848

 Score = 87.7 bits (44), Expect = 4e-14
 Identities = 137/168 (81%)
 Strand = Plus / Minus

                                                                       
Query: 406 gcagcctccatgagagcatttgaagcaggacttgtggtaagacttctcttcaactgtcac 465
           |||||| ||||||||||| ||||| || || ||| |||||||||   |||| ||||| ||
Sbjct: 564 gcagccaccatgagagcacttgaaacatgatttgaggtaagactgtccttctactgttac 505

                                                                       
Query: 466 cttctcaagagggtatgctgttttaccacaagtggcgcacttgtcctgcgttccagaaaa 525
           ||||||||| || ||||| ||||| |||||||| || || || ||    || ||||||||
Sbjct: 504 cttctcaagtggatatgcagttttgccacaagtagcacatttttcgactgtcccagaaaa 445

                                                           
Query: 526 catgccagcagctttgcttggcgatctagtcagctcaggagtcaactt 573
           |||||  |||||||||||||| ||||| |||| ||| ||||| |||||
Sbjct: 444 catgctggcagctttgcttggtgatctcgtcatctcgggagttaactt 397



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 284 cgcttgaccgatgcgcacttgatcagatggttgtagctccccttctccttgaaaagctgt 343
           |||||||  |||||| | ||||| ||||| |||||||| || ||||||||||| ||||| 
Sbjct: 686 cgcttgattgatgcggatttgataagatgattgtagcttcctttctccttgaagagctgg 627

                               
Query: 344 gagaaatggtgcttgcagta 363
           || || || || ||||||||
Sbjct: 626 gaaaagtgatgtttgcagta 607



to top

>gb|AC135205.4| Oryza sativa (japonica cultivar-group) chromosome 3 clone OJ1012B02,
              complete sequence
          Length = 115270

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 56/61 (91%)
 Strand = Plus / Minus

                                                                          
Query: 600    gtgactggaagctcttattgtagctnccggtctccttgaacagctgcgcgaaatggggct 659
              |||| ||||||||||| |||||||| ||||||||||||||||| ||| ||||||||||||
Sbjct: 114649 gtgattggaagctcttgttgtagctcccggtctccttgaacagttgctcgaaatggggct 114590

               
Query: 660    t 660
              |
Sbjct: 114589 t 114589



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                    
Query: 556    cagctcaggagtcaacttgtccgttgcagatttcgcgg 593
              |||||||||||||||||| |||| ||| | ||||||||
Sbjct: 114802 cagctcaggagtcaacttctccgatgcgggtttcgcgg 114765



to top

>emb|BX842219.1|CNS09YBU Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL71ZA01 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 727

 Score = 83.8 bits (42), Expect = 7e-13
 Identities = 108/130 (83%)
 Strand = Plus / Minus

                                                                       
Query: 311 tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggatg 370
           |||||||| || |||||||||||||| ||||| | |||||| ||||||||||| ||||| 
Sbjct: 560 tggttgtaacttcccttctccttgaagagctgagcgaaatgatgcttgcagtacaggatt 501

                                                                       
Query: 371 ccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcatttgaag 430
            |||| ||| | ||||| ||||| || || |  | ||| |||||||| ||||| ||||||
Sbjct: 500 acttcaaaaactgcgtagttggaaggtgaaattgggcaacctccatgtgagcacttgaag 441

                     
Query: 431 caggacttgt 440
           ||||||||||
Sbjct: 440 caggacttgt 431



to top

>ref|XM_466988.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 621

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 54/59 (91%)
 Strand = Plus / Minus

                                                                      
Query: 311 tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggat 369
           ||||||||||| |||||||||||||| ||||| |||||||||  |||||||||||||||
Sbjct: 509 tggttgtagctgcccttctccttgaacagctgcgagaaatggatcttgcagtagaggat 451



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 35/39 (89%)
 Strand = Plus / Minus

                                                  
Query: 617 ttgtagctnccggtctccttgaacagctgcgcgaaatgg 655
           |||||||| ||  |||||||||||||||||| |||||||
Sbjct: 506 ttgtagctgcccttctccttgaacagctgcgagaaatgg 468



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 38/44 (86%)
 Strand = Plus / Minus

                                                       
Query: 406 gcagcctccatgagagcatttgaagcaggacttgtggtaagact 449
           |||||| ||||| ||||| ||||||||   ||||||||||||||
Sbjct: 414 gcagcccccatgcgagcacttgaagcaactcttgtggtaagact 371



to top

>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete
                sequence
          Length = 35954743

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                           
Query: 311      tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggat 369
                ||||||||||| |||||||||||||| ||||| |||||||||  |||||||||||||||
Sbjct: 25758325 tggttgtagctgcccttctccttgaacagctgcgagaaatggatcttgcagtagaggat 25758383



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                       
Query: 617      ttgtagctnccggtctccttgaacagctgcgcgaaatgg 655
                |||||||| ||  |||||||||||||||||| |||||||
Sbjct: 25758328 ttgtagctgcccttctccttgaacagctgcgagaaatgg 25758366



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                            
Query: 406      gcagcctccatgagagcatttgaagcaggacttgtggtaagact 449
                |||||| ||||| ||||| ||||||||   ||||||||||||||
Sbjct: 25758420 gcagcccccatgcgagcacttgaagcaactcttgtggtaagact 25758463



to top

>dbj|AP004768.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC
              clone:P0010C01
          Length = 186185

