Clone Name | rbasd26c06 |
---|---|
Clone Library Name | barley_pub |
>gb|AC135564.4| Oryza sativa chromosome 3 BAC OSJNBb0056O10 genomic sequence, complete sequence Length = 139771 Score = 472 bits (238), Expect = e-130 Identities = 361/402 (89%) Strand = Plus / Plus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||| || |||||||||| |||| Sbjct: 78979 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 79038 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 |||||||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 79039 tcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccgaac 79098 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| Sbjct: 79099 atggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcgaaggtg 79158 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 |||||||||||||||||||| || |||||||||||||| || ||||| | |||||||| Sbjct: 79159 tcagggtcgtcggcgaggccgagcgggtcgaaggcgccgcctgggtacaccttgtcgagg 79218 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 ||||| ||||| || ||||| || || ||||||||||||| ||| ||||||||||||||| Sbjct: 79219 ccctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagcaccacc 79278 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 79279 tggaccgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtag 79338 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| || ||||||||||||||||||||||||||||||||| Sbjct: 79339 tcgagccccccctcggagaagatctgcgcgccggccttgaac 79380
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 472 bits (238), Expect = e-130 Identities = 361/402 (89%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||| || |||||||||| |||| Sbjct: 21808837 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 21808778 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 |||||||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 21808777 tcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccgaac 21808718 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| Sbjct: 21808717 atggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcgaaggtg 21808658 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 |||||||||||||||||||| || |||||||||||||| || ||||| | |||||||| Sbjct: 21808657 tcagggtcgtcggcgaggccgagcgggtcgaaggcgccgcctgggtacaccttgtcgagg 21808598 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 ||||| ||||| || ||||| || || ||||||||||||| ||| ||||||||||||||| Sbjct: 21808597 ccctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagcaccacc 21808538 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 21808537 tggaccgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtag 21808478 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| || ||||||||||||||||||||||||||||||||| Sbjct: 21808477 tcgagccccccctcggagaagatctgcgcgccggccttgaac 21808436
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 472 bits (238), Expect = e-130 Identities = 361/402 (89%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||| || |||||||||| |||| Sbjct: 21801866 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 21801807 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 |||||||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 21801806 tcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccgaac 21801747 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| Sbjct: 21801746 atggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcgaaggtg 21801687 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 |||||||||||||||||||| || |||||||||||||| || ||||| | |||||||| Sbjct: 21801686 tcagggtcgtcggcgaggccgagcgggtcgaaggcgccgcctgggtacaccttgtcgagg 21801627 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 ||||| ||||| || ||||| || || ||||||||||||| ||| ||||||||||||||| Sbjct: 21801626 ccctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagcaccacc 21801567 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 21801566 tggaccgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtag 21801507 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| || ||||||||||||||||||||||||||||||||| Sbjct: 21801506 tcgagccccccctcggagaagatctgcgcgccggccttgaac 21801465
>dbj|AK066762.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013075I09, full insert sequence Length = 1106 Score = 472 bits (238), Expect = e-130 Identities = 361/402 (89%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||| || |||||||||| |||| Sbjct: 836 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 777 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 |||||||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 776 tcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccgaac 717 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| Sbjct: 716 atggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcgaaggtg 657 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 |||||||||||||||||||| || |||||||||||||| || ||||| | |||||||| Sbjct: 656 tcagggtcgtcggcgaggccgagcgggtcgaaggcgccgcctgggtacaccttgtcgagg 597 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 ||||| ||||| || ||||| || || ||||||||||||| ||| ||||||||||||||| Sbjct: 596 ccctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagcaccacc 537 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 536 tggaccgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtag 477 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| || ||||||||||||||||||||||||||||||||| Sbjct: 476 tcgagccccccctcggagaagatctgcgcgccggccttgaac 435
>dbj|AK058315.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-A06, full insert sequence Length = 685 Score = 472 bits (238), Expect = e-130 Identities = 361/402 (89%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||| || |||||||||| |||| Sbjct: 411 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 352 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 |||||||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 351 tcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccgaac 292 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| Sbjct: 291 atggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcgaaggtg 232 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 |||||||||||||||||||| || |||||||||||||| || ||||| | |||||||| Sbjct: 231 tcagggtcgtcggcgaggccgagcgggtcgaaggcgccgcctgggtacaccttgtcgagg 172 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 ||||| ||||| || ||||| || || ||||||||||||| ||| ||||||||||||||| Sbjct: 171 ccctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagcaccacc 112 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 111 tggaccgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtag 52 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| || ||||||||||||||||||||||||||||||||| Sbjct: 51 tcgagccccccctcggagaagatctgcgcgccggccttgaac 10
>gb|AF061577.1|AF061577 Oryza sativa chlorophyll a/b binding protein (RCABP89) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 464 bits (234), Expect = e-127 Identities = 360/402 (89%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||| || |||||||||| |||| Sbjct: 825 ccggggacgaagttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 766 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 |||||||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 765 tcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaagccgaac 706 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| Sbjct: 705 atggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcgaaggtg 646 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 |||||||||||||||||||| || |||||||||||||| | ||||| | |||||||| Sbjct: 645 tcagggtcgtcggcgaggccgagcgggtcgaaggcgccgcttgggtacaccttgtcgagg 586 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 ||||| ||||| || ||||| || || ||||||||||||| ||| ||||||||||||||| Sbjct: 585 ccctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagcaccacc 526 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 525 tggaccgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtag 466 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| || ||||||||||||||||||||||||||||||||| Sbjct: 465 tcgagccccccctcggagaagatctgcgcgccggccttgaac 424
>gb|AY112240.1| Zea mays CL187_6 mRNA sequence Length = 770 Score = 456 bits (230), Expect = e-125 Identities = 359/402 (89%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| ||||||| |||||| | ||||| ||||||||| || |||||||||| |||| Sbjct: 469 ccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 410 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 |||||||||||||| | || ||||| ||||||||||||||||||||||||||||||||| Sbjct: 409 tcgaagaggttctcgatggggcccttgccggtgacgatggcctgcacgaagaagccgaac 350 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| ||| Sbjct: 349 atggagaacatggcaaggcggccgttcttgagctccttcaccttgagctcggcggcggtg 290 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || |||||||||||||| || ||||| | ||||||| Sbjct: 289 tccgggtcgtcggcgaggcccagcgggtcgaaggcgccgccggggtacaccttgtcgagc 230 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 || || ||||| || ||||| || || ||||||||||||| ||||||||||||||||||| Sbjct: 229 ccttccccgagcgggccgccgccgacgcggtagccctcgacgaagcccatgagcaccacc 170 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||||||| ||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 169 tggcacgcccagatggccaggatgctctgtgcgtgcaccaggttggggttccccaggtag 110 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 || || |||||||| ||||||||||||||||||||||||||| Sbjct: 109 tccagcccgccctccgagaagatctgcgcgccggccttgaac 68
>dbj|D00642.1|RICLHCP2 Oryza sativa (japonica cultivar-group) mRNA for type II light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 989 Score = 448 bits (226), Expect = e-123 Identities = 358/402 (89%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | | ||| ||||||||| || ||||||| || |||| Sbjct: 817 ccggggacgaagttggtggcgtatgaccaggcgttgttggcgacggggtcggtgacgtgg 758 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 |||||||||||||| | || ||||| ||||||||||||||||| |||||||| |||||| Sbjct: 757 tcgaagaggttctcgatggggcccttgccggtgacgatggcctggacgaagaatccgaac 698 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||| Sbjct: 697 atggagaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcgaaggtg 638 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 |||||||||||||||||||| || |||||||||||||| || ||||| | |||||||| Sbjct: 637 tcagggtcgtcggcgaggccgagcgggtcgaaggcgccgcctgggtacaccttgtcgagg 578 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 ||||| ||||| || ||||| || || ||||||||||||| ||| ||||||||||||||| Sbjct: 577 ccctcgccgagcgggccgccgccgacgcggtagccctcgacgaatcccatgagcaccacc 518 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||| Sbjct: 517 tggaccgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttccccaggtag 458 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| || ||||||||||||||||||||||||||||||||| Sbjct: 457 tcgagccccccctcggagaagatctgcgcgccggccttgaac 416
>emb|X68682.1|ZMLHCB Z.mays mRNA for type II light-harvesting chlorophyll a/b-binding protein Length = 1126 Score = 424 bits (214), Expect = e-115 Identities = 355/402 (88%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| ||||||| |||||| | ||||| ||||||||| || |||||||||| |||| Sbjct: 821 ccggggacgaagttcgtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtgg 762 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 |||||||||||||| | || ||||| ||||||||||||||||||||||||||||||||| Sbjct: 761 tcgaagaggttctcgatggggcccttgccggtgacgatggcctgcacgaagaagccgaac 702 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| ||| Sbjct: 701 atggagaacatggcaaggcggccgttcttgagctccttcaccttgagctcggcggcggtg 642 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || || |||||||| || || ||||| | ||||||| Sbjct: 641 tccgggtcgtcggcgaggcccagcggttcgaaggcaccgccggggtacaccttgtcgagc 582 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 || || ||||| || || || || || | ||||||||||| ||||||||||||||||||| Sbjct: 581 ccttccccgagcgggcctccgccgacgccgtagccctcgacgaagcccatgagcaccacc 522 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||||||| ||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 521 tggcacgcccagatggccaggatgctctgtgcgtgcaccaggttggggttccccaggtag 462 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 || || |||||||| ||||||||||||||||||||||||||| Sbjct: 461 tccagcccgccctccgagaagatctgcgcgccggccttgaac 420
>gb|AF079590.1|AF079590 Sorghum bicolor photosystem II type II chlorophyll a/b binding protein (CABII) mRNA, partial cds Length = 714 Score = 416 bits (210), Expect = e-113 Identities = 354/402 (88%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||| || ||||| |||| ||| Sbjct: 571 ccggggacgaagttggtggcgtaagcccaggcgttgttggcgacggggtcagcgacatgg 512 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 |||||||||||||| | |||||||| ||||||||||||||||| |||||||| || ||| Sbjct: 511 tcgaagaggttctcgatgggtcccttgccggtgacgatggcctggacgaagaacccaaac 452 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| ||| Sbjct: 451 atggagaacatggcgaggcggccgttcttgagctccttcaccttgagctccgcggcggtg 392 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||| |||||||| || || |||||||| ||||| || ||||||| ||||||| Sbjct: 391 tcggggtcatcggcgagcccgagcgggtcgaacgcgccgccggggtagaccttgtcgagc 332 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 || || ||||| || ||||| || || ||||||||||||| ||||||||||||||| ||| Sbjct: 331 ccttccccgagcgggccgccgccgacgcggtagccctcgacgaagcccatgagcacgacc 272 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||||||| |||||||||||||||||||||||||| ||||||||||||||| Sbjct: 271 tggcacgcccagatggccaggatgctctgcgcgtgcaccaggttcgggttgcccaggtag 212 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 || || |||||||| ||||||||||||||||||||||||||| Sbjct: 211 tccagcccgccctccgagaagatctgcgcgccggccttgaac 170
>gb|BC053854.1| Homo sapiens cDNA clone IMAGE:5194336, partial cds Length = 1044 Score = 355 bits (179), Expect = 1e-94 Identities = 341/395 (86%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 |||||||||||||||||||||| ||||||||||| || ||||||| || ||||||| || Sbjct: 850 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggagaggtggtcggcga 791 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 ||||||| | || ||||| |||||||||||||||||||||||||||||||||||||||| Sbjct: 790 ggttctcgagggggcccttgccggtgacgatggcctgcacgaagaagccgaacatggaga 731 Query: 320 acatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggt 379 |||||||||||||||||||||||| |||||| ||||||||||| ||| | ||||||| Sbjct: 730 acatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcctcagggt 671 Query: 380 cgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcac 439 ||||||| ||||| || ||||||||| ||| || ||||||| ||||| | ||| | Sbjct: 670 cgtcggcaaggcccagggggtcgaagctgccgccggggtagagcgggtcgacgatctcgc 611 Query: 440 cgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggcatg 499 |||| || ||||| | || ||||| ||||||| | |||||||||||| |||||||| | Sbjct: 610 cgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagcacgacctggcagg 551 Query: 500 cccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggc 559 |||||||||||||||||||||||||||| |||||| |||||||||| ||||||||||||| Sbjct: 550 cccagatggcgaggatgctctgcgcgtggaccaggctggggttgccgaggtagtcgaggc 491 Query: 560 cgccctcggagaagatctgcgcgccggccttgaac 594 |||||||| ||||||||| | ||||||||||||| Sbjct: 490 cgccctcgctgaagatctgggagccggccttgaac 456
>gb|M12152.1|LGIAB19A Lemna gibba chlorophyll a/b apoprotein gene, complete cds Length = 1913 Score = 353 bits (178), Expect = 4e-94 Identities = 346/402 (86%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||||||||||| ||||||||| || ||||||||||||||| Sbjct: 1527 ccggggacgaagttggtggcgaaggcccaggcgttgttggcgacggggtcggcgatgtgg 1468 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| |||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 1467 tcggccaggttctcgatggggcccttgccggtgacgatggcctgaacgaagaagccgaac 1408 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||| || || |||||||||| |||||| ||||| ||||| ||| | Sbjct: 1407 atggagaacatggccagccgcccgttcttgatctccttcaccttcagctccgcgaaggcc 1348 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||| || || || ||||||||||| || || ||||||| |||||| Sbjct: 1347 tcggggtcgtcggccagccccagcgggtcgaaggccccgccggggtagagcgggtcgagc 1288 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 ||||| || || || ||||| || || |||||||||||||| | |||||||||||||||| Sbjct: 1287 ccctcccccagcggcccgccgcccacgcggtagccctcgatcaggcccatgagcaccacc 1228 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 || ||||||||||||||||||||||||||||| |||||||||||||||||||||||| Sbjct: 1227 tgcgtggcccagatggcgaggatgctctgcgcgtggaccaggttggggttgcccaggtag 1168 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 |||||||||||||||||||||||||| ||||| ||||||||| Sbjct: 1167 tcgaggccgccctcggagaagatctgggcgcccgccttgaac 1126
>emb|X14794.1|ZMCAB1 Maize cab-1 gene for chlorophyll a/b-binding protein Length = 2100 Score = 337 bits (170), Expect = 2e-89 Identities = 344/402 (85%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| |||||||| ||||||||| Sbjct: 1673 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgactgggtcagcgatgtgg 1614 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 || ||||||||| | ||| ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 1613 tcagcgaggttctcgagcgggcccttgccggtgacgatggcctggacgaagaagccgaac 1554 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||| |||||||||||||||||||||||||||||||| ||||||||||||||| | Sbjct: 1553 atggaaaacatggcgaggcggccgttcttgagctccttcaccttgagctcggcgaaggcc 1494 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||| ||||| || ||||||||| ||| || ||||| | ||||| | Sbjct: 1493 tcggggtcgtcggccaggccgagggggtcgaagctgccgccagggtacagcgggtcgacg 1434 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| ||| ||||||||||||| | ||||||||||| ||| Sbjct: 1433 acctcgccgagcggcccgccggcaatgcggtagccctcgacggcacccatgagcacgacc 1374 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||||||||||||||||||||||||| | |||| |||||||||| |||||| Sbjct: 1373 tggcaggcccagatggcgaggatgctctgcgcgtggatcaggctggggttgccgaggtag 1314 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 || || ||||||||| ||||||||| | ||||||||||||| Sbjct: 1313 tccagcccgccctcgctgaagatctgggagccggccttgaac 1272
>emb|X13909.1|OSCABR2 Rice cab2R gene for light harvesting chlorophyll a/b-binding protein Length = 1442 Score = 329 bits (166), Expect = 6e-87 Identities = 343/402 (85%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 1279 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 1220 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 1219 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 1160 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 1159 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaaggcc 1100 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||| ||||||||||| || |||||||||||||| |||||||||| ||||| | Sbjct: 1099 tccgggtcatcggcgaggccgagcgggtcgaaggcgccgcccgggtagagcgggtcgacg 1040 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| ||| ||||| ||||||| | |||||||||||||||| Sbjct: 1039 acctcgccgagcggcccgccggcaatccggtacccctcgacggcgcccatgagcaccacc 980 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 || ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 979 tgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 920 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| || ||||||||| Sbjct: 919 tcgagcccgccctcgctgaagatctgcgaccccgccttgaac 878
>emb|X13908.1|OSCABR1 Rice cab1R gene for light harvesting chlorophyll a/b-binding protein Length = 1664 Score = 321 bits (162), Expect = 1e-84 Identities = 342/402 (85%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 1240 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 1181 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 1180 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 1121 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| || ||| ||||||||||| ||| | Sbjct: 1120 atggagaacatggcgaggcggccgttcttgatcttcttcaccttgagctccgcgcacgcc 1061 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||| ||||||||||| || |||||||||||||| || ||||| | ||||| | Sbjct: 1060 tcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtacagcgggtcgacg 1001 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || |||||| ||| ||||| ||||||| | |||||||||||||||| Sbjct: 1000 acctcgccgagcggcccgccagcaatccggtacccctcgacggcgcccatgagcaccacc 941 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 || ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 940 tgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 881 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| ||| ||||||||| Sbjct: 880 tcgagcccgccctcgctgaagatctgcgagcccgccttgaac 839
>ref|NM_192636.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 789 Score = 313 bits (158), Expect = 4e-82 Identities = 341/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 779 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 720 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 719 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 660 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 659 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaaggcc 600 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || ||||||| ||||| | Sbjct: 599 tccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggtcgacg 540 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 539 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 480 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 479 tggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 420 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| || ||||||||| Sbjct: 419 tcgagcccgccctcgctgaagatctgcgaccccgccttgaac 378
>dbj|AP008215.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, complete sequence Length = 22696651 Score = 313 bits (158), Expect = 4e-82 Identities = 341/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| |||| Sbjct: 10793775 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 10793716 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 10793715 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 10793656 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 10793655 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcc 10793596 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||| ||||||||||| || |||||||||||||| || ||||||| ||||| | Sbjct: 10793595 tcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggtcgacg 10793536 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 10793535 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 10793476 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 || ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 10793475 tgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 10793416 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| ||| ||||||||| Sbjct: 10793415 tcgagcccgccctcgctgaagatctgcgagcccgccttgaac 10793374
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 313 bits (158), Expect = 4e-82 Identities = 341/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 23604322 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 23604263 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 23604262 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 23604203 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 23604202 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaaggcc 23604143 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || ||||||| ||||| | Sbjct: 23604142 tccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggtcgacg 23604083 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 23604082 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 23604023 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 23604022 tggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 23603963 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| || ||||||||| Sbjct: 23603962 tcgagcccgccctcgctgaagatctgcgaccccgccttgaac 23603921 Score = 289 bits (146), Expect = 5e-75 Identities = 326/386 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 30025128 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 30025069 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| |||||||| | || ||||| ||||||||||||||||| |||||||| |||||| Sbjct: 30025068 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccgaac 30025009 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| | Sbjct: 30025008 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcgaacgcc 30024949 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || ||||||| ||||| | Sbjct: 30024948 tcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggtcgacg 30024889 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | || ||||| ||||||| | |||||||||||| ||| Sbjct: 30024888 acctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagcacgacc 30024829 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||| || ||||||||||||||||| | |||| |||||||||| |||||| Sbjct: 30024828 tggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccgaggtag 30024769 Query: 553 tcgaggccgccctcggagaagatctg 578 ||||| || |||||| ||||||||| Sbjct: 30024768 tcgagccccccctcgctgaagatctg 30024743
>dbj|AP005313.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, PAC clone:P0512H04 Length = 151049 Score = 313 bits (158), Expect = 4e-82 Identities = 341/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| |||| Sbjct: 17498 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 17439 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 17438 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 17379 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 17378 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcc 17319 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||| ||||||||||| || |||||||||||||| || ||||||| ||||| | Sbjct: 17318 tcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggtcgacg 17259 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 17258 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 17199 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 || ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 17198 tgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 17139 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| ||| ||||||||| Sbjct: 17138 tcgagcccgccctcgctgaagatctgcgagcccgccttgaac 17097
>dbj|AP003278.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0518F01 Length = 154541 Score = 313 bits (158), Expect = 4e-82 Identities = 341/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 67021 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 66962 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 66961 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 66902 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 66901 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaaggcc 66842 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || ||||||| ||||| | Sbjct: 66841 tccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggtcgacg 66782 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 66781 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 66722 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 66721 tggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 66662 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| || ||||||||| Sbjct: 66661 tcgagcccgccctcgctgaagatctgcgaccccgccttgaac 66620
>dbj|AP005700.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 9, BAC clone:OSJNBb0085I16 Length = 141701 Score = 313 bits (158), Expect = 4e-82 Identities = 341/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| |||| Sbjct: 130393 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 130334 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 130333 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 130274 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 130273 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcc 130214 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||| ||||||||||| || |||||||||||||| || ||||||| ||||| | Sbjct: 130213 tcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggtcgacg 130154 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 130153 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 130094 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 || ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 130093 tgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 130034 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| ||| ||||||||| Sbjct: 130033 tcgagcccgccctcgctgaagatctgcgagcccgccttgaac 129992
>dbj|AK121563.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033034J10, full insert sequence Length = 1180 Score = 313 bits (158), Expect = 4e-82 Identities = 341/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 850 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 791 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 790 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 731 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 730 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaaggcc 671 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || ||||||| ||||| | Sbjct: 670 tccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggtcgacg 611 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 610 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 551 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 550 tggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 491 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| || ||||||||| Sbjct: 490 tcgagcccgccctcgctgaagatctgcgaccccgccttgaac 449
>dbj|AK119173.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-037-B06, full insert sequence Length = 1126 Score = 313 bits (158), Expect = 4e-82 Identities = 341/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 849 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 790 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 789 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 730 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 729 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaaggcc 670 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || ||||||| ||||| | Sbjct: 669 tccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggtcgacg 610 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 609 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 550 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 549 tggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 490 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| || ||||||||| Sbjct: 489 tcgagcccgccctcgctgaagatctgcgaccccgccttgaac 448
>dbj|AK104350.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-G02, full insert sequence Length = 1013 Score = 313 bits (158), Expect = 4e-82 Identities = 341/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| |||| Sbjct: 843 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 784 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 783 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 724 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 723 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcc 664 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||| ||||||||||| || |||||||||||||| || ||||||| ||||| | Sbjct: 663 tcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggtcgacg 604 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 603 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 544 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 || ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 543 tgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 484 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| ||| ||||||||| Sbjct: 483 tcgagcccgccctcgctgaagatctgcgagcccgccttgaac 442