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                         
Query: 311    tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggat 369
              ||||||||||| |||||||||||||| ||||| |||||||||  |||||||||||||||
Sbjct: 161001 tggttgtagctgcccttctccttgaacagctgcgagaaatggatcttgcagtagaggat 161059



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                     
Query: 617    ttgtagctnccggtctccttgaacagctgcgcgaaatgg 655
              |||||||| ||  |||||||||||||||||| |||||||
Sbjct: 161004 ttgtagctgcccttctccttgaacagctgcgagaaatgg 161042



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                          
Query: 406    gcagcctccatgagagcatttgaagcaggacttgtggtaagact 449
              |||||| ||||| ||||| ||||||||   ||||||||||||||
Sbjct: 161096 gcagcccccatgcgagcacttgaagcaactcttgtggtaagact 161139



to top

>dbj|AP004133.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC
            clone:OJ1112_G03
          Length = 106401

 Score = 77.8 bits (39), Expect = 4e-11
 Identities = 54/59 (91%)
 Strand = Plus / Plus

                                                                       
Query: 311  tggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggat 369
            ||||||||||| |||||||||||||| ||||| |||||||||  |||||||||||||||
Sbjct: 4931 tggttgtagctgcccttctccttgaacagctgcgagaaatggatcttgcagtagaggat 4989



 Score = 48.1 bits (24), Expect = 0.037
 Identities = 35/39 (89%)
 Strand = Plus / Plus

                                                   
Query: 617  ttgtagctnccggtctccttgaacagctgcgcgaaatgg 655
            |||||||| ||  |||||||||||||||||| |||||||
Sbjct: 4934 ttgtagctgcccttctccttgaacagctgcgagaaatgg 4972



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                        
Query: 406  gcagcctccatgagagcatttgaagcaggacttgtggtaagact 449
            |||||| ||||| ||||| ||||||||   ||||||||||||||
Sbjct: 5026 gcagcccccatgcgagcacttgaagcaactcttgtggtaagact 5069



to top

>dbj|AP006402.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT34J23, TM0284,
             complete sequence
          Length = 92675

 Score = 71.9 bits (36), Expect = 3e-09
 Identities = 63/72 (87%)
 Strand = Plus / Plus

                                                                         
Query: 310   atggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcagtagaggat 369
             |||| ||||| |||| |||||| |||||||||||  ||||||||||||||||||||||| 
Sbjct: 85168 atggctgtaggtccctttctccatgaaaagctgttggaaatggtgcttgcagtagaggac 85227

                         
Query: 370   gccttccaaagc 381
              || ||||||||
Sbjct: 85228 accatccaaagc 85239



to top

>ref|NM_129548.2| Arabidopsis thaliana zinc ion binding AT2G39900 mRNA, complete cds
          Length = 948

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 302 ttgatcagatggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcag 361
           ||||| ||||| ||||| || || ||||||||||||||||| | ||||||||||||||||
Sbjct: 702 ttgatgagatgattgtaacttcctttctccttgaaaagctgagcgaaatggtgcttgcag 643

             
Query: 362 ta 363
           ||
Sbjct: 642 ta 641



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 494 caagtggcgcacttgtcctgcgttccagaaaacatgccagca 535
           ||||| ||||| ||||| ||||||||||| ||||| ||||||
Sbjct: 510 caagtagcgcatttgtcttgcgttccagagaacataccagca 469



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 416 tgagagcatttgaagcaggacttgtggtaaga 447
           ||||||||||||||||| | |||||| |||||
Sbjct: 291 tgagagcatttgaagcaagccttgtgataaga 260



to top

>gb|AY122901.1| Arabidopsis thaliana At2g39900/T28M21.6 mRNA, complete cds
          Length = 603

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 302 ttgatcagatggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcag 361
           ||||| ||||| ||||| || || ||||||||||||||||| | ||||||||||||||||
Sbjct: 527 ttgatgagatgattgtaacttcctttctccttgaaaagctgagcgaaatggtgcttgcag 468

             
Query: 362 ta 363
           ||
Sbjct: 467 ta 466



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 494 caagtggcgcacttgtcctgcgttccagaaaacatgccagca 535
           ||||| ||||| ||||| ||||||||||| ||||| ||||||
Sbjct: 335 caagtagcgcatttgtcttgcgttccagagaacataccagca 294



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 416 tgagagcatttgaagcaggacttgtggtaaga 447
           ||||||||||||||||| | |||||| |||||
Sbjct: 116 tgagagcatttgaagcaagccttgtgataaga 85



to top

>gb|AY094448.1| Arabidopsis thaliana At2g39900/T28M21.6 mRNA, complete cds
          Length = 948

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 302 ttgatcagatggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcag 361
           ||||| ||||| ||||| || || ||||||||||||||||| | ||||||||||||||||
Sbjct: 702 ttgatgagatgattgtaacttcctttctccttgaaaagctgagcgaaatggtgcttgcag 643

             
Query: 362 ta 363
           ||
Sbjct: 642 ta 641



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 494 caagtggcgcacttgtcctgcgttccagaaaacatgccagca 535
           ||||| ||||| ||||| ||||||||||| ||||| ||||||
Sbjct: 510 caagtagcgcatttgtcttgcgttccagagaacataccagca 469



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 416 tgagagcatttgaagcaggacttgtggtaaga 447
           ||||||||||||||||| | |||||| |||||
Sbjct: 291 tgagagcatttgaagcaagccttgtgataaga 260



to top

>gb|AF002109.3| Arabidopsis thaliana chromosome 2 clone T28M21 map CIC10A06, complete
             sequence
          Length = 108847