>dbj|AK104288.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-007-E05, full insert sequence Length = 1021 Score = 313 bits (158), Expect = 4e-82 Identities = 341/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| |||| Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 789 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 788 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 729 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 728 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcc 669 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||| ||||||||||| || |||||||||||||| || ||||||| ||||| | Sbjct: 668 tcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggtcgacg 609 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 608 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 549 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 || ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 548 tgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 489 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| ||| ||||||||| Sbjct: 488 tcgagcccgccctcgctgaagatctgcgagcccgccttgaac 447
>dbj|AK104281.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-006-D01, full insert sequence Length = 1056 Score = 313 bits (158), Expect = 4e-82 Identities = 341/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| |||| Sbjct: 850 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 791 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 790 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 731 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 730 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcc 671 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||| ||||||||||| || |||||||||||||| || ||||||| ||||| | Sbjct: 670 tcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggtcgacg 611 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 610 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 551 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 || ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 550 tgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 491 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| ||| ||||||||| Sbjct: 490 tcgagcccgccctcgctgaagatctgcgagcccgccttgaac 449
>dbj|AK060851.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-034-E08, full insert sequence Length = 1235 Score = 313 bits (158), Expect = 4e-82 Identities = 341/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| |||| Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 789 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 788 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 729 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 728 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcc 669 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||| ||||||||||| || |||||||||||||| || ||||||| ||||| | Sbjct: 668 tcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggtcgacg 609 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 608 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 549 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 || ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 548 tgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 489 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| ||| ||||||||| Sbjct: 488 tcgagcccgccctcgctgaagatctgcgagcccgccttgaac 447
>dbj|AK058305.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H02, full insert sequence Length = 1045 Score = 313 bits (158), Expect = 4e-82 Identities = 341/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| |||| Sbjct: 848 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 789 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 788 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 729 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 728 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaacgcc 669 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||| ||||||||||| || |||||||||||||| || ||||||| ||||| | Sbjct: 668 tcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggtcgacg 609 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 608 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 549 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 || ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 548 tgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 489 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| ||| ||||||||| Sbjct: 488 tcgagcccgccctcgctgaagatctgcgagcccgccttgaac 447
>gb|AF022739.1|AF022739 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds Length = 1100 Score = 313 bits (158), Expect = 4e-82 Identities = 332/390 (85%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| | ||||| ||||||||| || |||||||||| ||||||||| | |||| Sbjct: 820 ttggtggcgtatgcccaggcgttgttggcgacggggtcggcgacgtggtcgaaaaagttc 761 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| |||||||| || ||||||||||||||| Sbjct: 760 tcgatggggcccttgccggtgacgatggcctggacgaagaaacccaacatggagaacatg 701 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 |||||||||||||| |||| |||||| ||||||| ||| ||| ||||||||||| || Sbjct: 700 gcgaggcggccgttattgaactccttcaccttgaactccgcgaaagtgtcagggtcctcc 641 Query: 385 gcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcaccgagg 444 || | ||| || ||||||||||||| || ||||| | ||||||||||||| ||||| Sbjct: 640 gccaagccgagatggtcgaaggcgccgcctgggtacaccttgtcgaggccctcgccgagc 581 Query: 445 ggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggcatgcccag 504 || ||||| || || ||||||||||||| ||| |||||||||||||||||| |||||| Sbjct: 580 gggccgccgccgacgcggtagccctcgacgaatcccatgagcaccacctggaccgcccag 521 Query: 505 atggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccc 564 ||||||||||||||||| | | |||||||| |||||| |||||||||||||| || ||| Sbjct: 520 atggcgaggatgctctgggggcgcaccagggcggggttccccaggtagtcgagccccccc 461 Query: 565 tcggagaagatctgcgcgccggccttgaac 594 |||||||||||||||||||||||||||||| Sbjct: 460 tcggagaagatctgcgcgccggccttgaac 431
>emb|X55892.1|ZMLHCABB Zea mays L. mRNA for light-harvesting chlorophyll a/b binding protein Length = 869 Score = 311 bits (157), Expect = 1e-81 Identities = 334/393 (84%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| ||||||| ||||||||||| || |||||||||| ||||||| |||| Sbjct: 794 aagttggtggcataggcccatgcgttgttgttgacggggtcggcgaggtggtcggcgagg 735 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||| ||||| ||||||||||||||||| |||||||| ||||||||||||||| Sbjct: 734 ttctcgagcgggcccttgccggtgacgatggcctggacgaagaacccgaacatggagaac 675 Query: 322 atggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcg 381 ||||||||||||||||||||||||||||| ||||||| || ||| | ||||||||| Sbjct: 674 atggcgaggcggccgttcttgagctccttcaccttgacgtccgcgaaggcctcagggtcg 615 Query: 382 tcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcaccg 441 ||||||||||| || |||||||| | ||| || ||||||| ||||| | |||| ||| Sbjct: 614 tcggcgaggccgagcgggtcgaacgtgccgccggggtagagcgggtcgacgacctctccg 555 Query: 442 aggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggcatgcc 501 || || ||||| | || ||||| ||||||||| |||||||||||| |||||||| ||| Sbjct: 554 agcgggccgccggcgacgcggtacccctcgatggcgcccatgagcacgacctggcaggcc 495 Query: 502 cagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccg 561 |||||||||||||||||||||||||| | |||| | |||||||| |||||||| || || Sbjct: 494 cagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtagtccagccca 435 Query: 562 ccctcggagaagatctgcgcgccggccttgaac 594 |||||| ||||||||||| |||||||||||| Sbjct: 434 ccctcgctgaagatctgcgacccggccttgaac 402
>dbj|D00641.1|RICLHCP1 Oryza sativa (japonica cultivar-group) mRNA for type I light-harvesting chlorophyll a/b binding protein of photosystem II (LHCPII), complete cds Length = 1022 Score = 305 bits (154), Expect = 9e-80 Identities = 340/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||||| || |||||||||| |||| Sbjct: 829 ccggggacgaagttggtggcgtacgcccaggcgttgttgttgacggggtcggcgaggtgg 770 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 769 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagaagccgaac 710 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||| ||||||| |||||| ||||||||||| ||| | Sbjct: 709 atggagaacatggcgaggcggcctttcttgatctccttcaccttgagctccgcgaacgcc 650 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||| ||||||||||| || |||||||||||||| || ||||||| ||||| | Sbjct: 649 tcggggtcatcggcgaggccgagcgggtcgaaggcgccgccggggtagagcgggtcgacg 590 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 589 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 530 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 || ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 529 tgcaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 470 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||| ||||||||||| ||| ||||||||| Sbjct: 469 tcgagcccgccctcgctgaagatctgcgagcccgccttgaac 428
>emb|Y00379.1|ZMLHCP Maize mRNA for light-harvesting chlorophyll a/b binding protein LHCP Length = 967 Score = 297 bits (150), Expect = 2e-77 Identities = 339/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||| |||||| Sbjct: 855 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatgtgg 796 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 || ||||||||| | ||| ||||| ||||||||||||||||| |||||||| |||||| Sbjct: 795 tcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccgaac 736 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||| ||||||||||||||||| ||||||||||||||||||||||||||| || | Sbjct: 735 atggacaacatggcgaggcggcccttcttgagctccttgaccttgagctcgccgaaggcc 676 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || ||||||| ||||| | Sbjct: 675 tcggggtcgtcggcgaggcccagcgggtcgaagctgccgccggggtagagcgggtcgacg 616 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||||||||||| | |||||||||||| ||| Sbjct: 615 acctcgccgagcgggccgccggcgatgcggtagccctcgacggcgcccatgagcacgacc 556 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||||||| ||||||||||||||||| | ||| | ||||| || |||||| Sbjct: 555 tggcaggcccagatggcaaggatgctctgcgcgtggatgaggctcgggttcccgaggtag 496 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 || || ||||||||| ||||||||| | ||||||||||||| Sbjct: 495 tccagcccgccctcgctgaagatctgggagccggccttgaac 454
>ref|NM_191799.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 289 bits (146), Expect = 5e-75 Identities = 326/386 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 791 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 732 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| |||||||| | || ||||| ||||||||||||||||| |||||||| |||||| Sbjct: 731 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccgaac 672 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| | Sbjct: 671 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcgaacgcc 612 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || ||||||| ||||| | Sbjct: 611 tcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggtcgacg 552 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | || ||||| ||||||| | |||||||||||| ||| Sbjct: 551 acctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagcacgacc 492 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||| || ||||||||||||||||| | |||| |||||||||| |||||| Sbjct: 491 tggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccgaggtag 432 Query: 553 tcgaggccgccctcggagaagatctg 578 ||||| || |||||| ||||||||| Sbjct: 431 tcgagccccccctcgctgaagatctg 406
>emb|X53398.1|ZMCABM7 Z.mays cab-m7 gene for light harvesting chlorophyll a/b binding protein Length = 2261 Score = 289 bits (146), Expect = 5e-75 Identities = 338/402 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||| |||||| Sbjct: 1803 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatgtgg 1744 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 || ||||||||| | ||| ||||| ||||||||||||||||| |||||||| |||||| Sbjct: 1743 tcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccgaac 1684 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||| |||||||||||||| ||||||||||| ||| | Sbjct: 1683 atggagaacatggcgaggcggcccttcttgagctccttcaccttgagctcagcgaaggcc 1624 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || || |||| ||||| | Sbjct: 1623 tcggggtcgtcggcgaggcccagcgggtcgaagctgccgccgggatagagcgggtcgacg 1564 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||||||||||| | |||||||||||| ||| Sbjct: 1563 acctcgccgagcgggccgccggcgatgcggtagccctcgacggcgcccatgagcacgacc 1504 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||||||||||||||||||||||||| | ||| | ||||| || |||||| Sbjct: 1503 tggcaggcccagatggcgaggatgctctgcgcgtggatgaggctcgggttcccgaggtag 1444 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 || || || |||||| ||||||||| | ||||||||||||| Sbjct: 1443 tccagtccaccctcgctgaagatctgggagccggccttgaac 1402
>gb|AY100470.1| Oryza sativa (indica cultivar-group) putative soluble starch synthase IV-1 gene, complete cds Length = 15000 Score = 289 bits (146), Expect = 5e-75 Identities = 326/386 (84%) Strand = Plus / Plus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 13883 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 13942 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| |||||||| | || ||||| ||||||||||||||||| |||||||| |||||| Sbjct: 13943 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccgaac 14002 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| | Sbjct: 14003 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcgaacgcc 14062 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || ||||||| ||||| | Sbjct: 14063 tcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggtcgacg 14122 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | || ||||| ||||||| | |||||||||||| ||| Sbjct: 14123 acctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagcacgacc 14182 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||| || ||||||||||||||||| | |||| |||||||||| |||||| Sbjct: 14183 tggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccgaggtag 14242 Query: 553 tcgaggccgccctcggagaagatctg 578 ||||| || |||||| ||||||||| Sbjct: 14243 tcgagccccccctcgctgaagatctg 14268
>dbj|AP003292.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0690B02 Length = 153116 Score = 289 bits (146), Expect = 5e-75 Identities = 326/386 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 21118 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 21059 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| |||||||| | || ||||| ||||||||||||||||| |||||||| |||||| Sbjct: 21058 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccgaac 20999 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| | Sbjct: 20998 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcgaacgcc 20939 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || ||||||| ||||| | Sbjct: 20938 tcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggtcgacg 20879 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | || ||||| ||||||| | |||||||||||| ||| Sbjct: 20878 acctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagcacgacc 20819 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||| || ||||||||||||||||| | |||| |||||||||| |||||| Sbjct: 20818 tggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccgaggtag 20759 Query: 553 tcgaggccgccctcggagaagatctg 578 ||||| || |||||| ||||||||| Sbjct: 20758 tcgagccccccctcgctgaagatctg 20733
>dbj|AK104176.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C12, full insert sequence Length = 1055 Score = 289 bits (146), Expect = 5e-75 Identities = 326/386 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 872 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 813 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| |||||||| | || ||||| ||||||||||||||||| |||||||| |||||| Sbjct: 812 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccgaac 753 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| | Sbjct: 752 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcgaacgcc 693 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || ||||||| ||||| | Sbjct: 692 tcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggtcgacg 633 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | || ||||| ||||||| | |||||||||||| ||| Sbjct: 632 acctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagcacgacc 573 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||| || ||||||||||||||||| | |||| |||||||||| |||||| Sbjct: 572 tggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccgaggtag 513 Query: 553 tcgaggccgccctcggagaagatctg 578 ||||| || |||||| ||||||||| Sbjct: 512 tcgagccccccctcgctgaagatctg 487
>dbj|AK103946.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B02, full insert sequence Length = 1055 Score = 289 bits (146), Expect = 5e-75 Identities = 326/386 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 872 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 813 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| |||||||| | || ||||| ||||||||||||||||| |||||||| |||||| Sbjct: 812 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccgaac 753 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| | Sbjct: 752 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcgaacgcc 693 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || ||||||| ||||| | Sbjct: 692 tcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggtcgacg 633 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | || ||||| ||||||| | |||||||||||| ||| Sbjct: 632 acctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagcacgacc 573 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||| || ||||||||||||||||| | |||| |||||||||| |||||| Sbjct: 572 tggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccgaggtag 513 Query: 553 tcgaggccgccctcggagaagatctg 578 ||||| || |||||| ||||||||| Sbjct: 512 tcgagccccccctcgctgaagatctg 487
>dbj|AK058289.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-E06, full insert sequence Length = 1057 Score = 289 bits (146), Expect = 5e-75 Identities = 326/386 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 874 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 815 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| |||||||| | || ||||| ||||||||||||||||| |||||||| |||||| Sbjct: 814 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccgaac 755 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| | Sbjct: 754 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcgaacgcc 695 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || ||||||| ||||| | Sbjct: 694 tcggggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggtcgacg 635 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | || ||||| ||||||| | |||||||||||| ||| Sbjct: 634 acctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagcacgacc 575 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||| || ||||||||||||||||| | |||| |||||||||| |||||| Sbjct: 574 tggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccgaggtag 515 Query: 553 tcgaggccgccctcggagaagatctg 578 ||||| || |||||| ||||||||| Sbjct: 514 tcgagccccccctcgctgaagatctg 489
>dbj|AK061619.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-033-E02, full insert sequence Length = 650 Score = 283 bits (143), Expect = 3e-73 Identities = 317/375 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 379 ccggggacgaagttggtggcgtaggcccaggcgttgttgttgacggggtcggcgaggtgg 320 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||||||||| |||||| |||||||| Sbjct: 319 tcggcgaggttctcgagggggcccttgccggtgacgatggcctggacgaagcagccgaac 260 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||||||||||||||||||| |||||| ||||||||||| ||| | Sbjct: 259 ctggagaacatggcgaggcggccgttcttgatctccttcaccttgagctccgcgaaggcc 200 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || ||||||| ||||| | Sbjct: 199 tccgggtcgtcggcgaggccgagcgggtcgaagctgccgccggggtagagcgggtcgacg 140 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | | ||||| ||||||| | |||||||||||||||| Sbjct: 139 acctcgccgagcggcccgccggcgatgcggtacccctcgacggcgcccatgagcaccacc 80 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| ||||||||||||||||||||||||||||| | |||| | |||||||| |||||| Sbjct: 79 tggaccgcccagatggcgaggatgctctgcgcgtggatcaggctcgggttgccgaggtag 20 Query: 553 tcgaggccgccctcg 567 ||||| ||||||||| Sbjct: 19 tcgagcccgccctcg 5
>dbj|AK062725.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-D08, full insert sequence Length = 1057 Score = 281 bits (142), Expect = 1e-72 Identities = 325/386 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 874 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 815 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| |||||||| | || ||||| ||||||||||||||||| |||||||| |||||| Sbjct: 814 tcggccaggttctccagtggccccttgccggtgacgatggcctggacgaagaacccgaac 755 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| | Sbjct: 754 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcgaacgcc 695 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || | ||||||| ||| || ||||||| ||||| | Sbjct: 694 tcggggtcgtcggcgaggccgagcgagtcgaagctgccgccggggtagagcgggtcgacg 635 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | || ||||| ||||||| | |||||||||||| ||| Sbjct: 634 acctcgccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgagcacgacc 575 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||| || ||||||||||||||||| | |||| |||||||||| |||||| Sbjct: 574 tggcaaccccagatcgccaggatgctctgcgcgtggatcaggctggggttgccgaggtag 515 Query: 553 tcgaggccgccctcggagaagatctg 578 ||||| || |||||| ||||||||| Sbjct: 514 tcgagccccccctcgctgaagatctg 489
>gb|AY109324.1| Zea mays CL187_1 mRNA sequence Length = 2262 Score = 276 bits (139), Expect = 8e-71 Identities = 286/335 (85%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||| |||||| Sbjct: 1803 ccggggacgaagttggtggcgtaggcccaagcgttgttgttgacggggtcggcaatgtgg 1744 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 || ||||||||| | ||| ||||| ||||||||||||||||| |||||||| |||||| Sbjct: 1743 tcagcgaggttctcgagcgggcccttcccggtgacgatggcctggacgaagaatccgaac 1684 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||| |||||||||||||| ||||||||||| ||| | Sbjct: 1683 atggagaacatggcgaggcggcccttcttgagctccttcaccttgagctcagcgaaggcc 1624 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||||||| ||| || || |||| ||||| | Sbjct: 1623 tcggggtcgtcggcgaggcccagcgggtcgaagctgccgccgggatagagcgggtcgacg 1564 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| |||||||| | | ||||||||||||| | |||||||||||| ||| Sbjct: 1563 acctcgccgagcggtccgccggcgatgcggtagccctcgacggcgcccatgagcacgacc 1504 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtg 527 ||||| ||||||||||||||||||||||||||||| Sbjct: 1503 tggcaggcccagatggcgaggatgctctgcgcgtg 1469
>gb|L23107.1|GBICABBP Ginkgo biloba nuclear-encoded chloroplast chlorophyll a/b binding protein mRNA, complete cds Length = 997 Score = 266 bits (134), Expect = 8e-68 Identities = 335/402 (83%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||||||||||| ||||||||||| || |||||||||| |||| Sbjct: 864 ccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcgaggtgg 805 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || || || ||||||||||||||||| |||||||| |||||| Sbjct: 804 tcggcgaggttctcgatggggcctttgccggtgacgatggcctggacgaagaaaccgaac 745 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||| ||||||||||||||||||||||| ||||| || |||||| | Sbjct: 744 atggagaacatggccaggcggccgttcttgagctccttaaccttcagttcggcgaaggca 685 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||| ||||| | ||||||||| |||||| || |||||| |||| Sbjct: 684 tcggggtcgtcggccaggcccaaggggtcgaagctgccacctggatagatggggtcggta 625 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 ||| ||||| || |||||| ||| ||||||||||||| | |||||||| | ||| Sbjct: 624 atctcgccgagtgggccgccagcaatgcggtagccctcgacggctcccatgaggatgacc 565 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| |||||||||||||| |||||||| ||||| | ||| | ||||||||||||||| Sbjct: 564 tggcaggcccagatggcgagaatgctctgggcgtggatgaggcttgggttgcccaggtag 505 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||||||||| ||| ||||||||| | ||| ||||||||| Sbjct: 504 tcgaggccgccgtcgctgaagatctgagagcccgccttgaac 463
>dbj|AK058312.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-H12, full insert sequence Length = 1040 Score = 240 bits (121), Expect = 4e-60 Identities = 190/213 (89%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 857 ccggggacgaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 798 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 |||| |||||||| | || ||||| ||||||||||||||||| ||||||||||||||| Sbjct: 797 tcgagcaggttctccaaggggcccttgccggtgacgatggcctggacgaagaagccgaac 738 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||||||||||||||||||||| ||||||| |||||||||||||||||||||| ||| Sbjct: 737 atggagaacatggcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtg 678 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaag 405 | ||||||||||||||||| || ||||||||| Sbjct: 677 acggggtcgtcggcgaggccgagcgggtcgaag 645 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 529 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 468 ggcgccggccttgaac 453
>gb|U73218.1|TAU73218 Triticum aestivum chlorophyll a/b-binding protein WCAB precursor (Wcab) mRNA, complete cds Length = 918 Score = 226 bits (114), Expect = 7e-56 Identities = 330/402 (82%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| | |||||||||||||| ||||| || |||||||| || ||||||||||||||| Sbjct: 803 ccggggacaaagttggtggcgaatgcccatgcattgttgttgacggggtcggcgatgtgg 744 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 || ||||||||||| || ||||| || |||||||| || || || |||||||| ||| Sbjct: 743 tcagcgaggttctcaagtgggcccttgcccgtgacgatagcttggacaaagaagccaaac 684 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 || ||||||||||| ||||| |||||||||| |||||| ||||||||||||||| || Sbjct: 683 attgagaacatggcaaggcgaccgttcttgatctccttcaccttgagctcggcgaatgcc 624 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 |||||||| ||||| | |||||| ||||||||| || || ||||||| ||| | | Sbjct: 623 tcagggtcttcggccaagccaagagggtcgaagctaccgcctgggtagagtgggtcaacg 564 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 ||||||||| || ||||| |||||||||| ||||||| | ||||||||||| ||| Sbjct: 563 atctcaccgagtgggccgccggcaacacggtacccctcgacggcacccatgagcacgacc 504 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||||||||| || || |||||||| || |||||||| ||| |||||||||| |||||| Sbjct: 503 tggcatgcccaaatagctaggatgctttgtgcgtgcactaggctggggttgccgaggtag 444 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| || ||||| |||||||| | ||||||||||||| Sbjct: 443 tcgagaccaccctcactaaagatctgggagccggccttgaac 402
>dbj|AB211497.1| Lemna paucicostata LpCAB1 mRNA for CAB homologue1, partial cds Length = 695 Score = 220 bits (111), Expect = 4e-54 Identities = 324/395 (82%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 |||||||||||||||||||||| ||||||||||| || ||||| |||| ||||||| | Sbjct: 695 cgaagttggtggcgaaggcccaggcgttgttgttgacggggtcagcgaggtggtcggcca 636 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 |||||| | |||||||| ||||| ||||||||||| |||||||| ||||||||||||| Sbjct: 635 agttctcgaggggtcccttgccggtcacgatggcctggacgaagaatccgaacatggaga 576 Query: 320 acatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggt 379 |||| || || || |||||||||| |||||| ||||| ||||| ||| | || |||| Sbjct: 575 acatcgccagccgtccgttcttgatctccttcaccttcagctccgcgaaggcttccgggt 516 Query: 380 cgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcac 439 |||| || || || || ||||||||| || |||||||| | ||||| | |||| | Sbjct: 515 cgtccgccagccccagcgggtcgaagctcccgcccgggtacagcgggtcgacgacctctc 456 Query: 440 cgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggcatg 499 |||| || ||||| | || | ||||||||||| | ||||||||| | |||||| | Sbjct: 455 cgagcggcccgcccgccactctgtagccctcgacggcgcccatgaggatgacctgggtgg 396 Query: 500 cccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggc 559 ||||||||||||||||||||||||||||||||||| ||||||| || ||||||||||| | Sbjct: 395 cccagatggcgaggatgctctgcgcgtgcaccaggctggggttcccgaggtagtcgagcc 336 Query: 560 cgccctcggagaagatctgcgcgccggccttgaac 594 |||||||| ||||||||| | ||||||||||||| Sbjct: 335 cgccctcgctgaagatctgggagccggccttgaac 301
>emb|X89023.1|HVLHCIITI H.vulgare mRNA for LHC II type I protein Length = 934 Score = 212 bits (107), Expect = 1e-51 Identities = 331/403 (82%), Gaps = 2/403 (0%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| ||||||| ||||| || ||||| ||||||||||| || ||||||||||||||| Sbjct: 812 ccggggacgaagtttgtggcaaatgcccaagcgttgttgttgacggggtcggcgatgtgg 753 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 || ||||||||||| || ||||| |||||||| |||||||| || | ||||| ||| Sbjct: 752 tcagcgaggttctcaagagggcccttgccggtgactatggcctggacaagaaagccaaac 693 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 || ||||||||||| |||||||||||||||| |||||| ||||||||| || || || Sbjct: 692 atcgagaacatggcaaggcggccgttcttgatctccttcaccttgagcgcgtcgaatg-c 634 Query: 373 tcagggtcg-tcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgag 431 | |||||| ||||| |||||||||||||| || ||||||||||||| ||||| Sbjct: 633 ttggggtcgctcggccaggccaagtgggtcaaaccttccacccgggtagagagggtcgac 574 Query: 432 gccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccac 491 | ||| ||||| || |||||| |||||||||| ||||| | |||||||||||| || Sbjct: 573 gatctcgccgagtgggccgccagcaacacggtacccctcaacagcgcccatgagcacaac 514 Query: 492 ctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggta 551 |||||| ||||| ||||| ||||||||||| || || || ||| | |||||||| ||||| Sbjct: 513 ctggcaagcccaaatggcaaggatgctctgagcatggacgaggcttgggttgccgaggta 454 Query: 552 gtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||||||| |||||| |||||| |||| ||||||||||||| Sbjct: 453 gtcgaggccaccctcgctgaagatttgcgagccggccttgaac 411
>gb|AY171229.1| Chlamydomonas reinhardtii light-harvesting complex II protein (Lhcb) mRNA, complete cds; nuclear gene for chloroplast product Length = 1024 Score = 210 bits (106), Expect = 4e-51 Identities = 270/322 (83%), Gaps = 2/322 (0%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 706 cccttgccggtcacgatggcctgaacgaagaagccgaacatggagaacatggccaggcgg 647 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 646 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 587 Query: 394 agtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcaccgaggggtccgcca 453 || |||||||| | |||||| ||||| | |||| |||||||| || ||||| ||||| Sbjct: 586 agggggtcgaacgagccaccggggtacagcttgtccaggccctcgcccagggggccgccg 527 Query: 454 ccaacacggtagccctcgatgaagcccatgagcaccacctggcatgccca-gatggcgag 512 || ||||||||||| ||| |||||| |||| ||||||| |||||| |||||| || Sbjct: 526 ttgacgcggtagccctcaatggcgcccatcagcagcacctgg-gtgcccaggatggccag 468 Query: 513 gatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaa 572 |||| ||| |||||||||||||||||||||||||||||||| || |||||||| ||| Sbjct: 467 gatggactgggcgtgcaccaggttggggttgcccaggtagtccagaccgccctcctggaa 408 Query: 573 gatctgcgcgccggccttgaac 594 |||||| || || ||||||||| Sbjct: 407 gatctgagcaccagccttgaac 386