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                         
Query: 302   ttgatcagatggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcag 361
             ||||| ||||| ||||| || || ||||||||||||||||| | ||||||||||||||||
Sbjct: 28852 ttgatgagatgattgtaacttcctttctccttgaaaagctgagcgaaatggtgcttgcag 28793

               
Query: 362   ta 363
             ||
Sbjct: 28792 ta 28791



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                       
Query: 494   caagtggcgcacttgtcctgcgttccagaaaacatgccagca 535
             ||||| ||||| ||||| ||||||||||| ||||| ||||||
Sbjct: 28450 caagtagcgcatttgtcttgcgttccagagaacataccagca 28409



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                             
Query: 416   tgagagcatttgaagcaggacttgtggtaaga 447
             ||||||||||||||||| | |||||| |||||
Sbjct: 27912 tgagagcatttgaagcaagccttgtgataaga 27881



to top

>emb|BX842053.1|CNS09Y9O Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL12ZH07 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 892

 Score = 67.9 bits (34), Expect = 4e-08
 Identities = 55/62 (88%)
 Strand = Plus / Minus

                                                                       
Query: 302 ttgatcagatggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttgcag 361
           ||||| ||||| ||||| || || ||||||||||||||||| | ||||||||||||||||
Sbjct: 656 ttgatgagatgattgtaacttcctttctccttgaaaagctgagcgaaatggtgcttgcag 597

             
Query: 362 ta 363
           ||
Sbjct: 596 ta 595



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 494 caagtggcgcacttgtcctgcgttccagaaaacatgccagca 535
           ||||| ||||| ||||| ||||||||||| ||||| ||||||
Sbjct: 464 caagtagcgcatttgtcttgcgttccagagaacataccagca 423



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 416 tgagagcatttgaagcaggacttgtggtaaga 447
           ||||||||||||||||| | |||||| |||||
Sbjct: 245 tgagagcatttgaagcaagccttgtgataaga 214



to top

>emb|BX842049.1|CNS09Y98 Arabidopsis thaliana Full-length cDNA Complete sequence from clone
           GSLTSIL12ZB11 of Silique of strain col-0 of Arabidopsis
           thaliana (thale cress)
          Length = 904

 Score = 58.0 bits (29), Expect = 4e-05
 Identities = 50/57 (87%)
 Strand = Plus / Minus

                                                                    
Query: 302 ttgatcagatggttgtagctccccttctccttgaaaagctgtgagaaatggtgcttg 358
           ||||| ||||| ||||| || || ||||||||||||||||| | |||||||||||||
Sbjct: 657 ttgatgagatgattgtaacttcctttctccttgaaaagctgagcgaaatggtgcttg 601



 Score = 44.1 bits (22), Expect = 0.58
 Identities = 37/42 (88%)
 Strand = Plus / Minus

                                                     
Query: 494 caagtggcgcacttgtcctgcgttccagaaaacatgccagca 535
           ||||| ||||| ||||| ||||||||||| ||||| ||||||
Sbjct: 464 caagtagcgcatttgtcttgcgttccagagaacataccagca 423



 Score = 40.1 bits (20), Expect = 9.1
 Identities = 29/32 (90%)
 Strand = Plus / Minus

                                           
Query: 416 tgagagcatttgaagcaggacttgtggtaaga 447
           ||||||||||||||||| | |||||| |||||
Sbjct: 245 tgagagcatttgaagcaagccttgtgataaga 214



to top

>ref|XM_473290.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 606

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 406 gcagcctccatgagagcatttgaagcaggacttgtggtaagact 449
           |||||||||||||||||| |||||||||  ||||||||| ||||
Sbjct: 411 gcagcctccatgagagcacttgaagcagctcttgtggtatgact 368



to top

>emb|AL663006.3|OSJN00204 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0039L24,
             complete sequence
          Length = 121056

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                         
Query: 406   gcagcctccatgagagcatttgaagcaggacttgtggtaagact 449
             |||||||||||||||||| |||||||||  ||||||||| ||||
Sbjct: 34490 gcagcctccatgagagcacttgaagcagctcttgtggtatgact 34533



to top

>emb|AL662984.3|OSJN00183 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0081C01,
              complete sequence
          Length = 140454

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                          
Query: 406    gcagcctccatgagagcatttgaagcaggacttgtggtaagact 449
              |||||||||||||||||| |||||||||  ||||||||| ||||
Sbjct: 131818 gcagcctccatgagagcacttgaagcagctcttgtggtatgact 131861



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Plus

                                                            
Query: 406      gcagcctccatgagagcatttgaagcaggacttgtggtaagact 449
                |||||||||||||||||| |||||||||  ||||||||| ||||
Sbjct: 26594932 gcagcctccatgagagcacttgaagcagctcttgtggtatgact 26594975



to top

>emb|BX822901.1|CNS0A5ZC Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTFB71ZB02 of Flowers and buds of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 1203

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 111/135 (82%), Gaps = 4/135 (2%)
 Strand = Plus / Minus

                                                                        
Query: 311  tggttgtagctccccttctccttgaaaagctgtgagaaatggtgc--ttgcagtag-agg 367
            |||||||| || |||||||||||||| ||||| | ||||||||||   |||||||| |||
Sbjct: 1018 tggttgtaacttcccttctccttgaagagctgagcgaaatggtgcgtgtgcagtagcagg 959