>emb|AJ635207.1| Triticum durum ssp. durum partial mRNA for putative chlorophyll a/b binding protein (cab gene) Length = 760 Score = 210 bits (106), Expect = 4e-51 Identities = 286/346 (82%) Strand = Plus / Minus Query: 222 cgcgttgttgttcactgggtcggcgatgtggtcgaagaggttctcaaccggtccctttcc 281 |||||||||||| || |||||||| ||||||||| |||||||| | || ||||| || Sbjct: 760 cgcgttgttgttgacagggtcggcaatgtggtcggcaaggttctccaatgggcccttgcc 701 Query: 282 ggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcggccgttctt 341 |||||| ||||||||||| |||||||| |||||||||||||||||||||||||| ||||| Sbjct: 700 ggtgacaatggcctgcacaaagaagccaaacatggagaacatggcgaggcggccattctt 641 Query: 342 gagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggccaagtgggtc 401 || |||||| ||||||||||| || || || ||||||||||| |||||||||||||| Sbjct: 640 gatctccttaaccttgagctccgcaaatgcctcggggtcgtcggccaggccaagtgggtc 581 Query: 402 gaaggcgccacccgggtagatgatgtcgaggccctcaccgaggggtccgccaccaacacg 461 ||| |||||| ||||||| ||||| | ||| ||||| || || ||| ||| || Sbjct: 580 aaagctgccaccagggtagagtgggtcgacgatctcgccgagcggaccaccagcaatgcg 521 Query: 462 gtagccctcgatgaagcccatgagcaccacctggcatgcccagatggcgaggatgctctg 521 ||| ||||| | | ||||||||||| || || || ||||| ||||||||||||||||| Sbjct: 520 gtacccctcaacggcccccatgagcacaacttgacaagcccatatggcgaggatgctctg 461 Query: 522 cgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcg 567 ||||| || ||| |||||||||| |||||||||||||| |||||| Sbjct: 460 ggcgtggacgaggctggggttgccaaggtagtcgaggccaccctcg 415
>gb|U74295.1|OSU74295 Oryza sativa chlorophyll a/b binding protein (kcdl895) mRNA, complete cds Length = 1022 Score = 210 bits (106), Expect = 4e-51 Identities = 316/386 (81%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| | |||||||||||| ||||||| ||||||||||| || |||||||||| |||| Sbjct: 833 ccggggacaaagttggtggcgtaggcccatgcgttgttgttgacggggtcggcgaggtgg 774 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 || || |||||| | || ||||| ||||||||||||||||| || || || |||||| Sbjct: 773 tctgtgatgttctccagtggccccttgccggtgacgatggcctggacaaaaaacccgaac 714 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||| ||||||||||||||||||||||||| |||||| ||||||||||||||| | Sbjct: 713 atggataacatggcgaggcggccgttcttgatctccttcaccttgagctcggcgaacgcc 654 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || ||||||||||||||||| || ||||| || ||| || ||||||| ||||| Sbjct: 653 tcggggtcgtcggcgaggccgagcgggtctaaactgccgccggggtagagcgggtcgaca 594 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| ||||| || ||||| | || ||||| ||||||| | |||||||| ||| ||| Sbjct: 593 acctccccgagcgggccgccggcgacgcggtacccctcgacggcgcccatgaacacgacc 534 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| |||| || || ||||||||||||||||| | |||| |||||||||| |||||| Sbjct: 533 tggcaaccccaaatcgccaggatgctctgcgcgtggatcaggctggggttgccgaggtag 474 Query: 553 tcgaggccgccctcggagaagatctg 578 ||||| || |||||| ||||||||| Sbjct: 473 tcgagccccccctcgctgaagatctg 448
>dbj|AB051210.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-4, complete cds Length = 988 Score = 210 bits (106), Expect = 4e-51 Identities = 270/322 (83%), Gaps = 2/322 (0%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 690 cccttgccggtcacgatggcctgaacgaagaagccgaacatggagaacatggccaggcgg 631 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 630 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 571 Query: 394 agtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcaccgaggggtccgcca 453 || |||||||| | |||||| ||||| | |||| |||||||| || ||||| ||||| Sbjct: 570 agggggtcgaacgagccaccggggtacagcttgtccaggccctcgcccagggggccgccg 511 Query: 454 ccaacacggtagccctcgatgaagcccatgagcaccacctggcatgccca-gatggcgag 512 || ||||||||||| ||| |||||| |||| ||||||| |||||| |||||| || Sbjct: 510 ttgacgcggtagccctcaatggcgcccatcagcagcacctgg-gtgcccaggatggccag 452 Query: 513 gatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaa 572 |||| ||| |||||||||||||||||||||||||||||||| || |||||||| ||| Sbjct: 451 gatggactgggcgtgcaccaggttggggttgcccaggtagtccagaccgccctcctggaa 392 Query: 573 gatctgcgcgccggccttgaac 594 |||||| || || ||||||||| Sbjct: 391 gatctgagcaccagccttgaac 370
>gb|AF139467.2|AF139467 Vigna radiata LHCII type I chlorophyll a/b binding protein (CipLhcb1) mRNA, complete cds; nuclear gene for chloroplast product Length = 975 Score = 206 bits (104), Expect = 6e-50 Identities = 317/388 (81%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||| ||||||| ||||||||||| |||||||| || | || Sbjct: 845 ttccggggacgaagttggtggcgtaggcccaggcgttgttgttgactgggtcagcaaggt 786 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||| |||||||| |||||||| |||| Sbjct: 785 ggtcggcgaggttctccaatggtccctttccggtgacaatggcctggacgaagaacccga 726 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctg 370 ||| |||||||||||| | | ||||||||||| ||||||||||||||||||||| | Sbjct: 725 acacggagaacatggccaacctaccgttcttgagttccttgaccttgagctcggcgaaag 666 Query: 371 tgtcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcga 430 || |||||||| ||||| || | |||||||||| |||||| ||||| || ||| Sbjct: 665 cctctgggtcgtcagcgagacccaatgggtcgaagctgccaccggggtaagtggggtcag 606 Query: 431 ggccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcacca 490 | |||||||||| || || || ||| |||||| ||||||| | ||||||||| | | Sbjct: 605 tgacctcaccgagaggcccaccggcaatacggtaaccctcgacggcgcccatgaggatga 546 Query: 491 cctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggt 550 | ||| ||||||||||||||||||||||| ||||| | ||| | |||||||||| || Sbjct: 545 cttgggtggcccagatggcgaggatgctctgagcgtggatgaggcttgggttgcccaagt 486 Query: 551 agtcgaggccgccctcggagaagatctg 578 ||||||| || |||||| ||||||||| Sbjct: 485 agtcgagcccaccctcgctgaagatctg 458
>gb|U51632.1|PPU51632 Pinus palustris type 2 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb2) mRNA, partial cds Length = 873 Score = 204 bits (103), Expect = 2e-49 Identities = 322/395 (81%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 |||| ||||||||| ||||||| || |||||| || ||||| || | ||||||| ||| Sbjct: 727 cgaaattggtggcgtaggcccaggcattgttggcaacggggtccgccaagtggtcgtaga 668 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 | || |||| || ||||| ||||| ||||| |||||||||||||||||||||||||||| Sbjct: 667 gattttcaattgggcccttcccggtcacgattgcctgcacgaagaagccgaacatggaga 608 Query: 320 acatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggt 379 ||||||| || || |||||||| | |||||| ||||| ||||| ||| | || |||| Sbjct: 607 acatggccagccgcccgttctttatctccttcacctttagctccgcgaaagcctccgggt 548 Query: 380 cgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcac 439 ||||||| || || |||||||||||||| || || ||||| | ||| | ||||| | Sbjct: 547 cgtcggccagtcccagtgggtcgaaggcaccccctgggtacagagggtccaacccctccc 488 Query: 440 cgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggcatg 499 | |||||||| || || || | ||| || || || || ||||||||||| |||||||| | Sbjct: 487 caaggggtcctcctcccactctgtatccttcaatcaatcccatgagcacaacctggcagg 428 Query: 500 cccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggc 559 ||||||||||||| |||||||| ||||| | ||| |||||||| |||||||||||||||| Sbjct: 427 cccagatggcgagtatgctctgtgcgtgaatcagattggggttccccaggtagtcgaggc 368 Query: 560 cgccctcggagaagatctgcgcgccggccttgaac 594 | ||||| ||||| ||||| || |||||||||||| Sbjct: 367 ctccctctgagaatatctgagccccggccttgaac 333
>emb|X63205.1|ZMCAB48 Zea mays cab48 gene for chlorophyll a/b binding protein precursor Length = 2780 Score = 202 bits (102), Expect = 9e-49 Identities = 156/174 (89%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||||| || ||||||| || |||| Sbjct: 2714 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggtgaggtgg 2655 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | || ||||| ||||||||||| ||||||||||||||||||||| Sbjct: 2654 tcggcgaggttctcgatggggcccttgccggtgacgatagcctgcacgaagaagccgaac 2595 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcg 366 ||||||||||||||||||||||||||||||| |||||| ||||||||||||||| Sbjct: 2594 atggagaacatggcgaggcggccgttcttgatctccttcaccttgagctcggcg 2541 Score = 81.8 bits (41), Expect = 2e-12 Identities = 62/69 (89%) Strand = Plus / Minus Query: 477 gcccatgagcaccacctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggtt 536 ||||||||||||||||||||| |||||||| || ||||||||||||||||| || ||| | Sbjct: 2430 gcccatgagcaccacctggcacgcccagatagccaggatgctctgcgcgtggacaaggct 2371 Query: 537 ggggttgcc 545 |||||||| Sbjct: 2370 cgggttgcc 2362
>ref|XM_478729.1| Oryza sativa (japonica cultivar-group), mRNA Length = 972 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 757 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 756 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 697 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 696 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 637 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 636 gcgaggccgagcgggtcgaag 616 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 558 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 500 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 499 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 440 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 439 ggcgccggccttgaac 424
>ref|XM_507374.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 995 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 780 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 721 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 720 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 661 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 660 gcgaggccgagcgggtcgaag 640 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 582 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 524 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 523 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 464 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 463 ggcgccggccttgaac 448
>ref|XM_507373.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1007 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 780 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 721 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 720 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 661 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 660 gcgaggccgagcgggtcgaag 640 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 582 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 524 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 523 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 464 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 463 ggcgccggccttgaac 448
>ref|XM_507372.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1108 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 842 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 783 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 782 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 723 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 722 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 663 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 662 gcgaggccgagcgggtcgaag 642 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 584 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 526 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 525 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 466 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 465 ggcgccggccttgaac 450
>ref|XM_507371.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1000 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 726 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 725 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 666 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 665 gcgaggccgagcgggtcgaag 645 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 529 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 468 ggcgccggccttgaac 453
>ref|XM_507370.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1012 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 726 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 725 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 666 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 665 gcgaggccgagcgggtcgaag 645 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 529 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 468 ggcgccggccttgaac 453
>ref|XM_507369.1| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1032 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 788 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 787 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 728 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 727 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 668 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 667 gcgaggccgagcgggtcgaag 647 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 589 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 531 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 530 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 471 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 470 ggcgccggccttgaac 455
>ref|XM_506410.2| PREDICTED Oryza sativa (japonica cultivar-group), P0406F06.33 mRNA Length = 1159 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 880 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 821 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 820 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 761 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 760 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 701 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 700 gcgaggccgagcgggtcgaag 680 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 622 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 564 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 563 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 504 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 503 ggcgccggccttgaac 488
>gb|DQ122900.1| Chlamydomonas incerta chloroplast light-harvesting chlorophyll-a/b binding protein (LhcII-1.3) mRNA, complete cds; nuclear gene for chloroplast product Length = 1100 Score = 200 bits (101), Expect = 4e-48 Identities = 266/321 (82%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 698 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccaggcgg 639 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 638 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 579 Query: 394 agtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcaccgaggggtccgcca 453 || |||||||| | | || ||||| | | ||| |||||||| ||| ||| ||||| Sbjct: 578 agggggtcgaacgactcgccggggtacagggggtccaggccctcgccggcggggccgccg 519 Query: 454 ccaacacggtagccctcgatgaagcccatgagcaccacctggcatgcccagatggcgagg 513 || ||||||||||| | | |||||| || | ||||||||| ||| | |||||| | Sbjct: 518 ttgacgcggtagccctccaccaggcccatcaggatcacctggcaggccagggtggcgacg 459 Query: 514 atgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaag 573 ||| |||| ||||||||||| |||||||||||||||||| |||||||||||||||||| Sbjct: 458 atgttctgggcgtgcaccagagaggggttgcccaggtagtccaggccgccctcggagaag 399 Query: 574 atctgcgcgccggccttgaac 594 ||||| ||||||||||||||| Sbjct: 398 atctgggcgccggccttgaac 378 Score = 40.1 bits (20), Expect = 8.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 195 gggggcgaagttggtggcgaaggcccacgcgttgtt 230 ||||| ||| |||||||||||||| |||||||||| Sbjct: 777 gggggtgaacttggtggcgaaggcgaacgcgttgtt 742
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 22434853 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 22434794 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 22434793 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 22434734 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 22434733 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 22434674 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 22434673 gcgaggccgagcgggtcgaag 22434653 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 22434595 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 22434537 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 22434536 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 22434477 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 22434476 ggcgccggccttgaac 22434461
>dbj|AP004270.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0406F06 Length = 144533 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 95920 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 95861 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 95860 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 95801 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 95800 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 95741 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 95740 gcgaggccgagcgggtcgaag 95720 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 95662 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 95604 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 95603 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 95544 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 95543 ggcgccggccttgaac 95528
>dbj|AK119545.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-206-G05, full insert sequence Length = 1012 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 726 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 725 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 666 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 665 gcgaggccgagcgggtcgaag 645 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 529 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 468 ggcgccggccttgaac 453
>dbj|AK119533.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-203-F03, full insert sequence Length = 1000 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 726 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 725 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 666 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 665 gcgaggccgagcgggtcgaag 645 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 529 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 468 ggcgccggccttgaac 453
>dbj|AK104495.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-302-C03, full insert sequence Length = 973 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 816 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 757 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 756 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 697 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 696 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 637 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 636 gcgaggccgagcgggtcgaag 616 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 558 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 500 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 499 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 440 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 439 ggcgccggccttgaac 424
>dbj|AK104465.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C07, full insert sequence Length = 1012 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 726 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 725 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 666 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 665 gcgaggccgagcgggtcgaag 645 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 529 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 468 ggcgccggccttgaac 453
>dbj|AK104224.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-306-E11, full insert sequence Length = 995 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 780 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 721 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 720 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 661 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 660 gcgaggccgagcgggtcgaag 640 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 582 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 524 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 523 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 464 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 463 ggcgccggccttgaac 448
>dbj|AK103999.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-019-D10, full insert sequence Length = 1007 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 840 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 781 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 780 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 721 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 720 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 661 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 660 gcgaggccgagcgggtcgaag 640 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 582 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 524 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 523 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 464 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 463 ggcgccggccttgaac 448
>dbj|AK103926.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-D02, full insert sequence Length = 1000 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 726 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 725 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 666 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 665 gcgaggccgagcgggtcgaag 645 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 529 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 468 ggcgccggccttgaac 453
>dbj|AK061512.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-309-G12, full insert sequence Length = 1032 Score = 200 bits (101), Expect = 4e-48 Identities = 176/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 847 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 788 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 787 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 728 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 727 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 668 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 667 gcgaggccgagcgggtcgaag 647 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 589 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 531 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 530 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 471 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 470 ggcgccggccttgaac 455
>dbj|AK109399.2| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C08, full insert sequence Length = 1111 Score = 192 bits (97), Expect = 9e-46 Identities = 175/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 845 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 786 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||||||| ||||||||||||||||||||||||||| Sbjct: 785 tccaaggggcccttgccggtgacgatggcctggacgaagaagccgaacatggagaacatg 726 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| ||||||||||||||||| |||| ||| | ||||||||| Sbjct: 725 gcgaggcggccattcttgatctccttgaccttgagcttggcgaaggtgacggggtcgtcg 666 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 665 gcgaggccgagcgggtcgaag 645 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 587 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 529 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 528 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 469 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 468 ggcgccggccttgaac 453
>dbj|AK068972.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023001G03, full insert sequence Length = 1107 Score = 192 bits (97), Expect = 9e-46 Identities = 175/201 (87%) Strand = Plus / Minus Query: 205 ttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttc 264 ||||||||| || |||| ||||||||| || |||||||||| |||||||| |||||| Sbjct: 841 ttggtggcgtagacccaggcgttgttggcgacggggtcggcgaggtggtcgagcaggttc 782 Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 || | || ||||| ||||||||||||| ||| ||||||||||||||||||||||||||| Sbjct: 781 tccaaggggcccttgccggtgacgatggtctggacgaagaagccgaacatggagaacatg 722 Query: 325 gcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcg 384 ||||||||||| ||||||| |||||||||||||||||||||| ||| | ||||||||| Sbjct: 721 gcgaggcggccattcttgatctccttgaccttgagctcggcgaaggtgacggggtcgtcg 662 Query: 385 gcgaggccaagtgggtcgaag 405 |||||||| || ||||||||| Sbjct: 661 gcgaggccgagcgggtcgaag 641 Score = 159 bits (80), Expect = 1e-35 Identities = 124/136 (91%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||||| || ||||||||| || |||||| || ||||| | |||||||||||| Sbjct: 583 cggtagccctcgacgaggcccatgaggacgacctggaat-cccagcacggcgaggatgct 525 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| ||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| Sbjct: 524 ctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtcggagaagatctg 465 Query: 579 cgcgccggccttgaac 594 ||||||||||||||| Sbjct: 464 ggcgccggccttgaac 449
>emb|X61915.1|PTCABP P.thunbergii cab gene Length = 5419 Score = 188 bits (95), Expect = 1e-44 Identities = 320/395 (81%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 |||| ||||||||| ||||||| || |||||| || ||||| || | ||||||| ||| Sbjct: 3055 cgaaattggtggcgtaggcccaggcattgttggcaacggggtccgccaagtggtcgtaga 2996 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 | || |||| || ||||| ||||| ||||| ||||| |||||||| ||||||||||||| Sbjct: 2995 gattttcaatggggcccttcccggtcacgattgcctgaacgaagaaaccgaacatggaga 2936 Query: 320 acatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggt 379 ||||||| || || |||||||| | |||||| ||||| ||||| ||| | || |||| Sbjct: 2935 acatggccagccgaccgttcttaatctccttcaccttcagctccgcgaaggcctcggggt 2876 Query: 380 cgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcac 439 ||||||| || || |||||||||||||| || || ||||| | ||| | ||||| | Sbjct: 2875 cgtcggccagccccagtgggtcgaaggcaccccctgggtacagagggtccaacccctctc 2816 Query: 440 cgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggcatg 499 | |||||||| || || || | ||| || || || || |||||||| || |||||||| | Sbjct: 2815 caaggggtcctcctcccactctgtatccttcaatcaatcccatgagaacaacctggcagg 2756 Query: 500 cccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggc 559 |||||||||| || |||||||||||||| | |||||||||||| ||||||||||| |||| Sbjct: 2755 cccagatggctagaatgctctgcgcgtggatcaggttggggttccccaggtagtcaaggc 2696 Query: 560 cgccctcggagaagatctgcgcgccggccttgaac 594 | ||||| ||||| |||||||| |||||||||||| Sbjct: 2695 ctccctctgagaatatctgcgccccggccttgaac 2661
>gb|AY389597.1| Hyacinthus orientalis chloroplast chlorophyll a/b-binding protein mRNA, partial cds Length = 575 Score = 186 bits (94), Expect = 6e-44 Identities = 325/402 (80%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| | ||||||||||| || ||||| || |||||||| || |||||||||| ||| Sbjct: 465 ccggggacaaagttggtggcaaaagcccaggcattgttgttgacggggtcggcgaggtga 406 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| | |||||| | || ||||| ||||| ||||| ||||| ||||||||||||||| Sbjct: 405 tcggccaagttctccaatggccccttgccggtcacgatcgcctggacgaagaagccgaac 346 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||| |||||||| || | ||| ||||||| |||||| ||||| ||||||||| | Sbjct: 345 atggataacatggccagcctgccattcttgatctccttcaccttcagctcggcgaaggcc 286 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || |||||||||||||||||||| ||||||||| ||| || ||||| | | ||||| Sbjct: 285 tcggggtcgtcggcgaggccaagcgggtcgaagctgccgccggggtaaagggggtcgacc 226 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| |||||||| || || |||| | ||| ||||||| | |||||||| | ||| Sbjct: 225 acctcgccgaggggcccaccggcaaccctgtatccctcgacggcccccatgagaaggacc 166 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| ||||||||||| ||||||||||||||||| || ||| ||||||||||||||||| Sbjct: 165 tgggtggcccagatggccaggatgctctgcgcgtggacgaggctggggttgcccaggtag 106 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 || | ||||||||| ||||||||| || |||||||||||| Sbjct: 105 tccaatccgccctcgctgaagatctgggctccggccttgaac 64
>gb|M10144.1|WHTCAB Wheat major chlorophyll a/b-binding protein gene, complete cds Length = 1191 Score = 182 bits (92), Expect = 9e-43 Identities = 322/396 (81%), Gaps = 2/396 (0%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 ||||||||||||| | | ||||||||||||||| || |||||||| ||||||||| | Sbjct: 987 cgaagttggtggcaatgagccacgcgttgttgttgacagggtcggcaatgtggtcggcaa 928 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 ||| ||| | || ||||| |||||||| ||||||||||| |||||||| |||||||||| Sbjct: 927 ggtcctccaatgggcccttgccggtgacaatggcctgcacaaagaagccaaacatggaga 868 Query: 320 acatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggt 379 |||||||||||||||| ||||||| |||||| ||||||||||| || || | |||| Sbjct: 867 acatggcgaggcggccattcttgatctccttaaccttgagctccgcaaatgcctg-gggt 809 Query: 380 cg-tcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctca 438 || ||||| |||||||||||||| ||| |||||| ||||||| ||||| | ||| Sbjct: 808 cgctcggccaggccaagtgggtcaaagctgccaccagggtagagtgggtcgacgatctcg 749 Query: 439 ccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggcat 498 ||||| || || ||| ||| ||||| ||||| | | ||||||||||| || || || Sbjct: 748 ccgagcggaccaccagcaatgcggtacccctcaacggcccccatgagcacaacttgacaa 689 Query: 499 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgagg 558 ||||| |||||||||| |||||| ||||| || ||| |||||||||| |||||||||||| Sbjct: 688 gcccatatggcgaggaggctctgggcgtggacgaggctggggttgccaaggtagtcgagg 629 Query: 559 ccgccctcggagaagatctgcgcgccggccttgaac 594 || || ||| ||||||||| | ||| ||||||||| Sbjct: 628 ccaccatcgctgaagatctgagagccagccttgaac 593 Score = 79.8 bits (40), Expect = 9e-12 Identities = 66/72 (91%), Gaps = 2/72 (2%) Strand = Plus / Plus Query: 279 tccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcggccgtt 338 ||||||||| ||||||||||| |||||||| |||||||||||||||||||||||||| || Sbjct: 1107 tccggtgacaatggcctgcac-aagaagcc-aacatggagaacatggcgaggcggccatt 1164 Query: 339 cttgagctcctt 350 |||| |||||| Sbjct: 1165 attgatctcctt 1176
>gb|S73603.1| Pinus thunbergii chlorophyll a/b-binding protein (LHCPII) mRNA, complete cds Length = 998 Score = 178 bits (90), Expect = 1e-41 Identities = 324/402 (80%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || ||||| || | ||| Sbjct: 857 ccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccaggtga 798 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 || ||||||||| | ||||| || |||||||| ||||||||||||||||| |||||| Sbjct: 797 tcagtgaggttctcgatgggtcctttcccggtgacaatggcctgcacgaagaatccgaac 738 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||| |||||||| | || |||||||||| |||||| ||||| ||||| ||| | | Sbjct: 737 atggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcg 678 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 ||||||||||| || || || || ||||||||| ||| || ||||||||| |||| Sbjct: 677 tcagggtcgtccgcaagtcccagcgggtcgaagctgcccccggggtagatggggtcggtc 618 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| || || || ||||| ||| |||||| ||||| | | ||||||||| | ||| Sbjct: 617 acctctcccagaggaccgcccgcaatacggtatccctccacggcgcccatgaggataacc 558 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 |||||||||||||| || || |||||||||||||| |||| | | ||||| ||||||||| Sbjct: 557 tggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccaggtag 498 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 || || || |||||| ||| ||||| || |||||||||||| Sbjct: 497 tcaagccctccctcgctgaaaatctgagctccggccttgaac 456
>emb|Z49749.1|PMLHCABBP P.menziesii mRNA for light-harvesting chlorophyll a/b binding protein of photosystem II Length = 772 Score = 178 bits (90), Expect = 1e-41 Identities = 279/342 (81%) Strand = Plus / Minus Query: 249 gtggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagcc 308 ||||||||| ||||| || | || ||||| ||||| ||||| ||||||||||||||||| Sbjct: 644 gtggtcgaataggttttcgatggggcccttgccggtcacgattgcctgcacgaagaagcc 585 Query: 309 gaacatggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggc 368 ||||||||||||||| || || || |||||||| |||||||| ||||| ||||| ||| Sbjct: 584 gaacatggagaacatcgccagccgcccgttctttagctccttcaccttcagctccgcgaa 525 Query: 369 tgtgtcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtc 428 | || ||||||||||| | || |||||||||||||| || || ||||| | ||| Sbjct: 524 ggcctctgggtcgtcggccaaccctagtgggtcgaaggcaccccctgggtacaatgggtc 465 Query: 429 gaggccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcac 488 | ||||| || |||||||| || || || | ||| || || || || ||||||||||| Sbjct: 464 caacccctccccaaggggtcctcctcccactctgtatccttcaatcaatcccatgagcac 405 Query: 489 cacctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccag 548 || ||| | ||||||||||| || |||||||||||||| | |||||||||||| ||||| Sbjct: 404 aacttggaaggcccagatggctagaatgctctgcgcgtggatcaggttggggtttcccag 345 Query: 549 gtagtcgaggccgccctcggagaagatctgcgcgccggcctt 590 |||||||||||| ||||| ||||| |||||||| |||||||| Sbjct: 344 gtagtcgaggcctccctccgagaatatctgcgccccggcctt 303
>dbj|AB026686.1| Physcomitrella patens mRNA for chlorophyll a/b-binding protein precursor, complete cds Length = 964 Score = 174 bits (88), Expect = 2e-40 Identities = 325/404 (80%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 ||||||| |||||||||||||| ||||||| ||||||||| || |||||||| | || Sbjct: 841 ttccgggaacgaagttggtggcgtaggcccaggcgttgttggcaacggggtcggccaagt 782 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| | |||||| | ||||||||||| || ||||||||||| |||||||| |||| Sbjct: 781 ggtcgttcaagttctccaggggtccctttccagtcacgatggcctggacgaagaacccga 722 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctg 370 |||| ||||||||||| | ||||||||||||| |||||| ||||| | ||| ||| | Sbjct: 721 acattgagaacatggccaatcggccgttcttgatctccttcaccttcaactcagcgaagg 662 Query: 371 tgtcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcga 430 |||| |||||||| || | || | |||||||||| ||| |||||||||||| ||| Sbjct: 661 tgtcggggtcgtcagccaaacccaaggggtcgaaggagcctcccgggtagatggggtcag 602 Query: 431 ggccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcacca 490 | |||||||||||||| ||| |||||||||| ||||||| | ||||| || | | Sbjct: 601 taacgtcaccgaggggtccaccagcaacacggtaaccctcgacggctcccatcaggataa 542 Query: 491 cctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggt 550 | ||||| |||||||| || | ||||||||| |||||||| ||| |||||||||||| || Sbjct: 541 cttggcaagcccagatagccaagatgctctgagcgtgcacaaggctggggttgcccaagt 482 Query: 551 agtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 |||| | || |||||| ||||||||| || |||||||||||| Sbjct: 481 agtccaaacctccctcgctgaagatctgagctccggccttgaac 438
>emb|AJ309102.1|PPI309102 Pinus pinaster partial mRNA for putative chlorophyll A-B binding protein type I Length = 684 Score = 172 bits (87), Expect = 8e-40 Identities = 249/303 (82%) Strand = Plus / Minus Query: 292 gcctgcacgaagaagccgaacatggagaacatggcgaggcggccgttcttgagctccttg 351 |||||||||||||||||||||||||||||||| || || || |||||||| | |||||| Sbjct: 484 gcctgcacgaagaagccgaacatggagaacatcgccagccgcccgttcttaatctccttc 425 Query: 352 accttgagctcggcggctgtgtcagggtcgtcggcgaggccaagtgggtcgaaggcgcca 411 ||||| ||||| ||| | || ||||| ||||| || || |||||||||||||| || Sbjct: 424 accttcagctccgcgaacgcctccgggtcatcggccagccccagtgggtcgaaggcaccc 365 Query: 412 cccgggtagatgatgtcgaggccctcaccgaggggtccgccaccaacacggtagccctcg 471 || ||||| | ||| | ||||| || |||||||| || || || | ||| || || Sbjct: 364 cctgggtacagagggtccaacccctccccaaggggtcctcctcccactctgtatccttca 305 Query: 472 atgaagcccatgagcaccacctggcatgcccagatggcgaggatgctctgcgcgtgcacc 531 || || ||||||||||| |||||||| |||||||||||||| |||||||| ||||| | | Sbjct: 304 atcaatcccatgagcacaacctggcaggcccagatggcgagtatgctctgtgcgtgaatc 245 Query: 532 aggttggggttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggccttg 591 ||||| ||||| ||||||||||||||||| ||||| ||||| |||||||| ||||||||| Sbjct: 244 aggttagggttccccaggtagtcgaggcctccctctgagaatatctgcgccccggccttg 185 Query: 592 aac 594 ||| Sbjct: 184 aac 182
>emb|AJ313013.1|PCO313013 Pinus contorta cab gene for chlorophyll a/b binding protein Length = 1197 Score = 170 bits (86), Expect = 3e-39 Identities = 323/402 (80%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| ||||||||||||| ||||||| ||||||||| | || |||||||| | ||| Sbjct: 881 ccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccaggtga 822 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 || ||||||||| | ||||| || |||||||||||||||||||||||||| |||||| Sbjct: 821 tcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaac 762 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||| |||||||| | || |||||||||| |||||| ||||| ||||| ||| | | Sbjct: 761 atggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcg 702 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || |||||||| || || || || ||||||||| ||| || ||||||||| |||| Sbjct: 701 tcggggtcgtcagcaagtcccagcgggtcgaagctgcccccggggtagatggggtcggtc 642 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| || || || ||||| ||| |||||||||||| | | ||||||||| | ||| Sbjct: 641 acctctcccagaggaccgcccgcaatacggtagccctccacggcgcccatgaggatgacc 582 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 |||||||||||||| || || |||||||||||||| |||| | | ||||| ||||||||| Sbjct: 581 tggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccaggtag 522 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 || || || |||||| ||| ||||| || || ||||||||| Sbjct: 521 tcaagccctccctcgctgaaaatctgagctcccgccttgaac 480
>emb|X67714.1|PCCABA P.contorta cab gene for chlorophyll a/b binding protein Length = 2574 Score = 170 bits (86), Expect = 3e-39 Identities = 323/402 (80%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| ||||||||||||| ||||||| ||||||||| | || |||||||| | ||| Sbjct: 1959 ccggggacgaagttggtggcataggcccaggcgttgttgctaacggggtcggccaggtga 1900 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 || ||||||||| | ||||| || |||||||||||||||||||||||||| |||||| Sbjct: 1899 tcagcgaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaac 1840 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||| |||||||| | || |||||||||| |||||| ||||| ||||| ||| | | Sbjct: 1839 atggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctctgcgaaagcg 1780 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || |||||||| || || || || ||||||||| ||| || ||||||||| |||| Sbjct: 1779 tcggggtcgtccgcaagtcccagcgggtcgaagctgcccccggggtagatggggtcggtc 1720 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| || || || ||||| ||| |||||||||||| | | ||||||||| | ||| Sbjct: 1719 acctctcccagaggaccgcccgcaatacggtagccctccacggcgcccatgaggatgacc 1660 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 |||||||||||||| || || |||||||||||||| |||| | | ||||| ||||||||| Sbjct: 1659 tggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccaggtag 1600 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 || || || |||||| ||| ||||| || || ||||||||| Sbjct: 1599 tcaagccctccctcgctgaaaatctgagctcccgccttgaac 1558
>emb|X12735.1|HVCAB2 Barley Cab-2 gene for major light-harvesting chlorophyll a/b- binding protein ( LHCP ) Length = 1030 Score = 170 bits (86), Expect = 3e-39 Identities = 152/174 (87%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||||||||||| || |||||||| || |||||||||| ||| Sbjct: 968 ccggggacgaagttggtggcgaaggcccaggcattgttgtttacggggtcggcgagatgg 909 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 || | |||||| | || ||||| |||||||||||||||||||||||||| |||||| Sbjct: 908 tccgccaagttctcgaggggccccttcccggtgacgatggcctgcacgaagaatccgaac 849 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcg 366 |||||||||||||| ||||| |||||||||| |||||||||||| ||||||||| Sbjct: 848 atggagaacatggccaggcgtccgttcttgatctccttgaccttcagctcggcg 795 Score = 91.7 bits (46), Expect = 2e-15 Identities = 67/74 (90%) Strand = Plus / Minus Query: 478 cccatgagcaccacctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttg 537 |||||||| ||||||||||| ||||||||||| ||||||||||||||||| |||||| | Sbjct: 683 cccatgaggaccacctggcaggcccagatggccaggatgctctgcgcgtggaccagggag 624 Query: 538 gggttgcccaggta 551 ||||| |||||||| Sbjct: 623 gggttccccaggta 610
>gb|AY617091.1| Pinus strobus chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 165 bits (83), Expect = 2e-37 Identities = 273/337 (81%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | ||| ||||||||||||||||| ||||| ||||| ||| | ||| || Sbjct: 686 aaacatggccaagcgcccgttcttgagctccttcaccttcagctccgcgaaagcgtcggg 627 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 |||||| || || || | ||||||||| |||||| ||||||||| ||| |||| Sbjct: 626 gtcgtctgcaagtcccaaggggtcgaagctgccaccggggtagatggggtcrgtcacctc 567 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 || || || |||||| ||| |||||| ||||| | | ||||||||| | |||||||| Sbjct: 566 tcccagagggccgccagcaatacggtaaccctccacggcgcccatgaggatgacctggca 507 Query: 498 tgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgag 557 ||||||||| || || |||||||||||||| | ||| | ||||| ||||||||||| || Sbjct: 506 tgcccagattgcaagaatgctctgcgcgtggataaggctagggtttcccaggtagtcaag 447 Query: 558 gccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||| ||||| || || ||||||||| Sbjct: 446 ccctccctcgctgaaaatctgagctcccgccttgaac 410
>gb|M29334.1|LGILHCPABP L.gibba light-harvesting chlorophyll a/b protein gene, complete cds Length = 1633 Score = 163 bits (82), Expect = 8e-37 Identities = 148/170 (87%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||||||||||| ||||||||||| || |||||||||| ||| Sbjct: 1188 ccggggacgaagttggtggcgaaggcccaggcgttgttgttgacggggtcggcgagatgg 1129 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 || | |||||| | || ||||| |||||||||||||||||||||||||| |||||| Sbjct: 1128 tccgccaagttctcgagggggcccttcccggtgacgatggcctgcacgaagaacccgaac 1069 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctc 362 |||||||||||||| ||||| |||||||||| |||||| ||||| ||||| Sbjct: 1068 atggagaacatggccaggcgtccgttcttgatctccttcaccttcagctc 1019 Score = 117 bits (59), Expect = 4e-23 Identities = 116/135 (85%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccagatggcgaggatgctc 519 |||||||| |||| | ||||||||| |||||||| ||||||||||| ||||||||| Sbjct: 921 cggtagccttcgacggcgcccatgaggaccacctgcgtggcccagatggccaggatgctc 862 Query: 520 tgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctgc 579 ||||||||||||||| ||||||||||||||||||| || || |||||| |||||||||| Sbjct: 861 tgcgcgtgcaccaggctggggttgcccaggtagtccagccccccctcgctgaagatctgc 802 Query: 580 gcgccggccttgaac 594 | || ||||||||| Sbjct: 801 gaacccgccttgaac 787
>gb|AY617090.1| Pinus monticola chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 161 bits (81), Expect = 3e-36 Identities = 273/337 (81%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | ||| ||||||||||||||||| ||||| ||||| ||| | ||| || Sbjct: 686 aaacatggccaagcgcccgttcttgagctccttcaccttcagctccgcgaaagcgtcggg 627 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 |||||| || || || | ||||||||| |||||| ||||||||| |||| |||| Sbjct: 626 gtcgtctgcaagtcccaaggggtcgaagctgccaccggggtagatggggtcggtcacctc 567 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 || || || |||||| ||| |||||| ||||| | | ||||||||| | |||||||| Sbjct: 566 tcccagagggccgccagcaatacggtaaccctccacggcgcccatgaggatgacctggca 507 Query: 498 tgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgag 557 ||||||||| || || |||||||||||||| | ||| | ||||| || |||||||| || Sbjct: 506 tgcccagattgcaagaatgctctgcgcgtggataaggctagggtttccaaggtagtcaag 447 Query: 558 gccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||| ||||| || || ||||||||| Sbjct: 446 ccctccctcgctgaaaatctgagctcccgccttgaac 410
>gb|AY617089.1| Pinus lambertiana chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 161 bits (81), Expect = 3e-36 Identities = 272/337 (80%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | ||| ||||||||||||||||| ||||| ||||| ||| | ||| || Sbjct: 686 aaacatggccaagcgcccgttcttgagctccttcaccttcagctccgcgaaagcgtcrgg 627 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 ||||| || || || | ||||||||| |||||| ||||||||| |||| |||| Sbjct: 626 rtcgtctgcaagtcccaaggggtcgaagctgccaccggggtagatggggtcggtcacctc 567 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 || || || |||||| ||| |||||| ||||| | | ||||||||| | |||||||| Sbjct: 566 tcccagagggccgccagcaatacggtaaccctccacggcgcccatgaggatgacctggca 507 Query: 498 tgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgag 557 ||||||||| || || |||||||||||||| | ||| | ||||| || |||||||| || Sbjct: 506 tgcccagattgcaagaatgctctgcgcgtggataaggctagggtttccaaggtagtcaag 447 Query: 558 gccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||| ||||| || || ||||||||| Sbjct: 446 ccctccctcgctgaaaatctgagctcccgccttgaac 410
>gb|AY617088.1| Pinus flexilis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 161 bits (81), Expect = 3e-36 Identities = 273/337 (81%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtccctttccggtgacgatggcctgcacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | ||| ||||||||||||||||| ||||| ||||| ||| | ||| || Sbjct: 686 aaacatggccaagcgyccgttcttgagctccttcaccttcagctccgcgaaagcgtcggg 627 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 |||||| || || || | ||||||||| |||||| ||||||||| |||| |||| Sbjct: 626 gtcgtctgcaagtcccaaggggtcgaagctgccaccggggtagatggggtcggtcacctc 567 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 || || || |||||| ||| |||||| ||||| | | ||||||||| | |||||||| Sbjct: 566 tcccagagggccgccagcaatacggtaaccctccacggcgcccatgaggatgacctggca 507 Query: 498 tgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgag 557 ||||||||| || || |||||||||||||| | ||| | ||||| || |||||||| || Sbjct: 506 tgcccagattgcaagaatgctctgcgcgtggataaggctagggtttccaaggtagtcaag 447 Query: 558 gccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||| ||||| || || ||||||||| Sbjct: 446 ccctccctcgctgaaaatctgagctcccgccttgaac 410
>emb|X14506.1|PSCABIIB Pinus sylvestris cab II/1B mRNA for chlorophyll a/b-binding protein Length = 1006 Score = 155 bits (78), Expect = 2e-34 Identities = 321/402 (79%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| ||||||||||| || ||||| || | ||| Sbjct: 866 ccggggacgaagttggtggcgtaggcccaggcgttgttgttaacggggtcagccaggtga 807 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 || ||||||||| | ||||| || |||||||| ||||||||||||||||| |||||| Sbjct: 806 tcagcgaggttctcgatgggtcctttcccggtgacaatggcctgcacgaagaatccgaac 747 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 ||||| |||||||| | || |||||||||| |||||| ||||| ||||| ||| | Sbjct: 746 atggaaaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcc 687 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 |||||||| || || || || || ||||||||| ||| || ||||||||| |||| Sbjct: 686 tcagggtcttccgcaagtcccagcgggtcgaagctgccccctgggtagatggggtcggtc 627 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| || || || ||||| ||| |||||| ||||| | | ||||||||| | ||| Sbjct: 626 acctctcccagaggaccgcccgcaatacggtatccctccacggcgcccatgaggataacc 567 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 |||||||||||||| || || |||||||||||||| |||| | | ||||| ||||||||| Sbjct: 566 tggcatgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccaggtag 507 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 || || || |||||| ||| ||||| || || ||||||||| Sbjct: 506 tcaagccctccctcgctgaaaatctgagctcccgccttgaac 465
>gb|DQ018375.1| Pinus gerardiana chloroplast putative light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 760 Score = 153 bits (77), Expect = 8e-34 Identities = 272/337 (80%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | ||||||||||||||||| ||||||||||||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtccctttccggtgacaatggcctgcacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | ||| |||||||||| |||||| ||||| ||||| ||| | ||| || Sbjct: 686 aaacatggccaagcgcccgttcttgatctccttcaccttcagctccgcgaaagcgtctgg 627 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 |||||| || || || | ||||||||| |||||| ||||||||| |||| |||| Sbjct: 626 gtcgtctgcaagtcccaaggggtcgaagctgccaccggggtagatggggtcggtcacctc 567 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 || || || |||||| ||| |||||| ||||| | | ||||||||| | |||||||| Sbjct: 566 tcccagagggccgccagcaatacggtaaccctccacggcgcccatgaggatgacctggca 507 Query: 498 tgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgag 557 ||||||||| || || |||||||||||||| | ||| | ||||| ||||||||||| || Sbjct: 506 tgcccagattgcaagaatgctctgcgcgtggataaggctagggtttcccaggtagtcaag 447 Query: 558 gccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||| ||||| || || ||||||||| Sbjct: 446 ccctccctcgctgaaaatctgagctcccgccttgaac 410
>emb|X54856.1|CMCAB C.moewusii cab mRNA for chlorophyll a/b binding protein Length = 1011 Score = 153 bits (77), Expect = 8e-34 Identities = 260/321 (80%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| |||||||||||||||||||||||||| |||||||||||| |||||| Sbjct: 715 cccttgccggtcacgatggcctgcacgaagaagccgaagcaggagaacatggcaaggcgg 656 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||||||||| ||| ||||| ||||| || || ||||| Sbjct: 655 ccgttcttgatctccttcaccttgagctcagcgaaggtgtcggggtcatcagccaggccc 596 Query: 394 agtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcaccgaggggtccgcca 453 || |||||||||| | || ||||| | | ||| || ||||||||| ||| ||||| Sbjct: 595 agggggtcgaaggactcgccggggtacagggggtccagaccctcaccggcggggccgccg 536 Query: 454 ccaacacggtagccctcgatgaagcccatgagcaccacctggcatgcccagatggcgagg 513 |||||||||||||| || | ||||| ||||| |||||| ||| | |||| | | Sbjct: 535 ttcacacggtagccctcaatcagacccatcagcacaacctggacggccagggtggcaacg 476 Query: 514 atgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaag 573 ||| |||| ||||| | |||| |||| ||||||||||||| ||||| |||||||||||| Sbjct: 475 atgttctgggcgtggatcagggcggggctgcccaggtagtccaggccaccctcggagaag 416 Query: 574 atctgcgcgccggccttgaac 594 ||||| || |||||||||||| Sbjct: 415 atctgggcaccggccttgaac 395
>emb|X81810.1|PALHCB122 P.abies (L.)Karst. Lhcb1*2-2 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1050 Score = 149 bits (75), Expect = 1e-32 Identities = 315/395 (79%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 ||||||| || ||| ||||||| ||||||||| | || |||||||| | ||| || || Sbjct: 838 cgaagttagtagcgtaggcccaggcgttgttggtaaccgggtcggccaggtgatcagcga 779 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 | ||||| | ||||| || ||||||||||||||||| |||||||| |||||||| || | Sbjct: 778 gattctcgatgggtcctttaccggtgacgatggcctggacgaagaatccgaacatagaaa 719 Query: 320 acatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggt 379 ||||||| | || ||||||||||||||||| ||||| ||||| ||| | ||| |||| Sbjct: 718 acatggccaaccgcccgttcttgagctccttcaccttcagctccgcgaaagcgtccgggt 659 Query: 380 cgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcac 439 |||| || ||||| || ||||||||| ||| || ||||||||| ||| | ||| | Sbjct: 658 cgtcagcaaggccgagcgggtcgaagctgcccccggggtagatggggtcagtgatctctc 599 Query: 440 cgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggcatg 499 |||| || || || ||| |||||||||||| | | ||||||||| | |||||||||| Sbjct: 598 cgagagggccacctgcaatacggtagccctccacggcgcccatgagaatgacctggcatg 539 Query: 500 cccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggc 559 ||||||| || ||||||||||| ||||| | || | | ||||| ||||||||||| |||| Sbjct: 538 cccagattgcaaggatgctctgggcgtgaatcaagctagggtttcccaggtagtcaaggc 479 Query: 560 cgccctcggagaagatctgcgcgccggccttgaac 594 | |||||| ||||||||| || || ||||||||| Sbjct: 478 ctccctcgctgaagatctgagctcccgccttgaac 444
>emb|X81809.1|PALHCB12 P.abies (L.)Karst. Lhcb1*2-1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1062 Score = 149 bits (75), Expect = 1e-32 Identities = 315/395 (79%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 ||||||| || ||| ||||||| ||||||||| | || |||||||| | ||| || || Sbjct: 835 cgaagttagtagcgtaggcccaggcgttgttggtaaccgggtcggccaggtgatcagcga 776 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 | ||||| | ||||| || ||||||||||||||||| |||||||| |||||||| || | Sbjct: 775 gattctcgatgggtcctttaccggtgacgatggcctggacgaagaatccgaacatagaaa 716 Query: 320 acatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggt 379 ||||||| | || ||||||||||||||||| ||||| ||||| ||| | ||| |||| Sbjct: 715 acatggccaaccgcccgttcttgagctccttcaccttcagctccgcgaaagcgtccgggt 656 Query: 380 cgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcac 439 |||| || ||||| || ||||||||| ||| || ||||||||| ||| | ||| | Sbjct: 655 cgtcagcaaggccgagcgggtcgaagctgcccccggggtagatggggtcagtgatctctc 596 Query: 440 cgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggcatg 499 |||| || || || ||| |||||||||||| | | ||||||||| | |||||||||| Sbjct: 595 cgagagggccacctgcaatacggtagccctccacggcgcccatgagaatgacctggcatg 536 Query: 500 cccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggc 559 ||||||| || ||||||||||| ||||| | || | | ||||| ||||||||||| |||| Sbjct: 535 cccagattgcaaggatgctctgggcgtgaatcaagctagggtttcccaggtagtcaaggc 476 Query: 560 cgccctcggagaagatctgcgcgccggccttgaac 594 | |||||| ||||||||| || || ||||||||| Sbjct: 475 ctccctcgctgaagatctgagctcccgccttgaac 441
>emb|X14505.1|PSCABIIA Pinus sylvestris cab II/1A mRNA for chlorophyll a/b-binding protein Length = 1083 Score = 149 bits (75), Expect = 1e-32 Identities = 270/335 (80%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||| ||||||||| ||||||| || ||||||||||| |||||||| | ||| Sbjct: 885 ccggggacgaaattggtggcgtaggcccaggcattgttgttcacggggtcggccaggtga 826 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| ||||||||| | ||||| || || || ||||| ||||||||||||||||||||| Sbjct: 825 tcggcgaggttctcgatgggtcctttgcccgtcacgatcgcctgcacgaagaagccgaac 766 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||| | || |||||||||| |||||| || || ||||| ||| | Sbjct: 765 atggagaacatggccaaccgtccgttcttgatctccttcactttcagctccgcgaaagca 706 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || |||||||| || || || |||||||||||| || || || ||||| |||| Sbjct: 705 tccgggtcgtctgccagtcccagtgggtcgaagttaccgccgggatagatagggtcggtc 646 Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 |||| |||||||| || || |||||||||||||||||||| |||||||| | ||| Sbjct: 645 acctctccgaggggcccacccgcaacacggtagccctcgatggcacccatgaggatgacc 586 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtg 527 ||||||||||||||||| || |||||||| ||||| Sbjct: 585 tggcatgcccagatggcaagaatgctctgggcgtg 551
>ref|NM_001036402.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.3 mRNA, complete cds Length = 3299 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Plus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 2490 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 2549 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 2550 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 2609 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 2610 acatagagaacatagccaaccttccgttcttgagctccttcacctt 2655
>ref|NM_001036401.1| Arabidopsis thaliana O-acetyltransferase AT2G34410 transcript variant AT2G34410.2 mRNA, complete cds Length = 3338 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Plus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 2490 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 2549 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 2550 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 2609 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 2610 acatagagaacatagccaaccttccgttcttgagctccttcacctt 2655
>ref|NM_128994.2| Arabidopsis thaliana LHB1B2; chlorophyll binding AT2G34420 (LHB1B2) transcript variant AT2G34420.1 mRNA, complete cds Length = 1354 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 848 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 789 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 788 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 729 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 728 acatagagaacatagccaaccttccgttcttgagctccttcacctt 683
>ref|NM_179900.1| Arabidopsis thaliana LHB1B2 AT2G34420 (LHB1B2) transcript variant AT2G34420.2 mRNA, complete cds Length = 1312 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 806 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 747 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 746 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 687 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 686 acatagagaacatagccaaccttccgttcttgagctccttcacctt 641
>gb|AY142513.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 829 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 734 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 733 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 674 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 673 acatagagaacatagccaaccttccgttcttgagctccttcacctt 628
>gb|AY045806.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 1015 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 848 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 789 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 788 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 729 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 728 acatagagaacatagccaaccttccgttcttgagctccttcacctt 683
>gb|AY617087.1| Pinus chiapensis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 147 bits (74), Expect = 5e-32 Identities = 221/270 (81%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | |||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtccctttccggtgacgattgcctgcacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | ||| ||||||||||||||||| ||||| ||||| ||| | ||| || Sbjct: 686 aaacatggccaagcgcccgttcttgagctccttcaccttcagctccgcgaaagcgtcggg 627 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 |||||| || || || | ||||||||| |||||| ||||||||| |||| |||| Sbjct: 626 gtcgtctgcaagtcccaaggggtcgaagctgccaccggggtagatggggtcggtcacctc 567 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 || || || |||||| ||| |||||| ||||| | | ||||||||| | |||||||| Sbjct: 566 tcccagagggccgccagcaatacggtaaccctccacggcgcccatgaggatgacctggca 507 Query: 498 tgcccagatggcgaggatgctctgcgcgtg 527 ||||||||| || || |||||||||||||| Sbjct: 506 tgcccagattgcaagaatgctctgcgcgtg 477
>gb|AC004481.3| Arabidopsis thaliana chromosome 2 clone F13P17 map ve016, complete sequence Length = 112763 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Plus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 93208 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 93267 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 93268 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 93327 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 93328 acatagagaacatagccaaccttccgttcttgagctccttcacctt 93373 Score = 123 bits (62), Expect = 7e-25 Identities = 140/166 (84%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||| ||||||||||| || |||||||| ||||| || || | || Sbjct: 96100 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 96041 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| ||||||||| | |||||||||||||||||| |||||||| |||||||| || | Sbjct: 96040 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaa 95981 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 95980 acatagagaacatagccaaccttccgttcttgagctccttcacctt 95935
>gb|AC004077.3| Arabidopsis thaliana chromosome 2 clone T31E10 map ve016, complete sequence Length = 93060 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 80994 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 80935 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 80934 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 80875 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 80874 acatagagaacatagccaaccttccgttcttgagctccttcacctt 80829 Score = 123 bits (62), Expect = 7e-25 Identities = 140/166 (84%) Strand = Plus / Plus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||| ||||||||||| || |||||||| ||||| || || | || Sbjct: 78102 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 78161 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| ||||||||| | |||||||||||||||||| |||||||| |||||||| || | Sbjct: 78162 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaa 78221 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 78222 acatagagaacatagccaaccttccgttcttgagctccttcacctt 78267
>gb|AY081587.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420) mRNA, complete cds Length = 883 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 734 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 733 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 674 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 673 acatagagaacatagccaaccttccgttcttgagctccttcacctt 628
>gb|AY079110.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 734 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 733 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 674 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 673 acatagagaacatagccaaccttccgttcttgagctccttcacctt 628
>gb|AY079101.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 798 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 793 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 734 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 733 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 674 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 673 acatagagaacatagccaaccttccgttcttgagctccttcacctt 628
>gb|AY065125.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein (At2g34420; T31E10.24) mRNA, complete cds Length = 969 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 784 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 725 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 724 acatagagaacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AF419587.1|AF419587 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 784 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 725 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 724 acatagagaacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AF419548.1|AF419548 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 784 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 725 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 724 acatagagaacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AF428397.1|AF428397 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 1024 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 784 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 725 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 724 acatagagaacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AY039561.1| Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 995 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 784 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 725 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 724 acatagagaacatagccaaccttccgttcttgagctccttcacctt 679