                                                                        
Query: 368  -atgccttccaaagccgcgtaattggagggcgagagggcgcagcctccatgagagcattt 426
             || ||||| | ||| ||||| ||||| || || |  | ||| |||||||| ||||| ||
Sbjct: 958  tattccttcaagagctgcgtagttggaaggtgaaattgggcaacctccatgtgagcactt 899

                           
Query: 427  gaagcaggacttgtg 441
            |||||||||||||||
Sbjct: 898  gaagcaggacttgtg 884



 Score = 46.1 bits (23), Expect = 0.15
 Identities = 68/83 (81%)
 Strand = Plus / Minus

                                                                       
Query: 485 gttttaccacaagtggcgcacttgtcctgcgttccagaaaacatgccagcagctttgctt 544
           ||||||| |||||||||||| || || || || ||||| ||| |||||||| ||  ||| 
Sbjct: 555 gttttactacaagtggcgcatttctcttgtgtaccagagaacctgccagcaactcggcta 496

                                  
Query: 545 ggcgatctagtcagctcaggagt 567
           ||||  || ||||||||||||||
Sbjct: 495 ggcgtccttgtcagctcaggagt 473



to top

>dbj|AK069907.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023034M24, full
           insert sequence
          Length = 955

 Score = 56.0 bits (28), Expect = 2e-04
 Identities = 40/44 (90%)
 Strand = Plus / Minus

                                                       
Query: 406 gcagcctccatgagagcatttgaagcaggacttgtggtaagact 449
           |||||||||||||||||| |||||||||  ||||||||| ||||
Sbjct: 475 gcagcctccatgagagcacttgaagcagctcttgtggtatgact 432



to top

>gb|AY117114.1| Gossypioides kirkii putative LIM-domain transcription factor gene,
           partial cds
          Length = 353

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 73/89 (82%)
 Strand = Plus / Minus

                                                                       
Query: 464 accttctcaagagggtatgctgttttaccacaagtggcgcacttgtcctgcgttccagaa 523
           ||||||||||| || || || ||||| |||||||| ||||| || || || || || |||
Sbjct: 277 accttctcaagtggataagcagttttgccacaagtagcgcatttttcttgtgtaccggaa 218

                                        
Query: 524 aacatgccagcagctttgcttggcgatct 552
           |||||||  ||||||||||| || |||||
Sbjct: 217 aacatgctggcagctttgctaggtgatct 189



to top

>gb|AF116851.1|AF116851 Nicotiana tabacum LIM domain protein PLIM-2 (PLIM-2) mRNA, complete
           cds
          Length = 960

 Score = 50.1 bits (25), Expect = 0.009
 Identities = 43/49 (87%)
 Strand = Plus / Minus

                                                            
Query: 329 tccttgaaaagctgtgagaaatggtgcttgcagtagaggatgccttcca 377
           ||||| |||||||||  |||||| ||||||||||||||||  |||||||
Sbjct: 257 tccttaaaaagctgttcgaaatgatgcttgcagtagaggactccttcca 209



to top

>gb|AY117110.1| Gossypium herbaceum putative LIM-domain transcription factor gene,
           partial cds
          Length = 350

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 66/80 (82%)
 Strand = Plus / Minus

                                                                       
Query: 464 accttctcaagagggtatgctgttttaccacaagtggcgcacttgtcctgcgttccagaa 523
           |||||||| || ||||| || ||||| |||||||| ||||| || || || || || |||
Sbjct: 277 accttctcgagtgggtaagcagtttttccacaagtagcgcatttttcttgtgtcccggaa 218

                               
Query: 524 aacatgccagcagctttgct 543
           |||||||  |||||||||||
Sbjct: 217 aacatgctggcagctttgct 198



to top

>gb|AY109812.1| Zea mays CL4474_1 mRNA sequence
          Length = 1014

 Score = 48.1 bits (24), Expect = 0.037
 Identities = 30/32 (93%)
 Strand = Plus / Minus

                                           
Query: 311 tggttgtagctccccttctccttgaaaagctg 342
           ||||||||||||||||||||| |||| |||||
Sbjct: 470 tggttgtagctccccttctccatgaacagctg 439



 Score = 42.1 bits (21), Expect = 2.3
 Identities = 32/36 (88%)
 Strand = Plus / Minus

                                               
Query: 621 agctnccggtctccttgaacagctgcgcgaaatggg 656
           |||| |||||||||||||| |||||| |||| ||||
Sbjct: 175 agctcccggtctccttgaagagctgctcgaagtggg 140



to top

>ref|XM_422730.1| PREDICTED: Gallus gallus similar to mKIAA0226 protein (LOC424920),
            mRNA
          Length = 3720

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                  
Query: 423  atttgaagcaggacttgtggta 444
            ||||||||||||||||||||||
Sbjct: 3589 atttgaagcaggacttgtggta 3568



to top

>gb|AF055071.1| Anopheles oswaldoi clone PE1 5.8S ribosomal RNA gene, partial
           sequence; internal transcribed spacer 2, complete
           sequence; and 28S ribosomal RNA gene, partial sequence
          Length = 504

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 579 ttgcagatttcgcgggggattgtgactgga 608
           ||||| ||||||| ||||||||||||||||
Sbjct: 289 ttgcacatttcgctggggattgtgactgga 260



to top

>gb|AF184885.1|AF184885 Nicotiana tabacum LIM domain protein PLIM1 (PLIM1) gene, complete cds
          Length = 1773

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                  
Query: 407  cagcctccatgagagcatttgaagcaggacttgtggta 444
            ||||||||||||  |||||||||||||| ||| |||||
Sbjct: 1622 cagcctccatgactgcatttgaagcaggccttatggta 1585



to top

>gb|AF197567.1|AF197567 Nicotiana tabacum pollen specific LIM domain protein 1a mRNA,
           complete cds
          Length = 904

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 34/38 (89%)
 Strand = Plus / Minus

                                                 
Query: 407 cagcctccatgagagcatttgaagcaggacttgtggta 444
           ||||||||||||  |||||||||||||| ||| |||||
Sbjct: 540 cagcctccatgactgcatttgaagcaggccttatggta 503



to top

>gb|AY684984.1| Anopheles benarrochi B isolate CO315-26 5.8S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 540

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 579 ttgcagatttcgcgggggattgtgactgga 608
           ||||| ||||||| ||||||||||||||||
Sbjct: 332 ttgcacatttcgctggggattgtgactgga 303



to top

>gb|AY684983.1| Anopheles benarrochi B isolate CO314-1-4 5.8S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 540

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 579 ttgcagatttcgcgggggattgtgactgga 608
           ||||| ||||||| ||||||||||||||||
Sbjct: 332 ttgcacatttcgctggggattgtgactgga 303



to top

>gb|AY684982.1| Anopheles benarrochi B isolate CO314-1 5.8S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 540

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 579 ttgcagatttcgcgggggattgtgactgga 608
           ||||| ||||||| ||||||||||||||||
Sbjct: 332 ttgcacatttcgctggggattgtgactgga 303



to top

>gb|AY684981.1| Anopheles benarrochi B isolate CO313-20-1 5.8S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 540

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 579 ttgcagatttcgcgggggattgtgactgga 608
           ||||| ||||||| ||||||||||||||||
Sbjct: 332 ttgcacatttcgctggggattgtgactgga 303



to top

>gb|AY684980.1| Anopheles benarrochi B isolate CO172-12-4 5.8S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 540

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 579 ttgcagatttcgcgggggattgtgactgga 608
           ||||| ||||||| ||||||||||||||||
Sbjct: 332 ttgcacatttcgctggggattgtgactgga 303



to top

>gb|AY684979.1| Anopheles benarrochi B isolate CO168-13 5.8S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 540

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 579 ttgcagatttcgcgggggattgtgactgga 608
           ||||| ||||||| ||||||||||||||||
Sbjct: 332 ttgcacatttcgctggggattgtgactgga 303



to top

>gb|AY684978.1| Anopheles benarrochi B isolate CO235-31 5.8S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 540

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 579 ttgcagatttcgcgggggattgtgactgga 608
           ||||| ||||||| ||||||||||||||||
Sbjct: 332 ttgcacatttcgctggggattgtgactgga 303



to top

>gb|AY684977.1| Anopheles benarrochi B isolate CO235-18 5.8S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 540

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 579 ttgcagatttcgcgggggattgtgactgga 608
           ||||| ||||||| ||||||||||||||||
Sbjct: 332 ttgcacatttcgctggggattgtgactgga 303



to top

>gb|AY684976.1| Anopheles benarrochi B isolate CO235-12 5.8S ribosomal RNA gene,
           partial sequence; internal transcribed spacer 2,
           complete sequence; and 28S ribosomal RNA gene, partial
           sequence
          Length = 540

 Score = 44.1 bits (22), Expect = 0.58
 Identities = 28/30 (93%)
 Strand = Plus / Minus

                                         
Query: 579 ttgcagatttcgcgggggattgtgactgga 608
           ||||| ||||||| ||||||||||||||||
Sbjct: 332 ttgcacatttcgctggggattgtgactgga 303



to top

>gb|DQ020137.1| Anopheles aquasalis isolate AqITS2AUC9117-53 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 505

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 346 tgcacatttcgctggggattgtgactgga 318



to top

>gb|DQ020136.1| Anopheles aquasalis isolate AqITS2AUC9117-41 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 503

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 346 tgcacatttcgctggggattgtgactgga 318



to top

>gb|DQ020135.1| Anopheles aquasalis isolate AqITS2WNZ9116-45 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 505

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 346 tgcacatttcgctggggattgtgactgga 318



to top

>gb|DQ020134.1| Anopheles aquasalis isolate AqITS2WNZ9115-47 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 503

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 346 tgcacatttcgctggggattgtgactgga 318



to top

>gb|DQ020133.1| Anopheles aquasalis isolate AqITS2WNZ9115-44 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 503

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 346 tgcacatttcgctggggattgtgactgga 318



to top

>gb|DQ020132.1| Anopheles aquasalis isolate AqITS2WNZ9115-42 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 505

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 346 tgcacatttcgctggggattgtgactgga 318



to top

>gb|DQ020131.1| Anopheles aquasalis isolate AqITS2ZVZ7005-48 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 505

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 346 tgcacatttcgctggggattgtgactgga 318



to top

>gb|DQ020130.1| Anopheles aquasalis isolate AqITS2ZVZ7004-40 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 503

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 346 tgcacatttcgctggggattgtgactgga 318



to top

>gb|DQ020129.1| Anopheles aquasalis isolate AqITS2ZVZ7003-43 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 503

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 346 tgcacatttcgctggggattgtgactgga 318



to top

>gb|DQ020128.1| Anopheles aquasalis isolate AqITS2SNF6095-49 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 503

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 346 tgcacatttcgctggggattgtgactgga 318



to top

>gb|DQ020127.1| Anopheles aquasalis isolate AqITS2SNF6095-51 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 505