>gb|AF372886.1|AF372886 Arabidopsis thaliana At2g34420/T31E10.24 mRNA, complete cds Length = 969 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 844 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 785 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 784 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 725 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 724 acatagagaacatagccaaccttccgttcttgagctccttcacctt 679
>emb|BX820019.1|CNS0A9C1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS62ZC05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 825 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 766 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 765 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 706 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 705 acatagagaacatagccaaccttccgttcttgagctccttcacctt 660
>emb|BX820007.1|CNS0A9CM Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZF09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 885 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 828 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 769 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 768 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 709 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 708 acatagagaacatagccaaccttccgttcttgagctccttcacctt 663
>emb|BX822910.1|CNS0A63G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB71ZG07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 919 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Plus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 91 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 150 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 151 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 210 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 211 acatagagaacatagccaaccttccgttcttgagctccttcacctt 256
>emb|X64460.1|ATLH1B2 A.thaliana Lhb1B2 gene for photosystem II chlorophyll a/b binding protein Length = 1405 Score = 147 bits (74), Expect = 5e-32 Identities = 143/166 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 1093 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 1034 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 1033 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 974 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 973 acatagagaacatagccaaccttccgttcttgagctccttcacctt 928
>gb|AY617096.1| Picea sitchensis chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 763 Score = 145 bits (73), Expect = 2e-31 Identities = 261/324 (80%) Strand = Plus / Minus Query: 271 ggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgagg 330 ||||| || ||||||||||||||||| ||||||| |||||||| || |||||||| | Sbjct: 733 ggtcctttaccggtgacgatggcctggncgaagaatccgaacatagaaaacatggccaac 674 Query: 331 cggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgagg 390 || ||||||||||||||||| ||||| ||||| ||| | ||| |||||||| || ||| Sbjct: 673 cgcccgttcttgagctccttcaccttcagctccgcgaaagcgtccgggtcgtcagcaagg 614 Query: 391 ccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcaccgaggggtccg 450 || || ||||||||| ||| || ||||||||| ||| | ||| ||||| || || Sbjct: 613 ccgagcgggtcgaagctgcccccggggtagatggggtcagtgatctctccgagagggcca 554 Query: 451 ccaccaacacggtagccctcgatgaagcccatgagcaccacctggcatgcccagatggcg 510 || ||| |||||||||||| | | ||||||||| | ||||||||||||||||| || Sbjct: 553 cctgcaatacggtagccctccacggcgcccatgagaatgacctggcatgcccagattgca 494 Query: 511 aggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggag 570 ||||||||||| ||||| |||| | | ||||| ||||||||||| ||||| |||||| | Sbjct: 493 aggatgctctgggcgtgaaccaagctagggtttcccaggtagtcaaggcctccctcgctg 434 Query: 571 aagatctgcgcgccggccttgaac 594 |||||||| || || ||||||||| Sbjct: 433 aagatctgagctcccgccttgaac 410
>gb|AY617084.1| Pinus contorta chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 145 bits (73), Expect = 2e-31 Identities = 271/337 (80%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | ||||| || |||||||||||||||||||||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | || |||||||||| |||||| ||||| ||||| ||| | ||| || Sbjct: 686 aaacatggccaaccgcccgttcttgatctccttcaccttcagctctgcgaaagcgtcggg 627 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 |||||| ||||| || || ||||||||| ||| || ||||||||| |||| |||| Sbjct: 626 gtcgtccgcgagtcccagcgggtcgaagctgcccccggggtagatggggtcggtcacctc 567 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 | || || ||||| ||| |||||||||||| | | ||||||||| | |||||||| Sbjct: 566 tctcagaggaccgcccgcaatacggtagccctccacggcgcccatgaggatgacctggca 507 Query: 498 tgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgag 557 ||||||||| || || |||||||||||||| |||| | | ||||| ||||||||||| || Sbjct: 506 tgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccaggtagtcaag 447 Query: 558 gccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||| ||||| || || ||||||||| Sbjct: 446 ccctccctcgctgaaaatctgagctcccgccttgaac 410
>gb|AY617083.1| Pinus radiata chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 145 bits (73), Expect = 2e-31 Identities = 271/337 (80%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | ||||| || |||||||||||||||||||||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | || |||||||||| |||||| ||||| ||||| ||| | ||| || Sbjct: 686 aaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcgtcggg 627 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 |||||| || || || || ||||||||| ||| || ||||||||| |||| |||| Sbjct: 626 gtcgtccgcaagtcccagcgggtcgaagctgcccccggggtagatggggtcggtcacctc 567 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 || || || ||||| ||| |||||||||||| | | ||||||||| | |||||||| Sbjct: 566 tcccagaggaccgcccgcaatacggtagccctccacggcgcccatgaggatgacctggca 507 Query: 498 tgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgag 557 ||||||||| || || |||||||||||||| |||| | | ||||| ||||||||||| || Sbjct: 506 tgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccaggtagtcaag 447 Query: 558 gccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||| ||||| || || ||||||||| Sbjct: 446 ccctccctcgctgaaaatctgagctcccgccttgaac 410
>emb|BX819530.1|CNS0A9V8 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB87ZE01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 291 Score = 143 bits (72), Expect = 8e-31 Identities = 138/160 (86%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 164 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 105 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 104 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 45 Query: 311 acatggagaacatggcgaggcggccgttcttgagctcctt 350 |||| |||||||| || | | ||||||||||||||||| Sbjct: 44 acatagagaacatagccaaccttccgttcttgagctcctt 5
>gb|AF017998.1|AF017998 Tetraselmis sp. RG-15 chlorophyll a/b binding protein (LHCPII) gene, complete cds Length = 2095 Score = 141 bits (71), Expect = 3e-30 Identities = 128/147 (87%) Strand = Plus / Minus Query: 261 gttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaa 320 ||||||||| || ||||| |||||||| ||||||||||||||||| || ||||||||||| Sbjct: 1671 gttctcaacggggcccttgccggtgacaatggcctgcacgaagaacccaaacatggagaa 1612 Query: 321 catggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtc 380 ||| ||||| || |||||||||| |||||| ||||||||||||| | ||||||||||| Sbjct: 1611 catagcgagacgcccgttcttgatctccttcaccttgagctcggagaaggtgtcagggtc 1552 Query: 381 gtcggcgaggccaagtgggtcgaaggc 407 ||| || ||||| || ||||||||||| Sbjct: 1551 gtcagccaggcccagggggtcgaaggc 1525 Score = 85.7 bits (43), Expect = 2e-13 Identities = 102/119 (85%), Gaps = 2/119 (1%) Strand = Plus / Minus Query: 477 gcccatgagcaccacctggcatgcccag-atggcgaggatgctctgcgcgtgcaccaggt 535 |||||| |||||||||||||| |||||| ||||| |||||| ||| ||||||||||| Sbjct: 1455 gcccatcagcaccacctggca-gcccaggatggccaggatggactgggcgtgcaccagag 1397 Query: 536 tggggttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| |||||||||||||| || |||| ||| ||||| ||||||||||||||| Sbjct: 1396 aggagttgccaaggtagtcgaggccaccgtcggcgaaaatctgggcgccggccttgaac 1338
>gb|AF495473.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m1 gene, complete cds; nuclear gene for chloroplast product Length = 1934 Score = 139 bits (70), Expect = 1e-29 Identities = 127/146 (86%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 1414 cccttgccggtcacgatggcctgaacgaagaagccgaacatggagaacatggccaggcgg 1355 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 1354 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 1295 Query: 394 agtgggtcgaaggcgccacccgggta 419 || |||||||| | |||||| ||||| Sbjct: 1294 agggggtcgaacgagccaccggggta 1269 Score = 95.6 bits (48), Expect = 2e-16 Identities = 116/136 (85%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||| ||| |||||| |||| ||||||| ||||||| ||||| |||||| Sbjct: 1080 cggtagccctcaatggcgcccatcagcagcacctggg-tgcccaggatggccaggatgga 1022 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| |||||||||||||||||||||||||||||||| || |||||||| ||||||||| Sbjct: 1021 ctgggcgtgcaccaggttggggttgcccaggtagtccagaccgccctcctggaagatctg 962 Query: 579 cgcgccggccttgaac 594 || || ||||||||| Sbjct: 961 agcaccagccttgaac 946
>gb|AF247178.1|AF247178 Picea glauca needle chlorophyll a/b-binding protein mRNA, complete cds; nuclear gene for chloroplast product Length = 1096 Score = 139 bits (70), Expect = 1e-29 Identities = 140/162 (86%), Gaps = 1/162 (0%) Strand = Plus / Minus Query: 433 ccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacc 492 ||||| || |||||||| || ||||| | ||| ||||| || |||||||||||||| ||| Sbjct: 627 ccctccccaaggggtcctcccccaactctgtatccctcaatcaagcccatgagcacaacc 568 Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||| | ||||||||||| || |||||||||||||| | |||||||||||| ||||||||| Sbjct: 567 tggaaggcccagatggccagaatgctctgcgcgtggatcaggttggggttccccaggtag 508 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 |||||||| ||||| | ||| |||||||| |||||||||||| Sbjct: 507 tcgaggcctccctccgcgaatatctgcgc-ccggccttgaac 467 Score = 117 bits (59), Expect = 4e-23 Identities = 137/163 (84%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 |||| ||||||||| ||||||| ||||||||| | | || || || | ||||||||||| Sbjct: 860 cgaaattggtggcgtaggcccaggcgttgttggttgcgggatccgccaagtggtcgaaga 801 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 | || || | || ||||| ||||| ||||| |||||||||||||||||||||||||||| Sbjct: 800 gattttcgatggggcccttgccggttacgattgcctgcacgaagaagccgaacatggaga 741 Query: 320 acatggcgaggcggccgttcttgagctccttgaccttgagctc 362 ||||||| || || |||||||| |||||||| ||||| ||||| Sbjct: 740 acatggccagccgcccgttctttagctccttcaccttcagctc 698
>dbj|AB051206.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-4, complete cds Length = 1781 Score = 139 bits (70), Expect = 1e-29 Identities = 127/146 (86%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 1327 cccttgccggtcacgatggcctgaacgaagaagccgaacatggagaacatggccaggcgg 1268 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 1267 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 1208 Query: 394 agtgggtcgaaggcgccacccgggta 419 || |||||||| | |||||| ||||| Sbjct: 1207 agggggtcgaacgagccaccggggta 1182 Score = 95.6 bits (48), Expect = 2e-16 Identities = 116/136 (85%), Gaps = 2/136 (1%) Strand = Plus / Minus Query: 460 cggtagccctcgatgaagcccatgagcaccacctggcatgcccag-atggcgaggatgct 518 ||||||||||| ||| |||||| |||| ||||||| ||||||| ||||| |||||| Sbjct: 993 cggtagccctcaatggcgcccatcagcagcacctggg-tgcccaggatggccaggatgga 935 Query: 519 ctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctg 578 ||| |||||||||||||||||||||||||||||||| || |||||||| ||||||||| Sbjct: 934 ctgggcgtgcaccaggttggggttgcccaggtagtccagaccgccctcctggaagatctg 875 Query: 579 cgcgccggccttgaac 594 || || ||||||||| Sbjct: 874 agcaccagccttgaac 859
>emb|AJ843976.1| Plantago major partial mRNA for light harvesting protein 1 (lhc1 gene) Length = 688 Score = 137 bits (69), Expect = 5e-29 Identities = 129/149 (86%) Strand = Plus / Minus Query: 214 aaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttctcaaccggt 273 |||||||| ||||||||||| || ||||| || | |||||| |||||||| | ||| Sbjct: 662 aaggcccaagcgttgttgttaacggggtctgctaggtggtcagcaaggttctccaacggg 603 Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||||||||||||||| ||||| |||||||| |||||||||||||||||||| || | | Sbjct: 602 ccctttccggtgacgatagcctggacgaagaatccgaacatggagaacatggcaagcctg 543 Query: 334 ccgttcttgagctccttgaccttgagctc 362 ||||||||||||||||| ||||||||||| Sbjct: 542 ccgttcttgagctccttaaccttgagctc 514
>gb|AY617095.1| Pinus nelsonii chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 137 bits (69), Expect = 5e-29 Identities = 270/337 (80%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | |||||||||||||||||||||||||| |||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtccctttccggtgacgatggcctgaacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | ||| |||||||||| |||||| ||||| ||||| ||| | ||| || Sbjct: 686 aaacatggccaagcgcccgttcttgatctccttcaccttcagctccgcgaaagcgtcggg 627 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 |||||| || || || | ||||||||| |||||| ||||||||| |||| |||| Sbjct: 626 gtcgtctgcaagtcccaaggggtcgaagctgccaccggggtagatggggtcggtcacctc 567 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 || || || ||||| ||| |||||| ||||| | | ||||||||| | |||||||| Sbjct: 566 tcccagagggccgccggcaatacggtaaccctccacggcgcccatgaggatgacctggca 507 Query: 498 tgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgag 557 ||||||||| || || || ||||||||||| | ||| | ||||| ||||||||||| || Sbjct: 506 tgcccagattgcaagaatactctgcgcgtggataaggctagggtttcccaggtagtcaag 447 Query: 558 gccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||| ||||| || || ||||||||| Sbjct: 446 ccctccctcgctgaaaatctgagctcccgccttgaac 410
>gb|AY617082.1| Pinus ponderosa chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 137 bits (69), Expect = 5e-29 Identities = 270/337 (80%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | ||||| || |||||||||||||||||||||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | || |||||||||| |||||| ||||| ||||| ||| | ||| || Sbjct: 686 aaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcgtcggg 627 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 |||||| || || || || ||||||||| ||| || ||||||||| |||| || | Sbjct: 626 gtcgtccgcaagtcccagcgggtcgaagctgcccccggggtagatggggtcggtcaccmc 567 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 || || || ||||| ||| |||||||||||| | | ||||||||| | |||||||| Sbjct: 566 tcccagaggaccgcccgcaatacggtagccctccacggcgcccatgaggatgacctggca 507 Query: 498 tgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgag 557 ||||||||| || || |||||||||||||| |||| | | ||||| ||||||||||| || Sbjct: 506 tgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccaggtagtcaag 447 Query: 558 gccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||| ||||| || || ||||||||| Sbjct: 446 ccctccctcgctgaaaatctgagctcccgccttgaac 410
>gb|AY617081.1| Pinus echinata chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 762 Score = 137 bits (69), Expect = 5e-29 Identities = 270/337 (80%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | ||||| || |||||||||||||||||||||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | || |||||||||| |||||| ||||| ||||| ||| | ||| || Sbjct: 686 aaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcgtcggg 627 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 |||||| || || || || ||||||||| ||| || ||||||||| |||| |||| Sbjct: 626 gtcgtccgcaagtcccagcgggtcgaagctgcccccggggtagatggggtcggtcacctc 567 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 || | || ||||| ||| |||||||||||| | | ||||||||| | |||||||| Sbjct: 566 tcccaaaggaccgcccgcaatacggtagccctccacggcgcccatgaggatgacctggca 507 Query: 498 tgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgag 557 ||||||||| || || |||||||||||||| |||| | | ||||| ||||||||||| || Sbjct: 506 tgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccaggtagtcaag 447 Query: 558 gccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||| ||||| || || ||||||||| Sbjct: 446 ccctccctcgctgaaaatctgagctcccgccttgaac 410
>emb|AJ234428.1|HVU234428 Hordeum vulgare partial mRNA; clone cMWG0701.rev Length = 326 Score = 137 bits (69), Expect = 5e-29 Identities = 249/309 (80%) Strand = Plus / Plus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | ||| ||||| || ||||||||||| ||||| ||| | || |||||||| Sbjct: 18 gaggttctcgagcgggcccttaccagtgacgatggcttgcacaaagtatccaaacatgga 77 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 ||||| || || || |||||||||| |||||| |||||||||||||| | || || Sbjct: 78 aaacattgcaagacgaccgttcttgatctccttcaccttgagctcggcaaacgcctcggg 137 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 |||||| || |||||||| ||||||||| |||||| ||||| | ||||| | ||| Sbjct: 138 gtcgtctgcaaggccaagggggtcgaagctgccaccggggtatagtgggtcgacgatctc 197 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 ||||| || || ||| |||| ||||| ||||||| |||||||||||| |||||||| Sbjct: 198 tccgagtgggccaccagcaacgcggtacccctcgacagcgcccatgagcacgacctggca 257 Query: 498 tgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgag 557 ||||||||||| |||||||||| |||||| |||| | | || ||||| ||||||||||| Sbjct: 258 agcccagatggcaaggatgctctccgcgtggaccaagctaggattgccgaggtagtcgag 317 Query: 558 gccgccctc 566 ||| ||||| Sbjct: 318 gccaccctc 326
>dbj|AB051209.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-3, complete cds Length = 1256 Score = 137 bits (69), Expect = 5e-29 Identities = 126/145 (86%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| |||||||||||||||||||||||||| || |||||| Sbjct: 702 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatagccaggcgg 643 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 642 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 583 Query: 394 agtgggtcgaaggcgccacccgggt 418 || ||||||||||| ||||| |||| Sbjct: 582 agggggtcgaaggcaccaccggggt 558 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 540 gttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 |||||| ||||||| ||||||||||| | ||||||||| ||||||||||||||| Sbjct: 436 gttgccgaggtagttcaggccgccctcagcgaagatctgggcgccggccttgaac 382
>dbj|AB051205.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-3, complete cds Length = 1508 Score = 137 bits (69), Expect = 5e-29 Identities = 126/145 (86%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| |||||||||||||||||||||||||| || |||||| Sbjct: 1383 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatagccaggcgg 1324 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 1323 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 1264 Query: 394 agtgggtcgaaggcgccacccgggt 418 || ||||||||||| ||||| |||| Sbjct: 1263 agggggtcgaaggcaccaccggggt 1239 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 540 gttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 |||||| ||||||| ||||||||||| | ||||||||| ||||||||||||||| Sbjct: 884 gttgccgaggtagttcaggccgccctcagcgaagatctgggcgccggccttgaac 830
>gb|AF022738.1|AF022738 Oryza sativa chlorophyll a-b binding protein mRNA, complete cds Length = 1105 Score = 135 bits (68), Expect = 2e-28 Identities = 83/88 (94%) Strand = Plus / Minus Query: 507 ggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctc 566 ||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||| || Sbjct: 515 ggcgaggatgctctgggcgtgcaccaggttggggttgccgaggtagtcgaggccgccgtc 456 Query: 567 ggagaagatctgcgcgccggccttgaac 594 ||||||||| || ||||||||||||||| Sbjct: 455 ggagaagatttgggcgccggccttgaac 428 Score = 44.1 bits (22), Expect = 0.52 Identities = 44/50 (88%), Gaps = 1/50 (2%) Strand = Plus / Minus Query: 310 aacatggagaaca-tggcgaggcggccgttcttgagctccttgaccttga 358 ||||||||||||| |||||| |||| | ||||||| |||||||| ||||| Sbjct: 715 aacatggagaacattggcgaagcgggcattcttgatctccttgaacttga 666
>gb|U43707.1|PAU43707 Picea abies chlorophyll a/b binding protein of PS II mRNA, partial cds Length = 551 Score = 135 bits (68), Expect = 2e-28 Identities = 291/363 (80%), Gaps = 2/363 (0%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| | ||||| ||||||||||| || |||||||| | ||| Sbjct: 389 ccggggacgaagttggtggcgtaagcccaggcgttgttgttgacggggtcggccaggtga 330 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| |||||| || | ||||| || || || ||||||||||| |||||||| |||||| Sbjct: 329 tcggcgaggttntcgaggggtcctttgcccgtcacgatggcctggacgaagaacccgaac 270 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtg 372 |||||||||||||| | || |||||||| |||||||| ||||| ||||| ||| | | Sbjct: 269 atggagaacatggccaaccgcccgttctttagctccttcaccttcagctctgcgaaagcg 210 Query: 373 tcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgagg 432 || |||||||| || | || || ||||||||| |||||| || || ||| ||| || Sbjct: 209 tccgggtcgtctgccaaccccagggggtcgaagttgccaccgggataaatggggtc-agt 151 Query: 433 c-cctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccac 491 | |||| || |||||||| || |||||||||||||||| ||| |||||||| | || Sbjct: 150 cacctctcccaggggtccacccgcaacacggtagccctcaatggcacccatgaggatgac 91 Query: 492 ctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggta 551 |||||||||||||||||| || ||||| || ||||| || | || ||| |||||||||| Sbjct: 90 ctggcatgcccagatggcaagaatgctttgtgcgtggactaaatttgggctgcccaggta 31 Query: 552 gtc 554 ||| Sbjct: 30 gtc 28
>gb|AF479779.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m7 (Lhcbm7) mRNA, complete cds Length = 1016 Score = 133 bits (67), Expect = 7e-28 Identities = 115/131 (87%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 703 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccaggcgg 644 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 643 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 584 Query: 394 agtgggtcgaa 404 || |||||||| Sbjct: 583 agggggtcgaa 573 Score = 105 bits (53), Expect = 2e-19 Identities = 71/77 (92%) Strand = Plus / Minus Query: 518 tctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatct 577 |||| |||||||||||| |||||||||||||||||| ||||||||||| |||||||||| Sbjct: 456 tctgggcgtgcaccagggaggggttgcccaggtagtccaggccgccctcagagaagatct 397 Query: 578 gcgcgccggccttgaac 594 | ||||||||||||||| Sbjct: 396 gggcgccggccttgaac 380 Score = 40.1 bits (20), Expect = 8.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 195 gggggcgaagttggtggcgaaggcccacgcgttgtt 230 ||||| ||| |||||||||||||| |||||||||| Sbjct: 782 gggggtgaacttggtggcgaaggcgaacgcgttgtt 747
>gb|AF479777.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m10 (Lhcbm10) mRNA, complete cds Length = 1077 Score = 133 bits (67), Expect = 7e-28 Identities = 115/131 (87%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 704 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccaggcgg 645 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 644 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 585 Query: 394 agtgggtcgaa 404 || |||||||| Sbjct: 584 agggggtcgaa 574 Score = 113 bits (57), Expect = 7e-22 Identities = 81/89 (91%) Strand = Plus / Minus Query: 506 tggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccct 565 |||||| |||| |||| |||||||||||| |||||||||||||||||| |||||||||| Sbjct: 472 tggcgacgatgttctgggcgtgcaccagggaggggttgcccaggtagtccaggccgccct 413 Query: 566 cggagaagatctgcgcgccggccttgaac 594 | ||||||||||| ||||||||||||||| Sbjct: 412 cagagaagatctgggcgccggccttgaac 384 Score = 40.1 bits (20), Expect = 8.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 195 gggggcgaagttggtggcgaaggcccacgcgttgtt 230 ||||| ||| |||||||||||||| |||||||||| Sbjct: 783 gggggtgaacttggtggcgaaggcgaacgcgttgtt 748
>dbj|AB051208.1| Chlamydomonas reinhardtii mRNA for light-harvesting chlorophyll-a/b binding protein LhcII-1.3, complete cds Length = 1107 Score = 133 bits (67), Expect = 7e-28 Identities = 115/131 (87%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 732 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccaggcgg 673 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 672 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 613 Query: 394 agtgggtcgaa 404 || |||||||| Sbjct: 612 agggggtcgaa 602 Score = 113 bits (57), Expect = 7e-22 Identities = 81/89 (91%) Strand = Plus / Minus Query: 506 tggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccct 565 |||||| |||| |||| |||||||||||| |||||||||||||||||| |||||||||| Sbjct: 500 tggcgacgatgttctgggcgtgcaccagggaggggttgcccaggtagtccaggccgccct 441 Query: 566 cggagaagatctgcgcgccggccttgaac 594 | ||||||||||| ||||||||||||||| Sbjct: 440 cagagaagatctgggcgccggccttgaac 412 Score = 40.1 bits (20), Expect = 8.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 195 gggggcgaagttggtggcgaaggcccacgcgttgtt 230 ||||| ||| |||||||||||||| |||||||||| Sbjct: 811 gggggtgaacttggtggcgaaggcgaacgcgttgtt 776
>dbj|AB051204.1| Chlamydomonas reinhardtii gene for light-harvesting chlorophyll-a/b binding protein LhcII-1.3, complete cds Length = 1835 Score = 133 bits (67), Expect = 7e-28 Identities = 115/131 (87%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 1574 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccaggcgg 1515 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 1514 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 1455 Query: 394 agtgggtcgaa 404 || |||||||| Sbjct: 1454 agggggtcgaa 1444 Score = 113 bits (57), Expect = 7e-22 Identities = 81/89 (91%) Strand = Plus / Minus Query: 506 tggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccct 565 |||||| |||| |||| |||||||||||| |||||||||||||||||| |||||||||| Sbjct: 1128 tggcgacgatgttctgggcgtgcaccagggaggggttgcccaggtagtccaggccgccct 1069 Query: 566 cggagaagatctgcgcgccggccttgaac 594 | ||||||||||| ||||||||||||||| Sbjct: 1068 cagagaagatctgggcgccggccttgaac 1040 Score = 40.1 bits (20), Expect = 8.1 Identities = 32/36 (88%) Strand = Plus / Minus Query: 195 gggggcgaagttggtggcgaaggcccacgcgttgtt 230 ||||| ||| |||||||||||||| |||||||||| Sbjct: 1653 gggggtgaacttggtggcgaaggcgaacgcgttgtt 1618
>gb|DQ418483.1| Zingiber officinale chloroplast chlorophyll a/b-binding protein mRNA, partial cds; nuclear gene for chloroplast product Length = 393 Score = 131 bits (66), Expect = 3e-27 Identities = 105/118 (88%) Strand = Plus / Minus Query: 477 gcccatgagcaccacctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggtt 536 |||||| |||||||||||| | ||||| ||||| ||||||||||||||||| | |||| | Sbjct: 239 gcccatcagcaccacctgggacgcccatatggccaggatgctctgcgcgtggatcaggct 180 Query: 537 ggggttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||||||| ||||| ||||| |||||||||||||||||||||| |||||||||||| Sbjct: 179 ggggttgccgaggtaatcgagtccgccctcggagaagatctgcgacccggccttgaac 122
>emb|BX821505.1|CNS0A93G Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL46ZF04 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 959 Score = 131 bits (66), Expect = 3e-27 Identities = 141/166 (84%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||| ||||||| |||||||||| ||||||||||| | | Sbjct: 835 ttccggggacgaagttggtggcggaggcccaagcgttgttgtagactgggtcggccaaat 776 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 775 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 716 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 715 acatagagaacatagccaaccttccgttcttgagctccttcacctt 670
>emb|BX821638.1|CNS0A92F Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL5ZG08 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 911 Score = 131 bits (66), Expect = 3e-27 Identities = 142/166 (85%), Gaps = 1/166 (0%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||| ||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 827 ttccggggacgaa-ttggtggcgaaggcccaagcgttgttgttgactgggtcggccaaat 769 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 768 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaatccaa 709 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 708 acatagagaacatagccaaccttccgttcttgagctccttcacctt 663
>gb|AF165529.1|AF165529 Rumex palustris chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 986 Score = 131 bits (66), Expect = 3e-27 Identities = 141/166 (84%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 ||||||| |||||| | ||||| ||||||||| || || || || |||||||||| | Sbjct: 835 cgaagttagtggcgtaagcccaagcgttgttggcaacaggatcagcaatgtggtcgacta 776 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 |||||||||| || ||||| ||||||||||||||||| |||||||| ||||||||||||| Sbjct: 775 ggttctcaactgggcccttgccggtgacgatggcctggacgaagaatccgaacatggaga 716 Query: 320 acatggcgaggcggccgttcttgagctccttgaccttgagctcggc 365 |||| || || | || |||||||||||||| |||||||||||||| Sbjct: 715 acatagctagccttccattcttgagctccttcaccttgagctcggc 670 Score = 131 bits (66), Expect = 3e-27 Identities = 165/198 (83%) Strand = Plus / Minus Query: 397 gggtcgaaggcgccacccgggtagatgatgtcgaggccctcaccgaggggtccgccacca 456 ||||| ||||| ||||||||||| | |||| ||| |||| || || || ||||||||| Sbjct: 638 gggtcaaaggccccacccgggtaaagcttgtcaaggtcctccccaagtgggccgccacca 579 Query: 457 acacggtagccctcgatgaagcccatgagcaccacctggcatgcccagatggcgaggatg 516 || | ||| ||||||| ||| ||||| || || |||||||| |||||||| || |||||| Sbjct: 578 accctgtaaccctcgacgaatcccattaggacaacctggcaagcccagatcgcaaggatg 519 Query: 517 ctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatc 576 || || ||||| |||||||||||||| |||||||||||||| || ||||| ||||||||| Sbjct: 518 ctttgggcgtggaccaggttggggttccccaggtagtcgagccctccctccgagaagatc 459 Query: 577 tgcgcgccggccttgaac 594 || | |||||||||||| Sbjct: 458 tgggacccggccttgaac 441
>gb|AY617094.1| Pinus longaeva chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 759 Score = 129 bits (65), Expect = 1e-26 Identities = 269/337 (79%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | |||||||| |||||||| |||||||| |||||||| ||||||||||| Sbjct: 735 gaggttctcgatgggtcccttcccggtgacaatggcctgaacgaagaatccgaacatgga 676 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | ||| |||||||||| |||||| ||||| ||||| ||| | ||| || Sbjct: 675 aaacatggccaagcgcccgttcttgatctccttcaccttcagctccgcgaaagcgtcggg 616 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 |||||| || || || | ||||||||| |||||| ||||||||| |||| |||| Sbjct: 615 gtcgtctgcaagtcccaaggggtcgaagctgccaccggggtagatggggtcggtcacctc 556 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 || || || ||||| ||| |||||| ||||| | | ||||||||| | |||||||| Sbjct: 555 tcccagagggccgccggcaatacggtaaccctccacggcgcccatgaggatgacctggca 496 Query: 498 tgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgag 557 ||||||||| || || |||||||||||||| | ||| | ||||| ||||||||||| || Sbjct: 495 tgcccagattgcaagaatgctctgcgcgtggataaggctagggtttcccaggtagtcaag 436 Query: 558 gccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||| ||||| || || ||||||||| Sbjct: 435 ycctccctcgctgaaaatctgagctcccgccttgaac 399
>gb|AY617086.1| Pinus roxburghii chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 129 bits (65), Expect = 1e-26 Identities = 269/337 (79%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | ||||| || |||||||| ||||||||||||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtcctttcccggtgacaatggcctgcacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | || |||||||||| |||||| ||||| ||||| ||| | |||||| Sbjct: 686 aaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcgtcagg 627 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 |||||| || || | || ||||||||| ||| || ||||||||| |||| |||| Sbjct: 626 gtcgtccgcaagtctcagcgggtcgaagctgcccccggggtagatggggtcggtcacctc 567 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 || || || ||||| ||| |||||| ||||| | | ||||||||| | |||||||| Sbjct: 566 tcccagaggaccgcccgcaatacggtatccctccacggcgcccatgaggatgacctggca 507 Query: 498 tgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgag 557 ||||||||| || || |||||||||||||| |||| | | ||||| ||||||||||| || Sbjct: 506 tgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcccaggtagtcaag 447 Query: 558 gccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||| ||||| || || ||||||||| Sbjct: 446 ccctccctcgctgaaaatctgagctcccgccttgaac 410