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 346 tgcacatttcgctggggattgtgactgga 318



to top

>gb|DQ020126.1| Anopheles aquasalis isolate AqITS2SNF7007-60 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 496

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 339 tgcacatttcgctggggattgtgactgga 311



to top

>gb|DQ020125.1| Anopheles aquasalis isolate AqITS2SNF7006-52 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 505

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 346 tgcacatttcgctggggattgtgactgga 318



to top

>gb|DQ020124.1| Anopheles aquasalis isolate AqITS2SNF7006-50 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 503

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 346 tgcacatttcgctggggattgtgactgga 318



to top

>gb|DQ020123.1| Anopheles aquasalis isolate AqITS2SNF7006-46 5.8S ribosomal RNA
           gene and internal transcribed spacer 2, partial sequence
          Length = 503

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 346 tgcacatttcgctggggattgtgactgga 318



to top

>ref|XM_962778.1| PREDICTED: Tribolium castaneum similar to CG1019-PA, isoform A,
           transcript variant 1 (LOC663031), mRNA
          Length = 1990

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 421 gcatttgaagcaggacttgtg 441
           |||||||||||||||||||||
Sbjct: 190 gcatttgaagcaggacttgtg 170



to top

>ref|XM_971072.1| PREDICTED: Tribolium castaneum similar to CG1019-PA, isoform A,
           transcript variant 3 (LOC663031), mRNA
          Length = 1803

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 421 gcatttgaagcaggacttgtg 441
           |||||||||||||||||||||
Sbjct: 114 gcatttgaagcaggacttgtg 94



to top

>ref|XM_971066.1| PREDICTED: Tribolium castaneum similar to CG1019-PA, isoform A,
           transcript variant 2 (LOC663031), mRNA
          Length = 833

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 421 gcatttgaagcaggacttgtg 441
           |||||||||||||||||||||
Sbjct: 192 gcatttgaagcaggacttgtg 172



to top

>gb|AC149594.2| Xenopus tropicalis chromosome CH216-62P2, complete sequence
          Length = 167602

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 334   gaaaagctgtgagaaatggtg 354
             |||||||||||||||||||||
Sbjct: 76278 gaaaagctgtgagaaatggtg 76298



to top

>gb|AY028128.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028126.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028125.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028124.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028123.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028122.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028121.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028120.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028119.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028118.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028117.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028116.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028115.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028114.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028113.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028112.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028111.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028110.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028109.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028108.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028107.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028106.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028105.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028104.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028103.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028102.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028101.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028100.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028099.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028098.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028097.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028096.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028095.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028094.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028093.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028092.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028091.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028090.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028089.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028087.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028088.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028083.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028086.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028085.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028084.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028082.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY028081.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 549

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 335 tgcacatttcgctggggattgtgactgga 307



to top

>gb|AY117112.1| Gossypium barbadense A-subgenome putative LIM-domain transcription
           factor gene, partial cds
          Length = 350

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 72/89 (80%)
 Strand = Plus / Minus

                                                                       
Query: 464 accttctcaagagggtatgctgttttaccacaagtggcgcacttgtcctgcgttccagaa 523
           |||||||| || || || || ||||| |||||||| ||||| || || || || || |||
Sbjct: 277 accttctcgagtggataagcagtttttccacaagtagcgcatttttcttgtgtcccggaa 218

                                        
Query: 524 aacatgccagcagctttgcttggcgatct 552
           |||||||  ||||||||||| || |||||
Sbjct: 217 aacatgctggcagctttgctaggtgatct 189



to top

>gb|AF461750.1| Anopheles evansae 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 491

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 291 tgcacatttcgctggggattgtgactgga 263



to top

>gb|AF461749.1| Anopheles nuneztovari 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 491

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 291 tgcacatttcgctggggattgtgactgga 263



to top

>gb|AF462384.1| Anopheles benarrochi 2 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 494

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 291 tgcacatttcgctggggattgtgactgga 263



to top

>gb|AF462383.1| Anopheles benarrochi 1 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 497

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 292 tgcacatttcgctggggattgtgactgga 264



to top

>gb|AF462376.1| Anopheles aquasalis 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 474

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 288 tgcacatttcgctggggattgtgactgga 260



to top

>gb|U92355.1|ATU92355 Anopheles trinkae internal transcribed spacer 2, complete sequence
          Length = 396

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 189 tgcacatttcgctggggattgtgactgga 161



to top

>gb|U92351.1|ANU92351 Anopheles nuneztovari internal transcribed spacer 2, complete
           sequence
          Length = 371

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 191 tgcacatttcgctggggattgtgactgga 163



to top

>gb|U92350.1|ANU92350 Anopheles nuneztovari internal transcribed spacer 2, complete
           sequence
          Length = 369

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 191 tgcacatttcgctggggattgtgactgga 163



to top

>gb|U92346.1|ATU92346 Anopheles trinkae internal transcribed spacer 2, complete sequence
          Length = 401

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 194 tgcacatttcgctggggattgtgactgga 166



to top

>gb|U92343.1|ANU92343 Anopheles nuneztovari internal transcribed spacer 2, complete
           sequence
          Length = 377

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 191 tgcacatttcgctggggattgtgactgga 163



to top

>gb|U92328.1|AGU92328 Anopheles galvaoi internal transcribed spacer 2, complete sequence
          Length = 359

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 187 tgcacatttcgctggggattgtgactgga 159



to top

>gb|U92326.1|ADU92326 Anopheles dunhami internal transcribed spacer 2, complete sequence
          Length = 377