>gb|AY617085.1| Pinus merkusii chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 129 bits (65), Expect = 1e-26 Identities = 269/337 (79%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | ||||| || |||||||| ||||||||||||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtcctttcccggtgacaatggcctgcacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | || |||||||||| |||||| ||||| ||||| ||| | |||||| Sbjct: 686 aaacatggccaaccgcccgttcttgatctccttcaccttcagctccgcgaaagcgtcagg 627 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctc 437 |||||| || || || || ||||||||| ||| || ||||||||| |||| |||| Sbjct: 626 gtcgtccgcaagtcccagcgggtcgaagctgcccccggggtagatggggtcggtcacctc 567 Query: 438 accgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggca 497 || || || ||||| ||| |||||| ||||| | | ||||||||| | |||||||| Sbjct: 566 tcccagaggaccgcccgcaatacggtatccctccacggcgcccatgaggatgacctggca 507 Query: 498 tgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgag 557 ||||||||| || || |||||||||||||| |||| | | ||||| || |||||||| || Sbjct: 506 tgcccagattgcaagaatgctctgcgcgtgaaccaagctagggtttcctaggtagtcaag 447 Query: 558 gccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||| ||||| || || ||||||||| Sbjct: 446 ccctccctcgctgaaaatctgagctcccgccttgaac 410
>gb|M37489.1|PINCABII2 Pinus sylvestris chlorophyll a/b-binding protein (Cab) mRNA, partial cds Length = 583 Score = 129 bits (65), Expect = 1e-26 Identities = 104/117 (88%) Strand = Plus / Minus Query: 478 cccatgagcaccacctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttg 537 |||||||| || |||||||| ||||||||||| || |||||||||||||| | ||||||| Sbjct: 163 cccatgagaacaacctggcaggcccagatggctagaatgctctgcgcgtggatcaggttg 104 Query: 538 gggttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||||| ||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 103 gggttccccaggtagtcaaggcctccctctgagaatatctgcgccccggccttgaac 47 Score = 95.6 bits (48), Expect = 2e-16 Identities = 168/208 (80%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 |||| ||||||||| ||||||| || |||||| || ||||| || | ||||||| ||| Sbjct: 441 cgaaattggtggcgtaggcccaggcattgttggcaacggggtccgccaagtggtcgtaga 382 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 | || |||| || ||||| ||||| ||||| ||||| |||||||| ||||||||||||| Sbjct: 381 gattttcaatggggcccttcccggtcacgattgcctgaacgaagaaaccgaacatggaga 322 Query: 320 acatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggt 379 ||||||| || || |||||||| | |||||| ||||| ||||| || | || |||| Sbjct: 321 acatggccagccgaccgttcttaatctccttcaccttcagctccgccttggcctcggggt 262 Query: 380 cgtcggcgaggccaagtgggtcgaaggc 407 ||||||| || || |||||||||||||| Sbjct: 261 cgtcggccagccccagtgggtcgaaggc 234
>gb|AF330793.1|AF330793 Chlamydomonas reinhardtii light-harvesting complex II protein precursor (cabII-2) mRNA, complete cds Length = 1068 Score = 129 bits (65), Expect = 1e-26 Identities = 125/145 (86%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| |||||||||||||||||||||||||| || |||||| Sbjct: 686 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatagccaggcgg 627 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 626 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 567 Query: 394 agtgggtcgaaggcgccacccgggt 418 || ||||| ||||| ||||| |||| Sbjct: 566 agggggtcaaaggcaccaccggggt 542 Score = 61.9 bits (31), Expect = 2e-06 Identities = 49/55 (89%) Strand = Plus / Minus Query: 540 gttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 |||||| ||||||| ||||||||||| | ||||||||| ||||||||||||||| Sbjct: 420 gttgccgaggtagttcaggccgccctcagcgaagatctgggcgccggccttgaac 366
>gb|DQ226825.1| Boechera divaricarpa isolate SLW-B-H09 mRNA sequence Length = 775 Score = 127 bits (64), Expect = 4e-26 Identities = 140/166 (84%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||| || || | | Sbjct: 627 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagccaaat 568 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| || | Sbjct: 567 ggtcggcgaggttctccaatggtccctttccggtgacgatggcttgaacgaagaatccaa 508 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||| | ||||| Sbjct: 507 acatagagaacatagccaaccttccgttcttgagctccktcacctt 462
>emb|BX821952.1|CNS0AABH Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL87ZD09 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 949 Score = 125 bits (63), Expect = 2e-25 Identities = 102/115 (88%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||||||||| | | Sbjct: 825 ttccggggacgaagttggtggcgaaggcccaagcgttgttgttaactgggtcggcaaaat 766 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaa 305 ||||| ||||||||| | ||||||||||||||||||||||| || |||||||| Sbjct: 765 ggtcggcgaggttctccaaaggtccctttccggtgacgatggcttgaacgaagaa 711
>gb|U51633.1|PPU51633 Pinus palustris type 1 light-harvesting chlorophyll a/b-binding polypeptide (Lhcb1) mRNA, partial cds Length = 414 Score = 125 bits (63), Expect = 2e-25 Identities = 138/163 (84%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 ||||||||||||| ||||||| ||||||||||| || |||||||| | ||| || || Sbjct: 275 cgaagttggtggcataggcccaggcgttgttgttaacggggtcggccaggtgatcagcga 216 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 ||||||| | ||||| || |||||||||||||||||||||||||| ||||||||||| | Sbjct: 215 ggttctcgatgggtcctttcccggtgacgatggcctgcacgaagaatccgaacatggaaa 156 Query: 320 acatggcgaggcggccgttcttgagctccttgaccttgagctc 362 ||||||| | || |||||||||| |||||| ||||| ||||| Sbjct: 155 acatggccaaccgcccgttcttgatctccttcaccttcagctc 113
>ref|NM_128995.2| Arabidopsis thaliana LHB1B1; chlorophyll binding AT2G34430 (LHB1B1) mRNA, complete cds Length = 1008 Score = 123 bits (62), Expect = 7e-25 Identities = 140/166 (84%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||| ||||||||||| || |||||||| ||||| || || | || Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 799 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| ||||||||| | |||||||||||||||||| |||||||| |||||||| || | Sbjct: 798 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaa 739 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 738 acatagagaacatagccaaccttccgttcttgagctccttcacctt 693
>gb|AF339687.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 851 Score = 123 bits (62), Expect = 7e-25 Identities = 140/166 (84%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||| ||||||||||| || |||||||| ||||| || || | || Sbjct: 796 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 737 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| ||||||||| | |||||||||||||||||| |||||||| |||||||| || | Sbjct: 736 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaa 677 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 676 acatagagaacatagccaaccttccgttcttgagctccttcacctt 631
>gb|AF326864.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At2g34430) mRNA, complete cds Length = 1019 Score = 123 bits (62), Expect = 7e-25 Identities = 140/166 (84%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||| ||||||||||| || |||||||| ||||| || || | || Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 799 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| ||||||||| | |||||||||||||||||| |||||||| |||||||| || | Sbjct: 798 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaa 739 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 738 acatagagaacatagccaaccttccgttcttgagctccttcacctt 693
>gb|AY120776.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 1003 Score = 123 bits (62), Expect = 7e-25 Identities = 140/166 (84%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||| ||||||||||| || |||||||| ||||| || || | || Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 799 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| ||||||||| | |||||||||||||||||| |||||||| |||||||| || | Sbjct: 798 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaa 739 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 738 acatagagaacatagccaaccttccgttcttgagctccttcacctt 693
>gb|DQ018376.1| Pinus krempfii chloroplast putative light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 752 Score = 123 bits (62), Expect = 7e-25 Identities = 140/166 (84%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | |||||||| |||||||||||||||||||||||||| ||||||||||| Sbjct: 743 gaggttctcgatgggtcccttgccggtgacgatggcctgcacgaagaatccgaacatgga 684 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagg 377 |||||||| | ||| ||||||||||||||||| ||||| ||||| ||| | ||| || Sbjct: 683 aaacatggccaagcgcccgttcttgagctccttcaccttcagctccgcgaacgcgtcggg 624 Query: 378 gtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatg 423 |||||| || || || | ||||||||| |||||| ||||||||| Sbjct: 623 gtcgtctgcaagtcccaaggggtcgaagctgccaccggggtagatg 578 Score = 60.0 bits (30), Expect = 9e-06 Identities = 96/118 (81%) Strand = Plus / Minus Query: 477 gcccatgagcaccacctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggtt 536 ||||||||| | ||||||| ||||||||| || || |||||||||||||| | ||| | Sbjct: 524 gcccatgaggatgacctggcttgcccagattgcaagaatgctctgcgcgtggataaggct 465 Query: 537 ggggttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||||| || || |||||| ||| ||||| || || ||||||||| Sbjct: 464 agggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 407
>gb|AF324693.2|AF324693 Arabidopsis thaliana At2g34430 (At2g34430/T31E10.23) mRNA, complete cds Length = 1009 Score = 123 bits (62), Expect = 7e-25 Identities = 140/166 (84%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||| ||||||||||| || |||||||| ||||| || || | || Sbjct: 864 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 805 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| ||||||||| | |||||||||||||||||| |||||||| |||||||| || | Sbjct: 804 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaa 745 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 744 acatagagaacatagccaaccttccgttcttgagctccttcacctt 699
>emb|BX819881.1|CNS0AA6O Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS41ZH03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 638 Score = 123 bits (62), Expect = 7e-25 Identities = 140/166 (84%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||| ||||||||||| || |||||||| ||||| || || | || Sbjct: 516 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 457 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| ||||||||| | |||||||||||||||||| |||||||| |||||||| || | Sbjct: 456 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaa 397 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 396 acatagagaacatagccaaccttccgttcttgagctccttcacctt 351
>dbj|D00571.1|PYPLHABBP Pyrus pyrifolia var. culta mRNA for light harvesting a/b binding protein, complete cds Length = 1055 Score = 123 bits (62), Expect = 7e-25 Identities = 134/158 (84%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| || ||||||||||| |||||||| | ||| Sbjct: 892 ccggggacgaagttggtggcgtaggcccaggcattgttgttcacggggtcggccaggtga 833 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| |||||||| | ||||| || || || ||||| ||||||||||||||||||||| Sbjct: 832 tcggcaaggttctcgatgggtcctttgcccgtcacgatcgcctgcacgaagaagccgaac 773 Query: 313 atggagaacatggcgaggcggccgttcttgagctcctt 350 |||||||||||||| | || |||||||||| |||||| Sbjct: 772 atggagaacatggccaaccgtccgttcttgatctcctt 735 Score = 75.8 bits (38), Expect = 1e-10 Identities = 80/94 (85%) Strand = Plus / Minus Query: 434 cctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacct 493 |||| |||||||| || || |||||||||||||||||||| |||||||| | |||| Sbjct: 651 cctctccgaggggcccacccgcaacacggtagccctcgatggcacccatgaggatgacct 592 Query: 494 ggcatgcccagatggcgaggatgctctgcgcgtg 527 |||||||||||||||| || |||||||| ||||| Sbjct: 591 ggcatgcccagatggcaagaatgctctgggcgtg 558
>gb|AY086307.1| Arabidopsis thaliana clone 23727 mRNA, complete sequence Length = 979 Score = 123 bits (62), Expect = 7e-25 Identities = 140/166 (84%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||| ||||||||||| || |||||||| ||||| || || | || Sbjct: 858 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 799 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| ||||||||| | |||||||||||||||||| |||||||| |||||||| || | Sbjct: 798 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaa 739 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 738 acatagagaacatagccaaccttccgttcttgagctccttcacctt 693
>emb|X64459.1|ATLHB1B1 A.thaliana Lhb1B1 gene for photosystem II type I chlorophyll a/b binding protein Length = 1301 Score = 123 bits (62), Expect = 7e-25 Identities = 140/166 (84%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||| ||||||||||| || |||||||| ||||| || || | || Sbjct: 1096 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 1037 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| ||||||||| | |||||||||||||||||| |||||||| |||||||| || | Sbjct: 1036 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaa 977 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 976 acatagagaacatagccaaccttccgttcttgagctccttcacctt 931
>gb|BT002103.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein. (At2g34430) mRNA, complete cds Length = 853 Score = 123 bits (62), Expect = 7e-25 Identities = 140/166 (84%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||| ||||||||||| || |||||||| ||||| || || | || Sbjct: 796 ttccggggacgaagttggtagcgaaggcccatgcattgttgttgactggatcagccaagt 737 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| ||||||||| | |||||||||||||||||| |||||||| |||||||| || | Sbjct: 736 ggtccgcgaggttctccaacggtccctttccggtgacaatggcctgaacgaagaatccaa 677 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | ||||||||||||||||| ||||| Sbjct: 676 acatagagaacatagccaaccttccgttcttgagctccttcacctt 631
>gb|AF104631.3| Chlamydomonas reinhardtii light harvesting complex II protein precursor (Lhcb3) mRNA, complete cds Length = 1314 Score = 121 bits (61), Expect = 3e-24 Identities = 82/89 (92%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||| |||||| Sbjct: 758 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccaggcgg 699 Query: 334 ccgttcttgagctccttgaccttgagctc 362 |||||||||| |||||| ||||| ||||| Sbjct: 698 ccgttcttgatctccttcaccttcagctc 670 Score = 89.7 bits (45), Expect = 1e-14 Identities = 78/89 (87%) Strand = Plus / Minus Query: 506 tggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccct 565 |||| |||||| ||| |||||||||||| |||||||||||||||||| |||||||||| Sbjct: 523 tggccaggatggactgggcgtgcaccaggccggggttgcccaggtagtccaggccgccct 464 Query: 566 cggagaagatctgcgcgccggccttgaac 594 ||| ||||||||| || || ||||||||| Sbjct: 463 cggcgaagatctgagcaccagccttgaac 435
>gb|M97171.1|SOYCAB6A Glycine max chlorophyll a/b binding protein type II (Cab-6) gene, complete cds; nuclear gene for chloroplast product Length = 1322 Score = 121 bits (61), Expect = 3e-24 Identities = 244/305 (80%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| || ||||| |||||||| || ||||| || |||||||||||||| || | ||| Sbjct: 1025 cccttgccagtgacaatggcctgaacaaagaaaccaaacatggagaacatagccaagcga 966 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 ||||||||||| ||||||||||| | ||| ||| || |||||||| || || || ||| Sbjct: 965 ccgttcttgagttccttgaccttcaactcagcgaatgcatcagggtcatcagccagacca 906 Query: 394 agtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcaccgaggggtccgcca 453 || ||||| || || ||||| |||||||| ||| || || ||||| |||||||| ||| Sbjct: 905 agagggtcaaatgcaccaccagggtagatagggtcaagtccttcaccaaggggtcctcca 846 Query: 454 ccaacacggtagccctcgatgaagcccatgagcaccacctggcatgcccagatggcgagg 513 ||||| | ||| || || | || ||||||||||| ||||| ||||||||||| ||| Sbjct: 845 ccaactctgtaaccttcaacaaaacccatgagcacaacctgaacagcccagatggcaagg 786 Query: 514 atgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaag 573 ||||| || || || | |||||| |||||||||| |||||| || || ||||| |||||| Sbjct: 785 atgctttgagcatggatcaggtttgggttgcccaagtagtcaagtcctccctccgagaag 726 Query: 574 atctg 578 ||||| Sbjct: 725 atctg 721
>emb|X81808.1|PALHCB1 P.abies (L.)Karst. Lhcb1*1 mRNA for light-harvesting chlorophyll a/b-binding protein Length = 1078 Score = 121 bits (61), Expect = 3e-24 Identities = 136/161 (84%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||||||| ||||||| ||||||||||| || ||||| |||| ||| ||| |||| Sbjct: 822 aagttggtggcgtaggcccaggcgttgttgttgacagggtcagcgaggtgatcggcgagg 763 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||| || || || ||||||||||| |||||||| ||||||||||||||| Sbjct: 762 ttctctaggggtcctttgcctgtcacgatggcctggacgaagaacccgaacatggagaac 703 Query: 322 atggcgaggcggccgttcttgagctccttgaccttgagctc 362 ||||| | || |||||||| |||||||| ||||| ||||| Sbjct: 702 atggccaaccgcccgttctttagctccttcaccttcagctc 662 Score = 73.8 bits (37), Expect = 6e-10 Identities = 124/153 (81%) Strand = Plus / Minus Query: 442 aggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggcatgcc 501 |||||||| || |||||||||||||||| ||| |||||||| | |||||||||||| Sbjct: 582 aggggtccacccgcaacacggtagccctcaatggcacccatgaggatgacctggcatgcc 523 Query: 502 cagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccg 561 ||||||| || |||||||| ||||| | | || ||| ||||||||||||| || || Sbjct: 522 aagatggcaagaatgctctgtgcgtggattaaatttgggctgcccaggtagtcaagccct 463 Query: 562 ccctcggagaagatctgcgcgccggccttgaac 594 |||||| ||||||||| || || ||||||||| Sbjct: 462 ccctcgctgaagatctgagctcccgccttgaac 430
>gb|M30620.1|TOMCBPE2 Tomato chlorophyll a/b-binding protein Cab-3A gene, 3' end Length = 351 Score = 121 bits (61), Expect = 3e-24 Identities = 136/161 (84%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||| ||||| |||||||| ||||||||||| ||||||||||| ||||||||| ||| Sbjct: 335 aagtttgtggcaaaggcccaggcgttgttgttaactgggtcggcaatgtggtcggcaagg 276 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | || |||||||||||||| || || || || ||||| || |||||||||||| Sbjct: 275 ttctccaatggaccctttccggtgacaatagcttgaacaaagaatccaaacatggagaac 216 Query: 322 atggcgaggcggccgttcttgagctccttgaccttgagctc 362 || || || | ||||||||||| |||||| ||||||||||| Sbjct: 215 atagcaagtctgccgttcttgatctcctttaccttgagctc 175
>emb|X63197.1|HVLHBC H.vulgare lhbC mRNA for type III LHCII CAB precursor protein Length = 928 Score = 119 bits (60), Expect = 1e-23 Identities = 141/168 (83%) Strand = Plus / Minus Query: 238 gggtcggcgatgtggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgc 297 |||||| ||| ||||||||| |||||||| | || ||||| ||||||||||| || ||| Sbjct: 785 gggtcgtcgaggtggtcgaacaggttctccaatgggcccttgccggtgacgatagcttgc 726 Query: 298 acgaagaagccgaacatggagaacatggcgaggcggccgttcttgagctccttgaccttg 357 |||||||| |||||||| ||||||||||| || ||||| ||||||| |||||| ||||| Sbjct: 725 acgaagaacccgaacatagagaacatggcaagacggccattcttgatctccttcacctta 666 Query: 358 agctcggcggctgtgtcagggtcgtcggcgaggccaagtgggtcgaag 405 ||||| ||| || ||||||||||||| ||||| || ||||||||| Sbjct: 665 agctccgcgaaggtaacagggtcgtcggcaaggccgagcgggtcgaag 618 Score = 87.7 bits (44), Expect = 4e-14 Identities = 74/84 (88%) Strand = Plus / Minus Query: 511 aggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggag 570 ||||||||||||||||| || ||||||||||| || ||||| ||||| || ||||| ||| Sbjct: 509 aggatgctctgcgcgtggacaaggttggggttcccaaggtaatcgagaccaccctcagag 450 Query: 571 aagatctgcgcgccggccttgaac 594 |||||||| | ||||||||||||| Sbjct: 449 aagatctgagagccggccttgaac 426
>emb|X54090.1|GHCAB G.hirsutum cab gene for chlorophyll ab binding protein Length = 1746 Score = 117 bits (59), Expect = 4e-23 Identities = 260/327 (79%) Strand = Plus / Minus Query: 249 gtggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagcc 308 ||||||||| |||||||| | || |||||||| ||||| || ||||| |||||||| || Sbjct: 1278 gtggtcgaaaaggttctcgatgggaccctttccagtgacaatagcctggacgaagaaccc 1219 Query: 309 gaacatggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggc 368 |||||||||||||| || |||||||||||||||| |||||| ||||| | || ||| Sbjct: 1218 aaacatggagaacattgccaggcggccgttcttgatctccttaaccttcaattccgcgaa 1159 Query: 369 tgtgtcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtc 428 | |||||||| || || | ||||| ||||| || || ||||| ||||| || ||| Sbjct: 1158 ggcatcagggtcatcagccaatccaagcgggtcaaaagcaccacctgggtaaattgggtc 1099 Query: 429 gaggccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcac 488 ||| || |||||||| ||||| |||||||| | ||| || || | || ||||||||||| Sbjct: 1098 gagtccttcaccgagtggtccaccaccaactctgtacccttcaacaaatcccatgagcac 1039 Query: 489 cacctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccag 548 || ||||| |||||||| || || || ||||| || || | ||||| |||||||| || Sbjct: 1038 aacttggcaagcccagatagcaagaatactctgagcatggatgaggtttgggttgccgag 979 Query: 549 gtagtcgaggccgccctcggagaagat 575 ||||| ||||| |||||||||||||| Sbjct: 978 atagtcaaggccaccctcggagaagat 952
>emb|X16436.1|SACAB Mustard cab gene for chlorophyll a/b-binding protein Length = 2774 Score = 113 bits (57), Expect = 7e-22 Identities = 114/133 (85%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||| || || | | Sbjct: 2371 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagccaaat 2312 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||| ||||| | ||||||||||||||||||||| ||||| || ||||| || | Sbjct: 2311 ggtcggcgagattctccaacggtccctttccggtgacgatagcctgaacaaagaatccaa 2252 Query: 311 acatggagaacat 323 |||| |||||||| Sbjct: 2251 acatagagaacat 2239 Score = 48.1 bits (24), Expect = 0.033 Identities = 78/96 (81%) Strand = Plus / Minus Query: 499 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgagg 558 ||||| ||||| | ||||||||| ||||| |||| | | |||||||||| |||||| || Sbjct: 2060 gcccaaatggctaagatgctctgagcgtggaccaagcttgggttgcccaagtagtcaagt 2001 Query: 559 ccgccctcggagaagatctgcgcgccggccttgaac 594 || || ||| ||||||||| | |||||||||||| Sbjct: 2000 cctccttcgctgaagatctgtgaaccggccttgaac 1965
>emb|X74732.1|AHLHAH A.hypochondriacus Lhcb2*Ah1 mRNA Length = 1152 Score = 113 bits (57), Expect = 7e-22 Identities = 252/317 (79%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||||||| | ||||| || ||||| ||||||||| || | ||| ||| | ||| Sbjct: 948 aagttggtggcgtaagcccaggcattgttagccactgggtcagcaaggtgatcggaaagg 889 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||||| || ||||||||||| || || || || || ||||| ||||||||||||||| Sbjct: 888 ttctcaatgggaccctttccggtaacaatagcttgaacaaagaacccgaacatggagaac 829 Query: 322 atggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcg 381 || || || | |||||||||||||| || ||||| ||||| || | || |||||| Sbjct: 828 atagctagtctcccgttcttgagctcttttaccttcagctcagcaaaggcatctgggtcg 769 Query: 382 tcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcaccg 441 || || | ||||||||||| || || ||||| |||||||| |||| || ||||| || Sbjct: 768 tctgccaaaccaagtgggtcaaaagctccaccagggtagatcttgtcaagtccctcgccc 709 Query: 442 aggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggcatgcc 501 | ||| || |||||||||||||||||||| || || |||||||| || || ||||| ||| Sbjct: 708 aagggcccaccaccaacacggtagccctcaatcaaacccatgaggacaacttggcaagcc 649 Query: 502 cagatggcgaggatgct 518 ||||| ||||| ||||| Sbjct: 648 cagatagcgagaatgct 632
>emb|X15894.1|SACAB1 Sinapsis alba cab-1 gene for chlorophyll a/b-binding polypeptide Length = 2775 Score = 113 bits (57), Expect = 7e-22 Identities = 114/133 (85%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||||||||||||||| ||||||||||| ||||| || || | | Sbjct: 2372 ttccggggacgaagttggtggcgaaggcccatgcgttgttgttgactggatcagccaaat 2313 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| ||| ||||| | ||||||||||||||||||||| ||||| || ||||| || | Sbjct: 2312 ggtcggcgagattctccaacggtccctttccggtgacgatagcctgaacaaagaatccaa 2253 Query: 311 acatggagaacat 323 |||| |||||||| Sbjct: 2252 acatagagaacat 2240 Score = 48.1 bits (24), Expect = 0.033 Identities = 78/96 (81%) Strand = Plus / Minus Query: 499 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgagg 558 ||||| ||||| | ||||||||| ||||| |||| | | |||||||||| |||||| || Sbjct: 2061 gcccaaatggctaagatgctctgagcgtggaccaagcttgggttgcccaagtagtcaagt 2002 Query: 559 ccgccctcggagaagatctgcgcgccggccttgaac 594 || || ||| ||||||||| | |||||||||||| Sbjct: 2001 cctccttcgctgaagatctgtgaaccggccttgaac 1966
>gb|M23532.1|PCPCBP P.patens major chlorophyll binding protein gene, complete cds Length = 2544 Score = 113 bits (57), Expect = 7e-22 Identities = 102/117 (87%) Strand = Plus / Minus Query: 478 cccatgagcaccacctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttg 537 ||||| ||||||||||||||||||||||| || | |||||||| |||||||||||| || Sbjct: 2151 cccatcagcaccacctggcatgcccagatcgccaaaatgctctgagcgtgcaccaggctg 2092 Query: 538 gggttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||||||||||||||| | || |||||| ||||||||| || |||||||||||| Sbjct: 2091 gggttgcccaggtagtccaaccccccctcgctgaagatctgagctccggccttgaac 2035 Score = 63.9 bits (32), Expect = 6e-07 Identities = 132/164 (80%), Gaps = 1/164 (0%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 ||||||| |||||||||| || | ||||| ||||||||| ||| ||||| || | |||| Sbjct: 2435 ccgggggtgaagttggtg-cgtacgcccatgcgttgttggccaccgggtccgccaagtgg 2377 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 ||| | |||||| | || ||||||||||| ||||| |||||||||||||| |||||| Sbjct: 2376 tcgttcaagttctccaatgggccctttccggtcacgatcgcctgcacgaagaacccgaac 2317 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgacctt 356 || || ||||| || | || ||||| |||| |||||| ||||| Sbjct: 2316 atcgaaaacatcgccaatcgcccgtttttgatctccttcacctt 2273
>gb|AY646197.1| Chlorella pyrenoidosa chloroplast light-harvesting complex II (Lhc II) mRNA, partial cds; nuclear gene for chloroplast product Length = 537 Score = 109 bits (55), Expect = 1e-20 Identities = 136/163 (83%) Strand = Plus / Minus Query: 280 ccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcggccgttc 339 ||||| |||||||||||||||||||||||||||||| ||||||||| || || |||||| Sbjct: 470 ccggtcacgatggcctgcacgaagaagccgaacatgctgaacatggccagacgaccgttc 411 Query: 340 ttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggccaagtggg 399 |||| |||||| ||||||||||| || ||||| |||||||| || || || || ||| Sbjct: 410 ttgatctccttcaccttgagctcagccagggtgtcggggtcgtcagccagacccagaggg 351 Query: 400 tcgaaggcgccacccgggtagatgatgtcgaggccctcaccga 442 || ||||| ||||| ||||| | | |||| ||| ||||||||| Sbjct: 350 tcaaaggcaccacctgggtacaggctgtccaggtcctcaccga 308 Score = 40.1 bits (20), Expect = 8.1 Identities = 23/24 (95%) Strand = Plus / Minus Query: 511 aggatgctctgcgcgtgcaccagg 534 ||||||||||| |||||||||||| Sbjct: 230 aggatgctctgggcgtgcaccagg 207
>gb|AF495472.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m6 mRNA, complete cds; nuclear gene for chloroplast product Length = 1094 Score = 109 bits (55), Expect = 1e-20 Identities = 112/131 (85%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| |||||||||||||||||||||||| || |||||| Sbjct: 713 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacgatgccaggcgg 654 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 653 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 594 Query: 394 agtgggtcgaa 404 || |||||||| Sbjct: 593 agggggtcgaa 583 Score = 97.6 bits (49), Expect = 4e-17 Identities = 79/89 (88%) Strand = Plus / Minus Query: 506 tggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccct 565 |||||| |||| |||| |||||||| || |||||||||||||||||| |||||||||| Sbjct: 481 tggcgacgatgttctgggcgtgcacgagagaggggttgcccaggtagtccaggccgccct 422 Query: 566 cggagaagatctgcgcgccggccttgaac 594 | ||||||||||| ||||||||||||||| Sbjct: 421 cagagaagatctgggcgccggccttgaac 393
>emb|Y13865.1|BVCHLOROP Beta vulgaris mRNA for chlorophyll a/b-binding protein Length = 1036 Score = 109 bits (55), Expect = 1e-20 Identities = 136/163 (83%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 ||||||||||||| |||||||| || ||||| ||||||||| || | |||||| ||| Sbjct: 859 cgaagttggtggcaaaggcccaggcattgttagccactgggtcagcaaggtggtctgaga 800 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 ||||||||| || |||||||| || || || || ||||||||||| ||||||||||||| Sbjct: 799 ggttctcaatgggaccctttccagtaacaatagcttgcacgaagaacccgaacatggaga 740 Query: 320 acatggcgaggcggccgttcttgagctccttgaccttgagctc 362 |||| || | | ||||||||||||||||| ||||||||||| Sbjct: 739 acatagccaatcttccgttcttgagctccttaaccttgagctc 697 Score = 79.8 bits (40), Expect = 9e-12 Identities = 133/164 (81%) Strand = Plus / Minus Query: 391 ccaagtgggtcgaaggcgccacccgggtagatgatgtcgaggccctcaccgaggggtccg 450 ||||||||||| || || ||||| ||||||| ||||||| || ||||| | || || Sbjct: 668 ccaagtgggtcaaaagctccacctgggtagagcttgtcgagcccttcacccaatggccca 609 Query: 451 ccaccaacacggtagccctcgatgaagcccatgagcaccacctggcatgcccagatggcg 510 ||||||||||||||||||||||| || ||||| || || || |||| |||||||| || Sbjct: 608 ccaccaacacggtagccctcgatcaaacccataaggactacttggctagcccagatagca 549 Query: 511 aggatgctctgcgcgtgcaccaggttggggttgcccaggtagtc 554 |||||||| || || || | |||||| |||||||| |||||||| Sbjct: 548 aggatgctttgggcatggatcaggtttgggttgcctaggtagtc 505
>emb|X69434.1|CSCAB1 C.stellata cab1 mRNA for chlorophyll a/b binding protein Length = 1067 Score = 109 bits (55), Expect = 1e-20 Identities = 139/167 (83%) Strand = Plus / Minus Query: 286 acgatggcctgcacgaagaagccgaacatggagaacatggcgaggcggccgttcttgagc 345 |||||||||||||| |||||||||||||||| | |||||| | |||||||||||| ||| Sbjct: 678 acgatggcctgcactaagaagccgaacatggcggccatggccatgcggccgttcttcagc 619 Query: 346 tccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggccaagtgggtcgaag 405 ||||| ||||| ||||| || ||||| ||||||||||| ||||| || ||||||||| Sbjct: 618 tccttcaccttcagctcagccagggtgtcggggtcgtcggccaggcccagggggtcgaag 559 Query: 406 gcgccacccgggtagatgatgtcgaggccctcaccgaggggtccgcc 452 || || || ||||| | | ||| ||||||||||| ||||| ||||| Sbjct: 558 gcaccgccggggtacagggggtccaggccctcacccagggggccgcc 512 Score = 67.9 bits (34), Expect = 4e-08 Identities = 70/82 (85%) Strand = Plus / Minus Query: 513 gatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaa 572 ||||||||| |||||||||||||| |||||||||||||| ||||||||||| ||| Sbjct: 451 gatgctctgggcgtgcaccaggttctcgttgcccaggtagttcaggccgccctccttgaa 392 Query: 573 gatctgcgcgccggccttgaac 594 ||||| |||||| |||||||| Sbjct: 391 gatctcggcgccgaccttgaac 370
>gb|AF104630.1|AF104630 Chlamydomonas reinhardtii light harvesting complex II protein precursor (Lhcb2) mRNA, complete cds Length = 1200 Score = 109 bits (55), Expect = 1e-20 Identities = 112/131 (85%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| ||||||||||||||||||||||||||||| | | | Sbjct: 710 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacatggccaaggcg 651 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 650 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 591 Query: 394 agtgggtcgaa 404 || |||||||| Sbjct: 590 agggggtcgaa 580 Score = 105 bits (53), Expect = 2e-19 Identities = 80/89 (89%) Strand = Plus / Minus Query: 506 tggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccct 565 |||||| |||| |||| ||||||||||| |||||||||||||||||| |||||||||| Sbjct: 478 tggcgacgatgttctgggcgtgcaccagagaggggttgcccaggtagtccaggccgccct 419 Query: 566 cggagaagatctgcgcgccggccttgaac 594 | ||||||||||| ||||||||||||||| Sbjct: 418 cagagaagatctgggcgccggccttgaac 390