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 191 tgcacatttcgctggggattgtgactgga 163



to top

>gb|U92325.1|ABU92325 Anopheles benarrochi internal transcribed spacer 2, complete
           sequence
          Length = 379

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 210 tgcacatttcgctggggattgtgactgga 182



to top

>gb|U92324.1|AAU92324 Anopheles aquasalis internal transcribed spacer 2, complete
           sequence
          Length = 352

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 189 tgcacatttcgctggggattgtgactgga 161



to top

>gb|U92323.1|AAU92323 Anopheles albimanus internal transcribed spacer 2, complete
           sequence
          Length = 378

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 209 tgcacatttcgctggggattgtgactgga 181



to top

>gb|L78065.1|MSQINSP Anopheles albimanus ribosomal RNA (rRNA) gene
          Length = 8312

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                         
Query: 580  tgcagatttcgcgggggattgtgactgga 608
            |||| ||||||| ||||||||||||||||
Sbjct: 4125 tgcacatttcgctggggattgtgactgga 4097



to top

>emb|Y09075.1|ATITS2DNA A.trinkae internal transcribed spacer 2 DNA
          Length = 480

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 260 tgcacatttcgctggggattgtgactgga 232



to top

>gb|L22462.1|MSQITS2BN Anopheles nuneztovari 5.8S ribosomal RNA, internal transcribed
           spacer 2 (ITS2) and 28S ribosomal RNA
          Length = 446

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 580 tgcagatttcgcgggggattgtgactgga 608
           |||| ||||||| ||||||||||||||||
Sbjct: 257 tgcacatttcgctggggattgtgactgga 229



to top

>gb|AC004226.1| Homo sapiens chromosome 5, BAC clone 313n8 (LBNL H146), complete
             sequence
          Length = 108754

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 649   gaaatggggctttgcagtag 668
             ||||||||||||||||||||
Sbjct: 69103 gaaatggggctttgcagtag 69084



to top

>gb|AF051274.1| Anopheles darlingi internal transcribed spacer 2, complete sequence
          Length = 403

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 585 atttcgcgggggattgtgactgga 608
           ||||||| ||||||||||||||||
Sbjct: 226 atttcgctggggattgtgactgga 203



to top

>ref|XM_455236.1| Kluyveromyces lactis NRRL Y-1140, KLLA0F03443g predicted mRNA
          Length = 672

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 436 cttgtggtaagacttctctt 455
           ||||||||||||||||||||
Sbjct: 71  cttgtggtaagacttctctt 90



to top

>gb|AC084386.2| Mus musculus BAC clone RP23-61O2 from 17, complete sequence
          Length = 209523

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 114    tccccggagcttgaacacag 133
              ||||||||||||||||||||
Sbjct: 191925 tccccggagcttgaacacag 191944



to top

>gb|AC006404.25| Mus musculus strain 129/Sv clone ct7-141k23 map 6, complete sequence
          Length = 142777

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 92    acgaaattgataggtcctgg 111
             ||||||||||||||||||||
Sbjct: 89650 acgaaattgataggtcctgg 89631



to top

>emb|AL023285.1|HS474A14 Human DNA sequence from clone RP3-474A14 on chromosome 1q24.1-25.2
             Contains the 5' end of the TNR gene for tenascin R
             (restrictin, janusin), complete sequence
          Length = 107352

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 458   actgtcaccttctcaagagg 477
             ||||||||||||||||||||
Sbjct: 27253 actgtcaccttctcaagagg 27234



to top

>gb|AC110594.5| Homo sapiens chromosome 17, clone CTD-2193J24, complete sequence
          Length = 159490

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 520   agaaaacatgccagcagctt 539
             ||||||||||||||||||||
Sbjct: 44900 agaaaacatgccagcagctt 44919



to top

>emb|CR382126.1| Kluyveromyces lactis strain NRRL Y-1140 chromosome F of strain NRRL
              Y-1140 of Kluyveromyces lactis
          Length = 2602197

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 436    cttgtggtaagacttctctt 455
              ||||||||||||||||||||
Sbjct: 324090 cttgtggtaagacttctctt 324109



to top

>emb|AL663115.11| Mouse DNA sequence from clone RP23-452C23 on chromosome 11 Contains the
              gene for a novel protein simialr to cell division cycle
              associated 4 Cdca4, a ribosomal protein L15 (Rpl15)
              pseudogene, the 3' end of a novel gene and two CpG islands,
              complete sequence
          Length = 183089

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 320    ctccccttctccttgaaaag 339
              ||||||||||||||||||||
Sbjct: 162723 ctccccttctccttgaaaag 162742



to top

>gb|AC122178.2| Homo sapiens chromosome 3 clone RP11-340I14, complete sequence
          Length = 201917

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 520   agaaaacatgccagcagctt 539
             ||||||||||||||||||||
Sbjct: 60335 agaaaacatgccagcagctt 60354



to top

>dbj|AB072914.1| Expression vector pMFXU4 DNA, complete sequence
          Length = 7052

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 14   agcaatttcaacagtttctt 33
            ||||||||||||||||||||
Sbjct: 3176 agcaatttcaacagtttctt 3195



to top

>ref|NM_176104.1| Drosophila melanogaster CG33087-RC (CG33087), mRNA
          Length = 14423

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 528  tgccagcagctttgcttggc 547
            ||||||||||||||||||||
Sbjct: 5713 tgccagcagctttgcttggc 5732



to top

>gb|AE017340.1| Idiomarina loihiensis L2TR, complete genome
          Length = 2839318

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                   
Query: 230     gcagccgcctgtgctgtttg 249
               ||||||||||||||||||||
Sbjct: 1853776 gcagccgcctgtgctgtttg 1853795



to top

>gb|AC155636.3| Mus musculus BAC clone RP23-345F5 from chromosome 17, complete sequence
          Length = 223528

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 114    tccccggagcttgaacacag 133
              ||||||||||||||||||||
Sbjct: 156166 tccccggagcttgaacacag 156147



to top

>gb|AF462389.1| Anopheles darlingi 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 536

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 585 atttcgcgggggattgtgactgga 608
           ||||||| ||||||||||||||||
Sbjct: 336 atttcgctggggattgtgactgga 313



to top

>gb|AF462388.1| Anopheles darlingi 5.8S ribosomal RNA gene, partial sequence;
           internal transcribed spacer 2, complete sequence; and
           28S ribosomal RNA gene, partial sequence
          Length = 537

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 585 atttcgcgggggattgtgactgga 608
           ||||||| ||||||||||||||||
Sbjct: 336 atttcgctggggattgtgactgga 313



to top

>gb|AC126327.6| Homo sapiens chromosome 17, clone RP11-428O23, complete sequence
          Length = 181517

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 520   agaaaacatgccagcagctt 539
             ||||||||||||||||||||
Sbjct: 56692 agaaaacatgccagcagctt 56673



to top

>emb|CT030184.14| Mouse DNA sequence from clone RP23-9C19 on chromosome 13, complete
            sequence
          Length = 201341

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 314  ttgtagctccccttctcctt 333
            ||||||||||||||||||||
Sbjct: 3196 ttgtagctccccttctcctt 3215



to top

>gb|AC008370.1|AC008370 Drosophila melanogaster, chromosome 2R, region 44B-44C, BAC clones
             BACR09N11 and BACR40A15, complete sequence
          Length = 132171

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 528   tgccagcagctttgcttggc 547
             ||||||||||||||||||||
Sbjct: 98818 tgccagcagctttgcttggc 98837



to top

>gb|AE003838.3| Drosophila melanogaster chromosome 2R, section 12 of 73 of the complete
              sequence
          Length = 226833

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 528    tgccagcagctttgcttggc 547
              ||||||||||||||||||||
Sbjct: 173577 tgccagcagctttgcttggc 173596



to top

>gb|AC131029.6| Mus musculus chromosome 14, clone RP23-304N24, complete sequence
          Length = 239588

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 37     gaatgacatcaactccatgg 56
              ||||||||||||||||||||
Sbjct: 221246 gaatgacatcaactccatgg 221265



to top

>dbj|D85624.1|CNASA Citrullus lanatus serine acetyltransferase (Sat) DNA, complete cds
          Length = 5729

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 39  atgacatcaactccatggtt 58
           ||||||||||||||||||||
Sbjct: 195 atgacatcaactccatggtt 176



to top

>emb|CT030187.6| Mouse DNA sequence from clone RP23-38L5 on chromosome 13, complete
             sequence
          Length = 152073

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 314   ttgtagctccccttctcctt 333
             ||||||||||||||||||||
Sbjct: 43162 ttgtagctccccttctcctt 43143



to top

>emb|AL929576.7| Zebrafish DNA sequence from clone CH211-188M17, complete sequence
          Length = 161073

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 134   catacagcaggttacaatcgtaaataaa 161
             ||||| |||| |||||||||||||||||
Sbjct: 10701 catactgcagtttacaatcgtaaataaa 10728



to top

>gb|U92337.1|ADU92337 Anopheles darlingi internal transcribed spacer 2, complete sequence
          Length = 406

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 585 atttcgcgggggattgtgactgga 608
           ||||||| ||||||||||||||||
Sbjct: 229 atttcgctggggattgtgactgga 206



to top

>gb|AC083894.21| Mus musculus strain C57BL/6J chromosome 6 clone rp23-259j8, complete
              sequence
          Length = 167273

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 92     acgaaattgataggtcctgg 111
              ||||||||||||||||||||
Sbjct: 106132 acgaaattgataggtcctgg 106151



to top

>gb|U36780.1|ADU36780 Anopheles darlingi rDNA internal transcribed spacer 2 (ITS2)
          Length = 406

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                   
Query: 585 atttcgcgggggattgtgactgga 608
           ||||||| ||||||||||||||||
Sbjct: 229 atttcgctggggattgtgactgga 206



to top

>gb|M86236.1|YSAURAIII Candida boidinii orotidine-5'-phosphate decarboxylase (URA3) gene,
           complete cds
          Length = 1686

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 14  agcaatttcaacagtttctt 33
           ||||||||||||||||||||
Sbjct: 743 agcaatttcaacagtttctt 724



to top

>dbj|AB006530.1| Citrullus lanatus Sat gene for serine acetyltransferase, complete cds
            and 5'-flanking region
          Length = 7344

 Score = 40.1 bits (20), Expect = 9.1
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 39   atgacatcaactccatggtt 58
            ||||||||||||||||||||
Sbjct: 1810 atgacatcaactccatggtt 1791


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,273,419
Number of Sequences: 3902068
Number of extensions: 5273419
Number of successful extensions: 103726
Number of sequences better than 10.0: 172
Number of HSP's better than 10.0 without gapping: 172
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 103272
Number of HSP's gapped (non-prelim): 433
length of query: 668
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 645
effective length of database: 17,143,297,704
effective search space: 11057427019080
effective search space used: 11057427019080
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top