>gb|M24072.1|CRECABA C.reinhardtii encoding chlorophyll a/b-binding protein (cabII-1) gene, complete cds Length = 2290 Score = 109 bits (55), Expect = 1e-20 Identities = 112/131 (85%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| ||||||||||| |||||||||||||||||||||||| || |||||| Sbjct: 1734 cccttgccggtcacgatggcctggacgaagaagccgaacatggagaacgatgccaggcgg 1675 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 1674 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 1615 Query: 394 agtgggtcgaa 404 || |||||||| Sbjct: 1614 agggggtcgaa 1604 Score = 97.6 bits (49), Expect = 4e-17 Identities = 79/89 (88%) Strand = Plus / Minus Query: 506 tggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccct 565 |||||| |||| |||| |||||||| || |||||||||||||||||| |||||||||| Sbjct: 1256 tggcgacgatgttctgggcgtgcacgagagaggggttgcccaggtagtccaggccgccct 1197 Query: 566 cggagaagatctgcgcgccggccttgaac 594 | ||||||||||| ||||||||||||||| Sbjct: 1196 cagagaagatctgggcgccggccttgaac 1168
>emb|X13407.1|PTCAB Pinus thunbergii cab mRNA for light-harvesting chlorophyll a/b binding protein Length = 978 Score = 107 bits (54), Expect = 4e-20 Identities = 104/118 (88%), Gaps = 2/118 (1%) Strand = Plus / Minus Query: 478 cccatgagcaccacctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttg 537 |||||||| || |||||||| ||||||||||| || |||||||||||||| | ||||||| Sbjct: 558 cccatgagaacaacctggcaggcccagatggctagaatgctctgcgcgtggatcaggttg 499 Query: 538 gggttgcccag-gtagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||| |||||| ||||| ||||| ||||| |||||||| |||||||||||| Sbjct: 498 gggtt-cccagcgtagtcaaggcctccctctgagaatatctgcgccccggccttgaac 442 Score = 95.6 bits (48), Expect = 2e-16 Identities = 168/208 (80%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 |||| ||||||||| ||||||| || |||||| || ||||| || | ||||||| ||| Sbjct: 836 cgaaattggtggcgtaggcccaggcattgttggcaacggggtccgccaagtggtcgtaga 777 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 | || |||| || ||||| ||||| ||||| ||||| |||||||| ||||||||||||| Sbjct: 776 gattttcaatggggcccttcccggtcacgattgcctgaacgaagaaaccgaacatggaga 717 Query: 320 acatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggt 379 ||||||| || || |||||||| | ||| || ||||| ||||| ||| | || |||| Sbjct: 716 acatggccagccgaccgttcttaatctctttcaccttcagctccgcgcaggcctcggggt 657 Query: 380 cgtcggcgaggccaagtgggtcgaaggc 407 ||||||| || || |||||||||||||| Sbjct: 656 cgtcggccagccccagtgggtcgaaggc 629
>dbj|AP008949.1| Lotus japonicus genomic DNA, chromosome 2, clone:LjT44M23, TM1572a, complete sequence Length = 48924 Score = 107 bits (54), Expect = 4e-20 Identities = 243/306 (79%) Strand = Plus / Minus Query: 289 atggcctgcacgaagaagccgaacatggagaacatggcgaggcggccgttcttgagctcc 348 |||||||| || |||||||| |||||||||||||| || | || ||||||||||| ||| Sbjct: 40600 atggcctgaacaaagaagccaaacatggagaacattgccaatcgaccgttcttgagttcc 40541 Query: 349 ttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggccaagtgggtcgaaggcg 408 || ||||| | ||| || || |||||||| || || | ||||||||||| ||||| Sbjct: 40540 ttcaccttcaactctgcaaatgcatcagggtcatcagccaaaccaagtgggtcaaaggca 40481 Query: 409 ccacccgggtagatgatgtcgaggccctcaccgaggggtccgccaccaacacggtagccc 468 ||||| ||||| | ||| || || ||||| |||||||| |||||||| | |||||| Sbjct: 40480 ccacctgggtaaagtgggtctagtccttcaccaaggggtcctccaccaaccctgtagcct 40421 Query: 469 tcgatgaagcccatgagcaccacctggcatgcccagatggcgaggatgctctgcgcgtgc 528 || || || ||||||||||| ||||| |||||||| || ||||||||||| || || Sbjct: 40420 tcaattaatcccatgagcacaacctgagtagcccagattgcaaggatgctctgagcatgg 40361 Query: 529 accaggttggggttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggcc 588 | |||||| |||||||| | ||||| ||||| ||||| ||||||||||| || || ||| Sbjct: 40360 atcaggtttgggttgcctaaatagtcaaggccaccctcagagaagatctgggcaccagcc 40301 Query: 589 ttgaac 594 |||||| Sbjct: 40300 ttgaac 40295
>gb|AY617093.1| Pinus remota chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 105 bits (53), Expect = 2e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | |||||||| ||||||||||||||||| |||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtcccttcccggtgacgatggcctgaacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctc 362 |||||||| | ||| |||||||||| |||||| ||||| ||||| Sbjct: 686 aaacatggccaagcgcccgttcttgatctccttcaccttcagctc 642 Score = 60.0 bits (30), Expect = 9e-06 Identities = 96/118 (81%) Strand = Plus / Minus Query: 477 gcccatgagcaccacctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggtt 536 ||||||||| | ||||||||||||||||| || || || ||||||||||| | ||| | Sbjct: 527 gcccatgaggatgacctggcatgcccagattgcaagaatactctgcgcgtggataaggct 468 Query: 537 ggggttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||||| || || |||||| ||| ||||| || || ||||||||| Sbjct: 467 agggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410
>gb|AY617092.1| Pinus monophylla chloroplast light harvesting chlorophyll a/b binding protein (ifg1934) gene, partial cds; nuclear gene for chloroplast product Length = 770 Score = 105 bits (53), Expect = 2e-19 Identities = 92/105 (87%) Strand = Plus / Minus Query: 258 gaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatgga 317 ||||||||| | |||||||| ||||||||||||||||| |||||||| ||||||||||| Sbjct: 746 gaggttctcgatgggtcccttcccggtgacgatggcctgkacgaagaatccgaacatgga 687 Query: 318 gaacatggcgaggcggccgttcttgagctccttgaccttgagctc 362 |||||||| | ||| |||||||||| |||||| ||||| ||||| Sbjct: 686 aaacatggccaagcgcccgttcttgatctccttcaccttcagctc 642 Score = 67.9 bits (34), Expect = 4e-08 Identities = 97/118 (82%) Strand = Plus / Minus Query: 477 gcccatgagcaccacctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggtt 536 ||||||||| | ||||||||||||||||| || || |||||||||||||| | ||| | Sbjct: 527 gcccatgaggatgacctggcatgcccagattgcaagaatgctctgcgcgtggataaggct 468 Query: 537 ggggttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||||||||| || || |||||| ||| ||||| || || ||||||||| Sbjct: 467 agggtttcccaggtagtcaagccctccctcgctgaaaatctgagctcccgccttgaac 410
>emb|AJ538464.1|NTA538464 Nicotiana tabacum cDNA-AFLP-fragment BC2-M14-017 Length = 330 Score = 105 bits (53), Expect = 2e-19 Identities = 80/89 (89%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||||||||||||||| ||||| |||||||| || ||||||||||||||||| || | | Sbjct: 289 ccctttccggtgacgatagcctgaacgaagaatccaaacatggagaacatggcaagtctg 230 Query: 334 ccgttcttgagctccttgaccttgagctc 362 |||||||||| |||||| ||||||||||| Sbjct: 229 ccgttcttgatctcctttaccttgagctc 201
>gb|M21397.1|TOBCABA Tobacco chlorophyll a/b-binding protein (Cab-C) gene, complete cds Length = 1240 Score = 105 bits (53), Expect = 2e-19 Identities = 80/89 (89%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||||||||||||||| ||||| |||||||| || ||||||||||||||||| || | | Sbjct: 1152 ccctttccggtgacgatagcctgaacgaagaatccaaacatggagaacatggcaagtctg 1093 Query: 334 ccgttcttgagctccttgaccttgagctc 362 |||||||||| |||||| ||||||||||| Sbjct: 1092 ccgttcttgatctcctttaccttgagctc 1064
>gb|AY389606.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 40 mRNA, complete cds Length = 859 Score = 103 bits (52), Expect = 6e-19 Identities = 85/96 (88%) Strand = Plus / Minus Query: 499 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgagg 558 ||||||||||| ||||||||||||||||| || ||| ||||||||||||||||||| | Sbjct: 542 gcccagatggccaggatgctctgcgcgtggacgaggctggggttgcccaggtagtccaat 483 Query: 559 ccgccctcggagaagatctgcgcgccggccttgaac 594 ||||||||| ||||||||| || |||||||||||| Sbjct: 482 ccgccctcgctgaagatctgggctccggccttgaac 447 Score = 65.9 bits (33), Expect = 1e-07 Identities = 63/73 (86%) Strand = Plus / Minus Query: 333 gccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcc 392 ||||||||||| |||||| ||||| ||||||||| | || ||||||||||||||||| Sbjct: 710 gccgttcttgatctccttcaccttcagctcggcgaaggcctcggggtcgtcggcgaggcc 651 Query: 393 aagtgggtcgaag 405 ||| ||||||||| Sbjct: 650 aagcgggtcgaag 638
>emb|X12981.1|GMCAB3 Soybean Cab3 gene for PSII LHCII chlorophyll a/b binding protein Length = 1361 Score = 103 bits (52), Expect = 6e-19 Identities = 142/172 (82%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| ||||||||||||| ||||||| ||||||||||| || || | || | || Sbjct: 1037 ttccggggacgaagttggtggcataggcccaggcgttgttgttgacaggtccagcaaggt 978 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 | ||| ||||||||| | || |||||||||||||| |||||||| || |||||||| | Sbjct: 977 gatcggcgaggttctccaatggaccctttccggtgacaatggcctgaacaaagaagccaa 918 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgaccttgagctc 362 |||| ||||||||||| | || ||||||||||| ||||| ||||| ||||| Sbjct: 917 acatagagaacatggccaatcgtccgttcttgagttccttcaccttaagctc 866 Score = 87.7 bits (44), Expect = 4e-14 Identities = 83/96 (86%) Strand = Plus / Minus Query: 499 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgagg 558 ||||||||||||||||||||||| ||||| | |||| | |||||||||| ||||||||| Sbjct: 729 gcccagatggcgaggatgctctgggcgtggatcaggcttgggttgcccaagtagtcgagc 670 Query: 559 ccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||||||||| | |||||||||||| Sbjct: 669 ccaccctcgctgaagatctgggacccggccttgaac 634
>ref|NM_102733.2| Arabidopsis thaliana CAB1 (CHLOROPHYLL A/B BINDING PROTEIN 1); chlorophyll binding AT1G29930 (CAB1) mRNA, complete cds Length = 1044 Score = 101 bits (51), Expect = 3e-18 Identities = 129/155 (83%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||||||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 795 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 794 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 735 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 734 atagccaatcttccgttcttgagctccttcacctt 700
>gb|AY091169.1| Arabidopsis thaliana putative chlorophyll a/b-binding protein (At1g29930) mRNA, complete cds Length = 835 Score = 101 bits (51), Expect = 3e-18 Identities = 129/155 (83%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||||||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 788 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 729 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 728 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 669 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 668 atagccaatcttccgttcttgagctccttcacctt 634
>gb|AY050935.1| Arabidopsis thaliana putative photosystem II type I chlorophyll a/b binding protein (At1g29930) mRNA, complete cds Length = 1014 Score = 101 bits (51), Expect = 3e-18 Identities = 129/155 (83%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||||||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 795 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 794 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 735 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 734 atagccaatcttccgttcttgagctccttcacctt 700
>gb|AY058180.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1019 Score = 101 bits (51), Expect = 3e-18 Identities = 129/155 (83%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||||||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 795 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 794 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 735 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 734 atagccaatcttccgttcttgagctccttcacctt 700
>gb|AF428359.1|AF428359 Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 1045 Score = 101 bits (51), Expect = 3e-18 Identities = 129/155 (83%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||||||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 795 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 794 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 735 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 734 atagccaatcttccgttcttgagctccttcacctt 700
>gb|AY045673.1| Arabidopsis thaliana At1g29930/F1N18_23 mRNA, complete cds Length = 999 Score = 101 bits (51), Expect = 3e-18 Identities = 129/155 (83%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||||||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 854 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 795 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 794 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 735 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 734 atagccaatcttccgttcttgagctccttcacctt 700
>emb|BX815726.1|CNS0ACD7 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS89ZA03 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 930 Score = 101 bits (51), Expect = 3e-18 Identities = 129/155 (83%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||||||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 823 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 764 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 763 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 704 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 703 atagccaatcttccgttcttgagctccttcacctt 669
>gb|AC022455.5|AC022455 Arabidopsis thaliana chromosome 1 BAC T1P2 genomic sequence, complete sequence Length = 82053 Score = 101 bits (51), Expect = 3e-18 Identities = 129/155 (83%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||||||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 734 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 675 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 674 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 615 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 614 atagccaatcttccgttcttgagctccttcacctt 580
>gb|AC008030.4|AC008030 Arabidopsis thaliana chromosome I BAC F1N18 genomic sequence, complete sequence Length = 101075 Score = 101 bits (51), Expect = 3e-18 Identities = 129/155 (83%) Strand = Plus / Plus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||||||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 16127 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 16186 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 16187 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 16246 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 16247 atagccaatcttccgttcttgagctccttcacctt 16281 Score = 93.7 bits (47), Expect = 6e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| |||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 19880 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 19821 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 19820 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 19761 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 19760 atagccaatcttccgttcttgagctcctttacctt 19726 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||| ||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 22526 aagttggttgcgaaggcccatgcgttgttgttgactggatcggccaaatggtcagcaagg 22467 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||| ||||| || |||||||| || ||||| |||||| Sbjct: 22466 ttctctatcggtcccttaccagtgacaatggcttgaacgaagaatccaaacatagagaac 22407 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 22406 atagccaatcttccgttcttgagctccttcacctt 22372
>emb|X03909.1|ATLHCP3 A.thaliana gene (LHCP AB 140) for chlorophyll a/b binding protein Length = 1109 Score = 101 bits (51), Expect = 3e-18 Identities = 129/155 (83%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||||||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 1005 aagttggtggcgaaggcccatgcgttgttgttaactggatcggccaaatggtcagcaagg 946 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 945 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 886 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 885 atagccaatcttccgttcttgagctccttcacctt 851
>gb|AY105650.1| Zea mays PCO135935 mRNA sequence Length = 1366 Score = 101 bits (51), Expect = 3e-18 Identities = 117/139 (84%) Strand = Plus / Minus Query: 280 ccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcggccgttc 339 ||||||||| |||||| | ||||||| |||||||||||||||||||||| ||||||||| Sbjct: 924 ccggtgacgtaggcctggatgaagaaggcgaacatggagaacatggcgagccggccgttc 865 Query: 340 ttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggccaagtggg 399 |||| |||||| |||||||| |||||| ||| |||||| ||| ||||| || ||| Sbjct: 864 ttgatctccttcaccttgaggatggcggcctggtcggggtcgctggccaggcccaggggg 805 Query: 400 tcgaaggcgccacccgggt 418 ||||||| |||||| |||| Sbjct: 804 tcgaaggggccaccggggt 786
>dbj|AB115772.1| Physcomitrella patens subsp. patens PpLhcb2 gene for light-harvesting chlorophyll a/b-binding protein 2, complete cds Length = 3125 Score = 97.6 bits (49), Expect = 4e-17 Identities = 130/157 (82%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 |||||||||||||| ||||||| ||||||||| || |||||||| | ||||||| | Sbjct: 3010 cgaagttggtggcgtaggcccatgcgttgttggcaacggggtcggccaagtggtcgttca 2951 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 |||||| | || ||||||||||| ||||| ||||| |||||||| |||||||| |||| Sbjct: 2950 agttctccaatgggccctttccggtcacgatagcctgaacgaagaatccgaacatcgaga 2891 Query: 320 acatggcgaggcggccgttcttgagctccttgacctt 356 ||||||| | || |||||||||| |||||| ||||| Sbjct: 2890 acatggccaatcgcccgttcttgatctccttcacctt 2854 Score = 89.7 bits (45), Expect = 1e-14 Identities = 90/105 (85%) Strand = Plus / Minus Query: 490 acctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccagg 549 |||||||| ||||||||||| ||||||||||| |||||||| ||| |||||||||||| | Sbjct: 2720 acctggcaagcccagatggccaggatgctctgagcgtgcacaaggctggggttgcccaag 2661 Query: 550 tagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 || || || || |||||| |||||| || || |||||||||||| Sbjct: 2660 taatcaagaccaccctcgctgaagatttgagctccggccttgaac 2616
>emb|Z29965.1|TRLHCABBP T.repens (Huia) mRNA for light-harvesting chlorophyll a/b binding protein Length = 680 Score = 97.6 bits (49), Expect = 4e-17 Identities = 259/329 (78%) Strand = Plus / Minus Query: 250 tggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccg 309 |||||| | ||||||| ||| |||||||| ||||| |||||||| || || ||||| || Sbjct: 440 tggtcgtaaaggttctgaacaggtcccttgccggtaacgatggcttgaacaaagaaacca 381 Query: 310 aacatggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggct 369 |||||||||||||| || | |||||||||||||| ||||| ||||| | ||| || | Sbjct: 380 aacatggagaacatagccaatcggccgttcttgagttccttcaccttcaactctgcaaat 321 Query: 370 gtgtcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcg 429 | |||||||| || || || ||||| ||||| ||||| ||||| ||||| | ||| Sbjct: 320 gcatcagggtcatcagcaagaccaagagggtcaaaggcaccaccagggtaaagtgggtct 261 Query: 430 aggccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcacc 489 || || ||||| || ||||| ||||||| | ||| || || | || ||||||||||| Sbjct: 260 agtccttcaccaagaggtcctccaccaattctgtaaccttcaacaaatcccatgagcaca 201 Query: 490 acctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccagg 549 ||||| ||||||||| || || |||||||| || || | || |||||||||||||| Sbjct: 200 acctgagttgcccagattgcaagaatgctctgagcatggatcaagttggggttgcccaaa 141 Query: 550 tagtcgaggccgccctcggagaagatctg 578 ||||| ||||| ||||| ||||||||||| Sbjct: 140 tagtcaaggccaccctcagagaagatctg 112
>gb|AF003127.1|AF003127 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1042 Score = 97.6 bits (49), Expect = 4e-17 Identities = 130/157 (82%) Strand = Plus / Minus Query: 200 cgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaaga 259 |||||||||||||||||||||| || |||||||| |||||||| || | |||||| || Sbjct: 814 cgaagttggtggcgaaggcccaagcattgttgttgactgggtcagcaaggtggtctgcga 755 Query: 260 ggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggaga 319 ||||||| | || |||||||| || || ||||| || || ||||| ||||||||||||| Sbjct: 754 ggttctccaatgggccctttccagtcacaatggcttggacaaagaatccgaacatggaga 695 Query: 320 acatggcgaggcggccgttcttgagctccttgacctt 356 |||| || | | |||||||||| |||||||||||| Sbjct: 694 acatagccaatctaccgttcttgatctccttgacctt 658 Score = 73.8 bits (37), Expect = 6e-10 Identities = 88/105 (83%) Strand = Plus / Minus Query: 490 acctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccagg 549 |||||||| ||||||||||| ||||||||||| || || |||| | | |||||||||| | Sbjct: 524 acctggcaagcccagatggctaggatgctctgagcatggaccaagcttgggttgcccaag 465 Query: 550 tagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||| ||||| ||||| |||||| || || |||||||||||| Sbjct: 464 tagtcaaggccaccctcactgaagatttgtgcaccggccttgaac 420
>gb|M30622.1|TOMCBPF2 Tomato chlorophyll a/b-binding protein Cab-3B gene, 3' end Length = 351 Score = 97.6 bits (49), Expect = 4e-17 Identities = 133/161 (82%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||| ||||| |||||||| ||||||||||| |||||||| || ||||||||| || Sbjct: 335 aagtttgtggcaaaggcccaggcgttgttgttaactgggtcagcaatgtggtcggcaaga 276 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | || |||||||| ||||| || || || || |||||||| |||||||||||| Sbjct: 275 ttctccaatggaccctttccagtgacaatagcttgaacaaagaagccaaacatggagaac 216 Query: 322 atggcgaggcggccgttcttgagctccttgaccttgagctc 362 || || || | ||||||||||| |||||| || |||||||| Sbjct: 215 atagcaagtctgccgttcttgatctccttcactttgagctc 175
>emb|X16647.1|RSCHABBP Radish mRNA for chlorophyll a/b binding protein of photosystem II Length = 518 Score = 95.6 bits (48), Expect = 2e-16 Identities = 144/176 (81%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| |||||||||| ||||||||||| ||||||||||| |||||||| || | | Sbjct: 370 ttccggggacgaagttggtagcgaaggcccatgcgttgttgttgactgggtcagccaaat 311 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 | || ||| ||||| | |||||||||||||||||| || ||||| || ||||| || | Sbjct: 310 gatcagcgagattctccaacggtccctttccggtgacaatagcctgaacaaagaatccaa 251 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcg 366 |||| |||||||| || | | |||||||||| |||||| ||||| | ||||||| Sbjct: 250 acatagagaacatagccaaccttccgttcttgatctccttcaccttcaactcggcg 195
>gb|U21111.1|STU21111 Solanum tuberosum chlorophyll a/b binding protein (Lhcb1-1) gene, nuclear gene encoding chloroplast protein, complete cds Length = 798 Score = 95.6 bits (48), Expect = 2e-16 Identities = 141/172 (81%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| | ||||| |||||||| ||||| ||||||||||| || ||||| || | || Sbjct: 793 ttccggggacaaagtttgtggcgaaagcccaagcgttgttgttaacggggtctgcaaggt 734 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| |||||||| | || ||||||||||| || |||||||| |||||||| || | Sbjct: 733 ggtcagcaaggttctccaatggaccctttccggtaacaatggcctgaacgaagaatccaa 674 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgaccttgagctc 362 |||| |||||||| || || | ||||||||| | |||||| ||||||||||| Sbjct: 673 acatagagaacatagcaagtctgccgttcttaatctcctttaccttgagctc 622 Score = 60.0 bits (30), Expect = 9e-06 Identities = 84/102 (82%) Strand = Plus / Minus Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||||||| | ||||||||| || || |||| | | |||||||||| |||| Sbjct: 491 tggcaagcccagatggccaagatgctctgtgcatggaccaagcttgggttgcccaagtag 432 Query: 553 tcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 || || || |||||| ||||||||| | |||||||||||| Sbjct: 431 tcaagtcctccctcgctgaagatctgggatccggccttgaac 390
>gb|U23188.1|ZMU23188 Zea mays chlorophyll a/b-binding apoprotein CP26 (Lhcb5-1) mRNA, complete cds Length = 957 Score = 95.6 bits (48), Expect = 2e-16 Identities = 72/80 (90%) Strand = Plus / Minus Query: 280 ccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcggccgttc 339 ||||||||| |||||| | ||||||| |||||||||||||||||||||| ||||||||| Sbjct: 782 ccggtgacgtaggcctggatgaagaaggcgaacatggagaacatggcgagccggccgttc 723 Query: 340 ttgagctccttgaccttgag 359 |||| |||||| |||||||| Sbjct: 722 ttgatctccttcaccttgag 703
>gb|L07119.1|COTIIABINA Gossypium hirsutum chloroplast photosystem II chlorophyll A/B-binding protein gene, complete cds Length = 1260 Score = 95.6 bits (48), Expect = 2e-16 Identities = 141/172 (81%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| | ||||||||||| ||||||| || |||||||| |||||||| || | || Sbjct: 987 ttccggggacaaagttggtggcataggcccaagcattgttgttgactgggtcagcaaggt 928 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| | |||||| | |||||||||||||| ||||||||||| |||||||| |||| Sbjct: 927 ggtcagccaagttctccaatggtccctttccggtcacgatggcctgaacgaagaacccga 868 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgaccttgagctc 362 |||| |||||||| || | | |||||||||| ||| || ||||||||||| Sbjct: 867 acattgagaacatagccaacctaccgttcttgatctctttcaccttgagctc 816
>dbj|AB013728.1| Cryptomeria japonica mRNA for light-harvesting chlorophyll a/b-binding protein of photosystem II, complete cds Length = 935 Score = 95.6 bits (48), Expect = 2e-16 Identities = 129/156 (82%) Strand = Plus / Minus Query: 439 ccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccacctggcat 498 ||||| ||||| ||| | |||||||||||||| | | |||||||| | ||||||||| Sbjct: 559 ccgagcggtccaccagccacacggtagccctcaacggcacccatgaggatgacctggcat 500 Query: 499 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgagg 558 ||||||||||| ||||||||||| |||||||||||| | |||||||||| ||||| | Sbjct: 499 gcccagatggcaaggatgctctgtgcgtgcaccaggctagggttgcccaaatagtccaaa 440 Query: 559 ccgccctcggagaagatctgcgcgccggccttgaac 594 |||||||| ||||||||| | ||| ||||||||| Sbjct: 439 ccgccctcactgaagatctgtgagcccgccttgaac 404
>ref|NM_102732.2| Arabidopsis thaliana CAB2; chlorophyll binding AT1G29920 (CAB2) mRNA, complete cds Length = 1176 Score = 93.7 bits (47), Expect = 6e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| |||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 855 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 796 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 795 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 736 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 735 atagccaatcttccgttcttgagctcctttacctt 701
>gb|BT015572.1| Arabidopsis thaliana At1g29910 mRNA sequence Length = 762 Score = 93.7 bits (47), Expect = 6e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| |||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 746 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 687 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 686 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 627 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 626 atagccaatcttccgttcttgagctcctttacctt 592
>gb|BT000726.1| Arabidopsis thaliana clone RAFL06-67-G16 (R11472) putative photosystem II type I chlorophyll a /b binding protein (At1g29920) mRNA, complete cds Length = 1044 Score = 93.7 bits (47), Expect = 6e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| |||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 841 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 782 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 781 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 722 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 721 atagccaatcttccgttcttgagctcctttacctt 687
>gb|AF479778.1| Chlamydomonas reinhardtii major light-harvesting complex II protein m9 (Lhcbm9) mRNA, complete cds Length = 1221 Score = 93.7 bits (47), Expect = 6e-16 Identities = 110/131 (83%) Strand = Plus / Minus Query: 274 ccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcgg 333 ||||| ||||| || |||||||| |||||||||||||| ||||||||||| |||||| Sbjct: 705 cccttgccggtcacaatggcctggacgaagaagccgaaggacgagaacatggccaggcgg 646 Query: 334 ccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggcca 393 |||||||||| |||||| ||||| ||||| ||| ||||| |||||||| || ||||| Sbjct: 645 ccgttcttgatctccttcaccttcagctcagcgaaggtgtcggggtcgtcagccaggccc 586 Query: 394 agtgggtcgaa 404 || |||||||| Sbjct: 585 agggggtcgaa 575 Score = 58.0 bits (29), Expect = 3e-05 Identities = 74/89 (83%) Strand = Plus / Minus Query: 506 tggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgaggccgccct 565 |||||| |||| |||| ||||| | |||| ||||||||||||||||| || ||||||| Sbjct: 473 tggcgacgatgttctgggcgtggatcagggaggggttgcccaggtagttcagaccgccct 414 Query: 566 cggagaagatctgcgcgccggccttgaac 594 | |||||||| ||||||||||||||| Sbjct: 413 cctgaaagatctgggcgccggccttgaac 385
>gb|AY128345.1| Arabidopsis thaliana photosystem II type I chlorophyll a/b binding protein, putative (At1g29920) mRNA, complete cds Length = 994 Score = 93.7 bits (47), Expect = 6e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| |||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 841 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 782 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 781 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 722 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 721 atagccaatcttccgttcttgagctcctttacctt 687
>gb|AY081572.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920) mRNA, complete cds Length = 898 Score = 93.7 bits (47), Expect = 6e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| |||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 788 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 729 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 728 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 669 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 668 atagccaatcttccgttcttgagctcctttacctt 634
>gb|AY062814.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29920; F1N18.4) mRNA, complete cds Length = 1007 Score = 93.7 bits (47), Expect = 6e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| |||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 840 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 781 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 780 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 721 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 720 atagccaatcttccgttcttgagctcctttacctt 686
>gb|AY060500.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 804 Score = 93.7 bits (47), Expect = 6e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| |||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 788 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 729 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 728 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 669 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 668 atagccaatcttccgttcttgagctcctttacctt 634
>gb|AY054198.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 93.7 bits (47), Expect = 6e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| |||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 834 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 775 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 774 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 715 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 714 atagccaatcttccgttcttgagctcctttacctt 680
>gb|AY052237.1| Arabidopsis thaliana At1g29920/F1N18_80 mRNA, complete cds Length = 1027 Score = 93.7 bits (47), Expect = 6e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| |||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 840 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 781 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 780 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 721 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 720 atagccaatcttccgttcttgagctcctttacctt 686
>gb|AY086905.1| Arabidopsis thaliana clone 29298 mRNA, complete sequence Length = 1041 Score = 93.7 bits (47), Expect = 6e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| |||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 855 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 796 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 795 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 736 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 735 atagccaatcttccgttcttgagctccttcacctt 701
>emb|X03908.1|ATLHCP2 A.thaliana gene (LHCP AB 180) for chlorophyll a/b binding protein Length = 1060 Score = 93.7 bits (47), Expect = 6e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||| ||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 994 aagttggttgcgaaggcccatgcgttgttgttgactggatcggccaaatggtcagcaagg 935 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 934 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 875 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 874 atagccaatcttccgttcttgagctccttcacctt 840
>emb|X03907.1|ATLHCP1 A.thaliana gene (LHCP AB 165) for chlorophyll a/b binding protein Length = 999 Score = 93.7 bits (47), Expect = 6e-16 Identities = 128/155 (82%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| |||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 933 aagttggtggcaaaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 874 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 873 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 814 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 813 atagccaatcttccgttcttgagctcctttacctt 779
>emb|CT571263.1| Medicago truncatula chromosome 5 clone mte1-7c20, COMPLETE SEQUENCE Length = 127003 Score = 93.7 bits (47), Expect = 6e-16 Identities = 302/387 (78%) Strand = Plus / Minus Query: 192 tccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtg 251 ||||||| ||||||| || ||| | ||||| ||||||||| || ||||| || | || Sbjct: 51913 tccggggacgaagttagtagcgtatgcccatgcgttgttggcaacagggtcagcaacatg 51854 Query: 252 gtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaa 311 |||| | ||||||| ||| || ||||| || || || ||||| || || ||||| || || Sbjct: 51853 gtcgtaaaggttctgaacggggcccttgccagtaacaatggcttgaacaaagaaaccaaa 51794 Query: 312 catggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgt 371 |||||||||||| || | |||||||||||||| ||||||||||| | ||| ||| || Sbjct: 51793 catggagaacatagccaatcggccgttcttgagttccttgaccttcaactctgcgaatgc 51734 Query: 372 gtcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatgatgtcgag 431 || ||||| || || || ||||| ||||| ||||| ||||| ||||| | ||| || Sbjct: 51733 atcggggtcatcagcaagaccaagagggtcaaaggcaccaccagggtaaagtgggtccag 51674 Query: 432 gccctcaccgaggggtccgccaccaacacggtagccctcgatgaagcccatgagcaccac 491 || ||||| || ||||| |||||||| | |||||| || | || ||||||||||| || Sbjct: 51673 tccttcaccaagtggtcctccaccaactctgtagccttcaacaaatcccatgagcacaac 51614 Query: 492 ctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggta 551 ||| |||||||| || || |||||||| || || | |||||| |||||||||| || Sbjct: 51613 ctgagtagcccagattgcaagaatgctctgagcatggatcaggtttgggttgcccaaata 51554 Query: 552 gtcgaggccgccctcggagaagatctg 578 ||| ||||| ||||| ||||||||||| Sbjct: 51553 gtcaaggccaccctcagagaagatctg 51527
>gb|U23189.1|ZMU23189 Zea mays chlorophyll a/b-binding apoprotein CP26 (Lhcb5-2) mRNA, complete cds Length = 1073 Score = 93.7 bits (47), Expect = 6e-16 Identities = 116/139 (83%) Strand = Plus / Minus Query: 280 ccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcggccgttc 339 ||||||||| |||||| | ||||||| |||||||||||||||| ||||| ||||||||| Sbjct: 780 ccggtgacgtaggcctggatgaagaaggcgaacatggagaacatcgcgagccggccgttc 721 Query: 340 ttgagctccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggccaagtggg 399 |||| |||||| |||||||| |||||| ||| |||||| ||| ||||| || ||| Sbjct: 720 ttgatctccttcaccttgaggatggcggcctggtcggggtcgctggccaggcccaggggg 661 Query: 400 tcgaaggcgccacccgggt 418 ||||||| |||||| |||| Sbjct: 660 tcgaaggggccaccggggt 642
>emb|X61361.1|EGLHCAB E.gracilis gene for light harvesting chlorophyll a/b binding protein of photosystem II Length = 7650 Score = 91.7 bits (46), Expect = 2e-15 Identities = 88/102 (86%) Strand = Plus / Minus Query: 261 gttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaa 320 |||||| || || ||||||||||||| |||| ||||||||||||||||||| |||| | Sbjct: 7060 gttctccacggggccctttccggtgaggatgccctgcacgaagaagccgaagatggccac 7001 Query: 321 catggcgaggcggccgttcttgagctccttgaccttgagctc 362 |||||| || ||||||||||||| |||||| ||||| ||||| Sbjct: 7000 catggccagccggccgttcttgacctccttcaccttcagctc 6959 Score = 81.8 bits (41), Expect = 2e-12 Identities = 56/61 (91%) Strand = Plus / Minus Query: 531 caggttggggttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggcctt 590 |||| |||||||||||||||||| |||||| || ||||||||||||||||||||||||| Sbjct: 4684 caggctggggttgcccaggtagttcaggccgtccgcggagaagatctgcgcgccggcctt 4625 Query: 591 g 591 | Sbjct: 4624 g 4624 Score = 79.8 bits (40), Expect = 9e-12 Identities = 82/96 (85%) Strand = Plus / Minus Query: 261 gttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaa 320 |||||| || || ||||||||||||| |||| |||||||| |||||||||| |||| | Sbjct: 276 gttctccacagggccctttccggtgaggatgccctgcacggagaagccgaagatggccac 217 Query: 321 catggcgaggcggccgttcttgagctccttgacctt 356 |||||| || ||||||||||||| |||||| ||||| Sbjct: 216 catggccagccggccgttcttgacctccttcacctt 181 Score = 73.8 bits (37), Expect = 6e-10 Identities = 55/61 (90%) Strand = Plus / Minus Query: 531 caggttggggttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggcctt 590 |||| |||||||||||||||||| |||||| || |||||||||||||||| |||||||| Sbjct: 1241 caggctggggttgcccaggtagttcaggccgtccgcggagaagatctgcgcaccggcctt 1182 Query: 591 g 591 | Sbjct: 1181 g 1181 Score = 69.9 bits (35), Expect = 9e-09 Identities = 83/99 (83%) Strand = Plus / Minus Query: 321 catggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtc 380 |||||| |||||||||||||| |||||||| ||||||||||||||| | ||| ||||| Sbjct: 4900 catggccaggcggccgttcttcagctccttcaccttgagctcggcgagggcgtcggggtc 4841 Query: 381 gtcggcgaggccaagtgggtcgaaggcgccacccgggta 419 || ||| || || || |||||||| | |||||| ||||| Sbjct: 4840 gttggccagacccagggggtcgaacgggccaccggggta 4802 Score = 69.9 bits (35), Expect = 9e-09 Identities = 83/99 (83%) Strand = Plus / Minus Query: 321 catggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtc 380 |||||| |||||||||||||| |||||||| ||||||||||||||| | ||| ||||| Sbjct: 1457 catggccaggcggccgttcttcagctccttcaccttgagctcggcgagggcgtcggggtc 1398 Query: 381 gtcggcgaggccaagtgggtcgaaggcgccacccgggta 419 || ||| || || || |||||||| | |||||| ||||| Sbjct: 1397 gttggccagacccagggggtcgaacgggccaccggggta 1359 Score = 63.9 bits (32), Expect = 6e-07 Identities = 47/52 (90%) Strand = Plus / Minus Query: 543 gcccaggtagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 ||||||||||| || ||| ||||||||||||||||||| |||||||||||| Sbjct: 5968 gcccaggtagttcagcccgtcctcggagaagatctgcgcaccggccttgaac 5917 Score = 42.1 bits (21), Expect = 2.0 Identities = 33/37 (89%) Strand = Plus / Minus Query: 321 catggcgaggcggccgttcttgagctccttgaccttg 357 |||||| |||||||||||||| | |||||| |||||| Sbjct: 3744 catggccaggcggccgttcttcacctccttcaccttg 3708
>gb|AF458406.1|AF458406 Brassica oleracea chlorophyll a/b binding protein (CAB1) mRNA, complete cds Length = 980 Score = 91.7 bits (46), Expect = 2e-15 Identities = 136/166 (81%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| ||||||||||||| |||||||| || |||||||| ||||| || || | | Sbjct: 838 ttccggggacgaagttggtggcaaaggcccatgcattgttgttgactggatcagccaaat 779 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| || ||||| | ||||||||||||||||||||| ||||| |||||||| || | Sbjct: 778 ggtcagcaagattctccaacggtccctttccggtgacgatagcctgaacgaagaatccaa 719 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgacctt 356 |||| |||||||| || | | |||||||||| |||||| ||||| Sbjct: 718 acatagagaacatagccaaccttccgttcttgatctccttcacctt 673
>gb|M60049.1|DUNCAB D.tertiolecta 28.5-kDa LHCII apoprotein mRNA, complete cds Length = 1041 Score = 91.7 bits (46), Expect = 2e-15 Identities = 112/134 (83%) Strand = Plus / Minus Query: 286 acgatggcctgcacgaagaagccgaacatggagaacatggcgaggcggccgttcttgagc 345 ||||||||||||||||||||||| | ||||||||||| |||||||||||||||| | Sbjct: 707 acgatggcctgcacgaagaagcccaggcaagagaacatggccaggcggccgttcttgatc 648 Query: 346 tccttgaccttgagctcggcggctgtgtcagggtcgtcggcgaggccaagtgggtcgaag 405 ||||||||||| ||||| ||| ||||| ||||| || || || || || ||||||||| Sbjct: 647 tccttgaccttcagctcagcgaaggtgtctgggtcatcagccagacccagggggtcgaag 588 Query: 406 gcgccacccgggta 419 | |||||| ||||| Sbjct: 587 gggccaccagggta 574
>dbj|AB012638.1| Nicotiana sylvestris Lhcb1*5, Lhcb1*6 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7299 Score = 91.7 bits (46), Expect = 2e-15 Identities = 121/146 (82%) Strand = Plus / Minus Query: 217 gcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttctcaaccggtccc 276 ||||| || |||||||| |||||||| || | ||||||| |||||||| | || || Sbjct: 5132 gcccaggcattgttgttaactgggtcagcaaggtggtcggcaaggttctccaatggacct 5073 Query: 277 tttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcggccg 336 |||||||||||||| ||||| || ||||| || ||||||||||||||||| || | ||| Sbjct: 5072 tttccggtgacgatagcctgaacaaagaatccaaacatggagaacatggcaagtctgcca 5013 Query: 337 ttcttgagctccttgaccttgagctc 362 ||||||| |||||| ||||||||||| Sbjct: 5012 ttcttgatctcctttaccttgagctc 4987 Score = 89.7 bits (45), Expect = 1e-14 Identities = 132/161 (81%) Strand = Plus / Plus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||| ||||| ||||||| ||||||||||| |||||||| || | |||||| ||| Sbjct: 1886 aagtttgtggcataggcccaagcgttgttgttaactgggtcagcaagatggtcggcaagg 1945 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | || ||||||||||||||||| || || |||||||| || |||||||||||| Sbjct: 1946 ttctccaatggaccctttccggtgacgatagcttgaacgaagaaaccaaacatggagaac 2005 Query: 322 atggcgaggcggccgttcttgagctccttgaccttgagctc 362 || || || | || ||||||| |||||| ||||||||||| Sbjct: 2006 atagcaagtctaccattcttgatctcctttaccttgagctc 2046
>gb|AC139600.16| Medicago truncatula clone mth2-20m4, complete sequence Length = 124732 Score = 89.7 bits (45), Expect = 1e-14 Identities = 111/133 (83%) Strand = Plus / Plus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| | ||||| |||||||||||||| ||||||||||| |||||||| ||||||| Sbjct: 8576 ttccggggacaaagtttgtggcgaaggcccaagcgttgttgttaactgggtcagcgatgt 8635 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| ||||| | | |||||||||||||| |||||||| || || ||||| || | Sbjct: 8636 ggtcagcaaggttttttaaaggtccctttccggtcacgatggcttgaacaaagaatccaa 8695 Query: 311 acatggagaacat 323 |||| |||||||| Sbjct: 8696 acatagagaacat 8708 Score = 89.7 bits (45), Expect = 1e-14 Identities = 111/133 (83%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| | ||||| ||||| |||||||| ||||||||||| || ||||| | ||| | Sbjct: 212 ttccggggacaaagtttgtggcaaaggcccaagcgttgttgttgacggggtcagtgatat 153 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| |||||||| | |||||||||||||| || |||||||| |||||||| || | Sbjct: 152 ggtcggcaaggttctctagaggtccctttccggttacaatggcctgaacgaagaatccaa 93 Query: 311 acatggagaacat 323 |||| |||||||| Sbjct: 92 acatagagaacat 80 Score = 67.9 bits (34), Expect = 4e-08 Identities = 100/122 (81%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||| ||||| |||||||| |||||| |||| ||||| || ||||||||||| ||| Sbjct: 2057 aagtttgtggcaaaggcccaagcgttgctgttgactggatcagcgatgtggtcagcaagg 1998 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| |||| || |||||||| ||||| || || ||||| |||||| Sbjct: 1997 ttctctagtggtcccttttcggttacaatggcctgaacgaaaaatccaaacatcgagaac 1938 Query: 322 at 323 || Sbjct: 1937 at 1936
>gb|AF279249.1|AF279249 Vigna radiata LHCII type I chlorophyll a/b-binding protein (CipLhcb1*2) mRNA, complete cds; nuclear gene for chloroplast product Length = 932 Score = 89.7 bits (45), Expect = 1e-14 Identities = 105/125 (84%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||||||| ||||||| ||||||||||| || |||||||| | ||| ||| |||| Sbjct: 835 aagttggtggcgtaggcccaggcgttgttgttgacagggtcggcaaggtgatcggcgagg 776 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | |||||||| || ||||| ||||| || |||||||| || || ||||||||| Sbjct: 775 ttctccaaaggtcccttgccagtgacaatggcttgaacgaagaaaccaaatatggagaac 716 Query: 322 atggc 326 ||||| Sbjct: 715 atggc 711 Score = 48.1 bits (24), Expect = 0.033 Identities = 48/56 (85%) Strand = Plus / Minus Query: 499 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtc 554 ||||||||||| ||||||||||| || || | |||| | |||||||||| |||||| Sbjct: 538 gcccagatggcaaggatgctctgtgcatggatcaggcttgggttgcccaagtagtc 483
>gb|AF003128.1|AF003128 Mesembryanthemum crystallinum chlorophyll a/b-binding protein (CAB2) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1027 Score = 89.7 bits (45), Expect = 1e-14 Identities = 132/161 (81%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||| |||||||||||||| || |||||||| ||||||||||| | ||| || ||| Sbjct: 800 aagtttgtggcgaaggcccaagcattgttgttaactgggtcggcaaggtgatcagcaagg 741 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | || ||||||||||| || ||||| || || ||||| |||||||| |||||| Sbjct: 740 ttctccaatggaccctttccggtcacaatggcttggacaaagaacccgaacattgagaac 681 Query: 322 atggcgaggcggccgttcttgagctccttgaccttgagctc 362 ||||| | | |||||||||| |||||| ||||||||||| Sbjct: 680 atggctaatctaccgttcttgatctccttcaccttgagctc 640 Score = 56.0 bits (28), Expect = 1e-04 Identities = 79/96 (82%) Strand = Plus / Minus Query: 499 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgagg 558 |||||||||||||||||||| || ||||| |||| | |||||||||| ||| || || Sbjct: 503 gcccagatggcgaggatgctttgagcgtggaccaaacttgggttgcccaagtaatcaagc 444 Query: 559 ccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| |||||||| || |||||||||||| Sbjct: 443 ccaccctcgctaaagatctgggctccggccttgaac 408
>gb|M14444.1|TOMCBPB Tomato chlorophyll a/b-binding protein gene Cab-3C, complete cds Length = 1135 Score = 89.7 bits (45), Expect = 1e-14 Identities = 111/133 (83%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| | ||||| |||||||||||||| || ||||| || |||||||| |||| | Sbjct: 1001 ttccggggacaaagtttgtggcgaaggcccaagcattgttattgactgggtcagcgagat 942 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| |||||||| | || ||||||||||||||||| || || || |||||||||| Sbjct: 941 ggtcagcaaggttctccaatggaccctttccggtgacgatagcttgaacaaagaagccga 882 Query: 311 acatggagaacat 323 ||||||||||||| Sbjct: 881 acatggagaacat 869
>gb|AY389553.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein (CAB) mRNA, partial cds Length = 720 Score = 87.7 bits (44), Expect = 4e-14 Identities = 83/96 (86%) Strand = Plus / Minus Query: 499 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgagg 558 ||||| ||||| || |||||||| ||||| |||||| | ||||||||||||||||| | Sbjct: 526 gcccatatggccagaatgctctgtgcgtggaccaggctagggttgcccaggtagtccaat 467 Query: 559 ccgccctcggagaagatctgcgcgccggccttgaac 594 ||||||||| ||||||||| ||||||||||||||| Sbjct: 466 ccgccctcgctgaagatctgggcgccggccttgaac 431
>gb|AY389549.1| Hyacinthus orientalis chloroplast chlorophyll A-B binding protein 3C (LHCP) mRNA, partial cds Length = 661 Score = 87.7 bits (44), Expect = 4e-14 Identities = 83/96 (86%) Strand = Plus / Minus Query: 499 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgagg 558 ||||| ||||| || |||||||| ||||| |||||| | ||||||||||||||||| | Sbjct: 361 gcccatatggccagaatgctctgtgcgtggaccaggctagggttgcccaggtagtccaat 302 Query: 559 ccgccctcggagaagatctgcgcgccggccttgaac 594 ||||||||| ||||||||| ||||||||||||||| Sbjct: 301 ccgccctcgctgaagatctgggcgccggccttgaac 266
>gb|AF268321.1|AF268321 Chlorarachnion CCMP621 light-harvesting complex protein LHCG12 mRNA, complete cds Length = 1170 Score = 87.7 bits (44), Expect = 4e-14 Identities = 80/92 (86%) Strand = Plus / Minus Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 ||||| |||||||||||||| |||| ||||| ||| |||| |||| |||||||||||| Sbjct: 967 tcaacaggtccctttccggtagcgatagcctgaacgtagaatccgagcatggagaacata 908 Query: 325 gcgaggcggccgttcttgagctccttgacctt 356 ||||| ||||||||||||| |||||| ||||| Sbjct: 907 gcgagacggccgttcttgatctccttaacctt 876
>gb|AF268320.1|AF268320 Chlorarachnion CCMP621 light-harvesting complex protein LHCG11 mRNA, complete cds Length = 1128 Score = 87.7 bits (44), Expect = 4e-14 Identities = 80/92 (86%) Strand = Plus / Minus Query: 265 tcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatg 324 ||||| |||||||||||||| |||| ||||| ||| |||| |||| |||||||||||| Sbjct: 924 tcaacaggtccctttccggtagcgatagcctgaacgtagaatccgagcatggagaacata 865 Query: 325 gcgaggcggccgttcttgagctccttgacctt 356 ||||| ||||||||||||| |||||| ||||| Sbjct: 864 gcgagacggccgttcttgatctccttaacctt 833
>dbj|AB206466.1| Adiantum capillus-veneris AcCab1 gene for chlorophyll a/b-binding protein, complete cds Length = 1500 Score = 87.7 bits (44), Expect = 4e-14 Identities = 187/232 (80%), Gaps = 2/232 (0%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactggg-tcggcgatgtg 251 ||||||| ||||||||||||| | ||||| ||||||||| | |||| ||||| | ||| Sbjct: 1387 ccgggggtgaagttggtggcgtaagcccaggcgttgttga-cggtgggatcggccaagtg 1329 Query: 252 gtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaa 311 |||| | | |||||| | || |||||||||||||| |||||||| || ||||| ||||| Sbjct: 1328 gtcggacaagttctcgatggggccctttccggtgacaatggcctgaacaaagaaaccgaa 1269 Query: 312 catggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgt 371 |||||||||||| || || | |||||||| | |||||| ||||| | ||||||| | Sbjct: 1268 catggagaacatagccagcctaccgttcttcaactccttcaccttcaactcggcgaaagc 1209 Query: 372 gtcagggtcgtcggcgaggccaagtgggtcgaaggcgccacccgggtagatg 423 || |||||||| || | ||| || |||||||||| |||||| ||||||||| Sbjct: 1208 ctctgggtcgtcagccaagccgagggggtcgaaggagccaccggggtagatg 1157
>gb|AF034631.1|AF034631 Panax ginseng chlorophyll a/b binding protein of LHCII type I precursor (CAB) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 1015 Score = 87.7 bits (44), Expect = 4e-14 Identities = 140/172 (81%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| | ||||||||||| ||||||| || |||||||||||||| || || | | Sbjct: 819 ttccggggacaaagttggtggcataggcccatgcattgttgttcactggatcagcaaggg 760 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 ||||| |||||||| | || |||||||| || || |||||||| || ||||| || | Sbjct: 759 ggtcggctaggttctccaatgggccctttcctgtaacaatggcctgaacaaagaaaccaa 700 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgaccttgagctc 362 ||||||||||||||||||| | || |||||||| ||||| ||||| ||||| Sbjct: 699 acatggagaacatggcgagccttccattcttgagttccttaaccttaagctc 648
>dbj|AU066541.1| Chlamydomonas sp. HS-5 mRNA for hypothetical protein, NaCl+paraquat inducible, partial cds, clone:M27 Length = 687 Score = 87.7 bits (44), Expect = 4e-14 Identities = 65/72 (90%) Strand = Plus / Minus Query: 523 gcgtgcaccaggttggggttgcccaggtagtcgaggccgccctcggagaagatctgcgcg 582 ||||||||||| |||||||||||||||||| ||||||||||| ||||||||||| ||| Sbjct: 423 gcgtgcaccagcgaggggttgcccaggtagtcaaggccgccctcagagaagatctgggcg 364 Query: 583 ccggccttgaac 594 || ||||||||| Sbjct: 363 cctgccttgaac 352 Score = 40.1 bits (20), Expect = 8.1 Identities = 29/32 (90%) Strand = Plus / Minus Query: 331 cggccgttcttgagctccttgaccttgagctc 362 ||||||||||||| |||||| ||||| ||||| Sbjct: 624 cggccgttcttgatctccttcaccttcagctc 593
>dbj|AB012641.1| Nicotiana sylvestris Lhcb1*9 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3386 Score = 87.7 bits (44), Expect = 4e-14 Identities = 122/148 (82%) Strand = Plus / Minus Query: 215 aggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagaggttctcaaccggtc 274 ||||||| ||||||||||| ||||||||||| | |||||| |||||||| | || | Sbjct: 2225 aggcccaagcgttgttgttaactgggtcggcaaggtggtcagcaaggttctctaatggac 2166 Query: 275 cctttccggtgacgatggcctgcacgaagaagccgaacatggagaacatggcgaggcggc 334 ||||||||||||| || || ||||||||||| || ||||| ||||||||||| || | | Sbjct: 2165 cctttccggtgactatagcttgcacgaagaatccaaacatagagaacatggcaagtctac 2106 Query: 335 cgttcttgagctccttgaccttgagctc 362 | ||||||| ||||| ||||||||||| Sbjct: 2105 cattcttgatttccttcaccttgagctc 2078
>dbj|AB012637.1| Nicotiana sylvestris Lhcb1*2, Lhcb1*3, Lhcb1*4 genes for light harvesting chlorophyll a/b-binding protein, complete cds Length = 7965 Score = 87.7 bits (44), Expect = 4e-14 Identities = 143/176 (81%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| | ||||| |||||| ||||||| || |||||||| |||||||| || | || Sbjct: 7667 ttccggggacaaagtttgtggcgtaggcccaagcattgttgttaactgggtctgcaaggt 7608 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| |||||||| | || |||||||| || || ||||| || || ||||| |||| Sbjct: 7607 ggtcagcaaggttctctaatgggccctttccagtaacaatggcttgaacaaagaatccga 7548 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcg 366 |||| |||||||||||||| | |||||||| | ||| || ||||||||||||||| Sbjct: 7547 acatagagaacatggcgagtcttccgttcttaatctcttttaccttgagctcggcg 7492 Score = 71.9 bits (36), Expect = 2e-09 Identities = 138/172 (80%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| | ||||| ||||| ||| ||| ||||||||||| || ||||| || | || Sbjct: 5127 ttccggggacaaagtttgtggcataggaccaggcgttgttgttaacagggtctgcaaggt 5068 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| |||||||| | || ||||||||||| || |||||||| || ||||| |||| Sbjct: 5067 ggtcagcaaggttctccaatgggccctttccggtaacaatggcctgaacaaagaatccga 5008 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgaccttgagctc 362 |||| ||||||||||| || | || ||||||| |||||| || |||||||| Sbjct: 5007 acatagagaacatggcaagtctcccattcttgatctcctttactttgagctc 4956 Score = 71.9 bits (36), Expect = 2e-09 Identities = 174/220 (79%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||| |||||| ||| ||| ||||||||||| |||||||| || | ||||| ||| Sbjct: 2663 aagtttgtggcgtaggaccaggcgttgttgttaactgggtcagcaagatggtcagcaagg 2604 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | || || ||||| || || |||||||| || ||||| |||||||| |||||| Sbjct: 2603 ttctccaatggaccttttccagtaacaatggcctgaacaaagaatccgaacatagagaac 2544 Query: 322 atggcgaggcggccgttcttgagctccttgaccttgagctcggcggctgtgtcagggtcg 381 ||||| || | ||| ||||||| |||||| || |||||||| ||| || || ||||| Sbjct: 2543 atggcaagcctgccattcttgatctcctttactttgagctcagcgaatgcctctgggtcc 2484 Query: 382 tcggcgaggccaagtgggtcgaaggcgccacccgggtaga 421 || || ||||| |||||||| ||| |||||| ||||||| Sbjct: 2483 tcagcaaggcctagtgggtcaaagctgccaccagggtaga 2444 Score = 46.1 bits (23), Expect = 0.13 Identities = 62/75 (82%) Strand = Plus / Minus Query: 493 tggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtag 552 ||||| ||||||||||| | |||||| || || ||||||| | | |||||||||| |||| Sbjct: 7365 tggcaagcccagatggccaagatgctttgtgcatgcaccaagcttgggttgcccaagtag 7306 Query: 553 tcgaggccgccctcg 567 || || || |||||| Sbjct: 7305 tcaagtccaccctcg 7291
>dbj|AB012636.1| Nicotiana sylvestris Lhcb1*1 gene for light harvesting chlorophyll a/b-binding protein, complete cds Length = 3659 Score = 87.7 bits (44), Expect = 4e-14 Identities = 143/176 (81%) Strand = Plus / Minus Query: 191 ttccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgt 250 |||||||| | ||||| |||||| | ||||| || |||||||| |||||||| || | || Sbjct: 929 ttccggggacaaagtttgtggcgtacgcccaagcattgttgttaactgggtctgcaaggt 870 Query: 251 ggtcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccga 310 |||| |||||||| | || ||||||||||| || ||||| || || ||||| |||| Sbjct: 869 ggtcagcaaggttctctaatgggccctttccggtaacaatggcttgaacaaagaatccga 810 Query: 311 acatggagaacatggcgaggcggccgttcttgagctccttgaccttgagctcggcg 366 |||| |||||||||||||| | |||||||| | ||| || ||||||||||||||| Sbjct: 809 acatagagaacatggcgagtcttccgttcttaatctcttttaccttgagctcggcg 754
>ref|NM_102731.2| Arabidopsis thaliana CAB3 (CHLOROPHYLL A/B BINDING PROTEIN 3); chlorophyll binding AT1G29910 (CAB3) mRNA, complete cds Length = 1020 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||| ||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 841 aagttggttgcgaaggcccatgcgttgttgttgactggatcggccaaatggtcagcaagg 782 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||| ||||| || |||||||| || ||||| |||||| Sbjct: 781 ttctctatcggtcccttaccagtgacaatggcttgaacgaagaatccaaacatagagaac 722 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 721 atagccaatcttccgttcttgagctccttcacctt 687
>gb|AY114594.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910) mRNA, complete cds Length = 870 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||| ||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 788 aagttggttgcgaaggcccatgcgttgttgttgactggatcggccaaatggtcagcaagg 729 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||| ||||| || |||||||| || ||||| |||||| Sbjct: 728 ttctctatcggtcccttaccagtgacaatggcttgaacgaagaatccaaacatagagaac 669 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 668 atagccaatcttccgttcttgagctccttcacctt 634
>gb|AY065165.1| Arabidopsis thaliana chlorophyll a/b-binding protein (At1g29910; F1N18.5) mRNA, complete cds Length = 1019 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 |||||||| ||||||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 841 aagttggttgcgaaggcccatgcgttgttgttgactggatcggccaaatggtcagcaagg 782 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||| ||||| || |||||||| || ||||| |||||| Sbjct: 781 ttctctatcggtcccttaccagtgacaatggcttgaacgaagaatccaaacatagagaac 722 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 721 atagccaatcttccgttcttgagctccttcacctt 687
>emb|BX815776.1|CNS0AE4K Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS93ZB12 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 972 Score = 85.7 bits (43), Expect = 2e-13 Identities = 128/155 (82%), Gaps = 1/155 (0%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| |||||||| ||||||||||| ||||| ||||| | ||||| ||| Sbjct: 825 aagttggtggc-aaggcccaagcgttgttgttgactggatcggccaaatggtcagcaagg 767 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | ||||||||| || ||||||||||| || |||||||| || ||||| |||||| Sbjct: 766 ttctctatcggtcccttaccagtgacgatggcttgaacgaagaatccaaacatagagaac 707 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 || || | | ||||||||||||||||| ||||| Sbjct: 706 atagccaatcttccgttcttgagctcctttacctt 672
>gb|AF072931.1|AF072931 Medicago sativa chlorophyll a/b binding protein (CARCAB1) mRNA, complete cds Length = 983 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||||||||| ||||||| ||||||||||| ||||||||||| | || || ||| Sbjct: 836 aagttggtggcataggcccatgcgttgttgttgactgggtcggcaagatgatcagcaagg 777 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | |||||||||||||| || || ||||| || ||||| |||||||| |||||| Sbjct: 776 ttctccaaaggtccctttccggtcacaatagcctgaacaaagaatccgaacatagagaac 717 Query: 322 atggcgaggcggccgttcttgagctccttgacctt 356 ||||| | | |||||||||||| ||||| ||||| Sbjct: 716 atggctaatctgccgttcttgagttccttaacctt 682
>gb|AY433957.1| Pyrus communis chlorophyll a/b-binding protein mRNA, partial sequence; nuclear gene for chloroplast product Length = 255 Score = 83.8 bits (42), Expect = 6e-13 Identities = 84/98 (85%) Strand = Plus / Minus Query: 259 aggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggag 318 |||||||||| ||||||||||| | ||| ||||||||||| |||||||||||||| ||| Sbjct: 112 aggttctcaataggtccctttccagcgacaatggcctgcacaaagaagccgaacattgag 53 Query: 319 aacatggcgaggcggccgttcttgagctccttgacctt 356 |||||||| || | || |||||||| || |||||||| Sbjct: 52 aacatggccagtcttccattcttgagttctttgacctt 15
>gb|U39475.1|GMU39475 Glycine max chlorophyll a/b-binding protein (cab3) mRNA, nuclear gene encoding chloroplast protein, complete cds Length = 977 Score = 83.8 bits (42), Expect = 6e-13 Identities = 138/170 (81%) Strand = Plus / Minus Query: 193 ccgggggcgaagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtgg 252 |||||| |||||||||||||| ||||||| || |||||||| |||||||| || | ||| Sbjct: 816 ccggggacgaagttggtggcgtaggcccaggcattgttgttgactgggtccgcaaggtga 757 Query: 253 tcgaagaggttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaac 312 || |||||||| | || ||||| |||||||| |||||||| || ||||| || ||| Sbjct: 756 tcagcaaggttctccaatggacccttaccggtgacaatggcctgaacaaagaacccaaac 697 Query: 313 atggagaacatggcgaggcggccgttcttgagctccttgaccttgagctc 362 || ||||||||||| | | ||||||||||| ||||| ||||| ||||| Sbjct: 696 atagagaacatggccaatctcccgttcttgagttccttcaccttaagctc 647 Score = 79.8 bits (40), Expect = 9e-12 Identities = 82/96 (85%) Strand = Plus / Minus Query: 499 gcccagatggcgaggatgctctgcgcgtgcaccaggttggggttgcccaggtagtcgagg 558 ||||||||||||||||||||||| ||||| || ||| | |||||||||| |||||| || Sbjct: 510 gcccagatggcgaggatgctctgggcgtggacaaggcttgggttgcccaagtagtccagc 451 Query: 559 ccgccctcggagaagatctgcgcgccggccttgaac 594 || |||||| ||||||||| | |||||||||||| Sbjct: 450 ccaccctcgctgaagatctgggacccggccttgaac 415
>dbj|AB236867.1| Panax ginseng cab mRNA for chlorophyll a/b binding protein, complete cds Length = 935 Score = 81.8 bits (41), Expect = 2e-12 Identities = 98/117 (83%) Strand = Plus / Minus Query: 478 cccatgagcaccacctggcatgcccagatggcgaggatgctctgcgcgtgcaccaggttg 537 ||||||||||| || |||| |||||||| || ||||||||||| || || || ||||| Sbjct: 528 cccatgagcacaacttggctggcccagatagccaggatgctctgggcatggacaaggttt 469 Query: 538 gggttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggccttgaac 594 |||||||| || ||||| ||||| || ||||||||||| || || |||||||||||| Sbjct: 468 gggttgccaagatagtcaaggccaccttcggagaagatttgggctccggccttgaac 412 Score = 67.9 bits (34), Expect = 4e-08 Identities = 100/122 (81%) Strand = Plus / Minus Query: 235 actgggtcggcgatgtggtcgaagaggttctcaaccggtccctttccggtgacgatggcc 294 |||||||| || | ||||||| | |||||||||| || |||||||||||||| |||||| Sbjct: 771 actgggtcagcaaggtggtcgtaaaggttctcaattgggccctttccggtgacaatggcc 712 Query: 295 tgcacgaagaagccgaacatggagaacatggcgaggcggccgttcttgagctccttgacc 354 || || ||||| || ||||| || ||||| || | || |||||||| |||||||| ||| Sbjct: 711 tggacaaagaatccaaacatagaaaacattgccaatcgtccgttcttaagctccttaacc 652 Query: 355 tt 356 || Sbjct: 651 tt 650
>gb|L29644.1|EGRLHCPII Euglena gracilis chlorophyll a/b binding protein (LHCPII) gene exons 1-5, 5' end Length = 3122 Score = 81.8 bits (41), Expect = 2e-12 Identities = 56/61 (91%) Strand = Plus / Minus Query: 531 caggttggggttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggcctt 590 |||| |||||||||||||||||| |||||| || ||||||||||||||||||||||||| Sbjct: 1999 caggctggggttgcccaggtagttcaggccgtccgcggagaagatctgcgcgccggcctt 1940 Query: 591 g 591 | Sbjct: 1939 g 1939 Score = 44.1 bits (22), Expect = 0.52 Identities = 37/42 (88%) Strand = Plus / Minus Query: 321 catggcgaggcggccgttcttgagctccttgaccttgagctc 362 |||||| || ||||||||||| | |||||| ||||||||||| Sbjct: 2909 catggccagacggccgttcttcacctccttcaccttgagctc 2868
>gb|DQ252493.1| Solanum tuberosum clone 062G02 chlorophyll a-b binding protein 3C-like mRNA, complete cds Length = 1055 Score = 81.8 bits (41), Expect = 2e-12 Identities = 131/161 (81%) Strand = Plus / Minus Query: 202 aagttggtggcgaaggcccacgcgttgttgttcactgggtcggcgatgtggtcgaagagg 261 ||||| ||||| |||||||| ||||||||||| |||||||| || | ||||||| ||| Sbjct: 823 aagtttgtggcaaaggcccaagcgttgttgttaactgggtcagcaaggtggtcggcaagg 764 Query: 262 ttctcaaccggtccctttccggtgacgatggcctgcacgaagaagccgaacatggagaac 321 ||||| | || |||||||||||||| || || || || ||||| || ||||| |||||| Sbjct: 763 ttctccaatggaccctttccggtgacaatagcttggacaaagaatccaaacatagagaac 704 Query: 322 atggcgaggcggccgttcttgagctccttgaccttgagctc 362 || || || | ||| ||||||| ||||| ||||||||||| Sbjct: 703 atagcaagtctgccattcttgatttccttaaccttgagctc 663
>gb|U03392.1|EGU03392 Euglena gracilis var. bacillaris PSII chlorophyll a/b binding protein (LHCPII) mRNA, partial cds Length = 1022 Score = 81.8 bits (41), Expect = 2e-12 Identities = 56/61 (91%) Strand = Plus / Minus Query: 531 caggttggggttgcccaggtagtcgaggccgccctcggagaagatctgcgcgccggcctt 590 |||| |||||||||||||||||| |||||| || ||||||||||||||||||||||||| Sbjct: 822 caggctggggttgcccaggtagttcaggccgtccgcggagaagatctgcgcgccggcctt 763 Query: 591 g 591 | Sbjct: 762 g 762 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,550,233 Number of Sequences: 3902068 Number of extensions: 4550233 Number of successful extensions: 88680 Number of sequences better than 10.0: 505 Number of HSP's better than 10.0 without gapping: 504 Number of HSP's successfully gapped in prelim test: 3 Number of HSP's that attempted gapping in prelim test: 86497 Number of HSP's gapped (non-prelim): 1918 length of query: 594 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 571 effective length of database: 17,143,297,704 effective search space: 9788822988984 effective search space used: 9788822988984 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)