ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd26b13
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC120791.13| Mus musculus chromosome 7, clone RP23-56I4, comp... 44 0.57
2gb|AC123030.4| Mus musculus BAC clone RP24-573I5 from chromosome... 44 0.57
3gb|AC138528.8| Mus musculus chromosome 3, clone RP23-329L9, comp... 42 2.3
4gb|AC155072.1| Homo sapiens chromosome 12 clone fa0727, complete... 40 8.9
5gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-... 40 8.9
6gb|AC068605.4| Mus musculus strain C57BL6/J chromosome 6 clone R... 40 8.9
7gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete... 40 8.9
8gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome 40 8.9
9ref|XM_707544.1| Candida albicans SC5314 hypothetical protein (C... 40 8.9
10ref|XM_707694.1| Candida albicans SC5314 hypothetical protein (C... 40 8.9
11gb|AC121497.15| Mus musculus chromosome 6, clone RP23-2M23, comp... 40 8.9
12gb|AC078859.13| Homo sapiens 3 BAC RP11-588N12 (Roswell Park Can... 40 8.9
13gb|AC135048.2| Homo sapiens chromosome 16 clone RP11-1072A3, com... 40 8.9
14gb|AC125119.2| Mus musculus BAC clone RP24-266E24 from chromosom... 40 8.9
15gb|DQ153261.1| Bacillus weihenstephanensis strain WSBC 10394 Nhe... 40 8.9
16gb|DQ153260.1| Bacillus weihenstephanensis strain WSBC 10386 Nhe... 40 8.9
17gb|DQ153259.1| Bacillus weihenstephanensis strain WSBC 10204 Nhe... 40 8.9
18gb|DQ153258.1| Bacillus weihenstephanensis strain NVH 453-92 Nhe... 40 8.9
19gb|DQ153257.1| Bacillus cereus strain NVH 0075-95 NheA (nheA), N... 40 8.9
20gb|CP000001.1| Bacillus cereus E33L, complete genome 40 8.9
21emb|AL442071.30| Human DNA sequence from clone RP11-420K8 on chr... 40 8.9
22emb|AL161740.16| Human DNA sequence from clone RP6-239D12 on chr... 40 8.9
23emb|AL606470.15| Mouse DNA sequence from clone RP23-293J11 on ch... 40 8.9
24gb|DQ019312.1| Bacillus cereus strain F4430/73 non-hemolytic ent... 40 8.9
25dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011 40 8.9
26gb|AF325332.1|F325326S07 Homo sapiens macrophin 1 isoforms (MACF... 40 8.9
27dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic D... 40 8.9
28gb|AC140063.13| Homo sapiens 12 BAC RP11-292I17 (Roswell Park Ca... 40 8.9
29gb|AC108476.5| Homo sapiens BAC clone RP11-1413K20 from 2, compl... 40 8.9
30gb|AC135050.3| Homo sapiens chromosome 16 clone RP11-196G11, com... 40 8.9
31gb|AC108846.15| Mus musculus chromosome 9, clone RP23-12I4, comp... 40 8.9
32gb|AC154008.1| Mus musculus 6 BAC RP24-470H20 (Roswell Park Canc... 40 8.9
33dbj|AP005657.3| Oryza sativa (japonica cultivar-group) genomic D... 40 8.9
34dbj|AB099298.1| Bacillus thuringiensis genes for non hemolytic e... 40 8.9
35emb|AJ937161.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
36emb|AJ937160.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
37emb|AJ937156.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
38emb|AJ937155.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
39emb|AJ937154.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
40emb|AJ937153.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
41emb|AJ937152.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
42emb|AJ937151.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
43emb|AJ937150.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
44emb|AJ937149.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
45emb|AJ937148.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
46emb|AJ937147.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
47emb|AJ937146.1| Bacillus thuringiensis partial nheA gene for Ent... 40 8.9
48emb|AJ937145.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
49emb|AJ937144.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
50emb|AJ937143.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
51emb|AJ937141.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
52emb|AJ937140.1| Bacillus cereus partial nheA gene for Enterotoxi... 40 8.9
53gb|CP000009.1| Gluconobacter oxydans 621H, complete genome 40 8.9
54gb|AY835995.1| Bacillus cereus isolate A6 non-hemolytic enteroto... 40 8.9
55gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome 40 8.9
56gb|AE016879.1| Bacillus anthracis str. Ames, complete genome 40 8.9
57gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome 40 8.9
58gb|AC170997.2| Mus musculus BAC clone RP24-198N9 from chromosome... 40 8.9 
>gb|AC120791.13| Mus musculus chromosome 7, clone RP23-56I4, complete sequence
          Length = 246249

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                    
Query: 472    ctcaaggaggccaaaagaaggg 493
              ||||||||||||||||||||||
Sbjct: 218821 ctcaaggaggccaaaagaaggg 218842
to top
>gb|AC123030.4| Mus musculus BAC clone RP24-573I5 from chromosome 7, complete sequence
          Length = 173971

 Score = 44.1 bits (22), Expect = 0.57
 Identities = 22/22 (100%)
 Strand = Plus / Plus

                                   
Query: 472   ctcaaggaggccaaaagaaggg 493
             ||||||||||||||||||||||
Sbjct: 30915 ctcaaggaggccaaaagaaggg 30936
to top
>gb|AC138528.8| Mus musculus chromosome 3, clone RP23-329L9, complete sequence
          Length = 188290

 Score = 42.1 bits (21), Expect = 2.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 472    ctcaaggaggccaaaagaagg 492
              |||||||||||||||||||||
Sbjct: 151215 ctcaaggaggccaaaagaagg 151235
to top
>gb|AC155072.1| Homo sapiens chromosome 12 clone fa0727, complete sequence
          Length = 32000

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                         
Query: 103   tgtgtacagatttgcagagatttgagag 130
             |||||||||||||||||| | |||||||
Sbjct: 12907 tgtgtacagatttgcagacaattgagag 12934
to top
>gb|AE017355.1| Bacillus thuringiensis serovar konkukian str. 97-27, complete genome
          Length = 5237682

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 525     atttcacaatatctccactt 544
               ||||||||||||||||||||
Sbjct: 1809763 atttcacaatatctccactt 1809744
to top
>gb|AC068605.4| Mus musculus strain C57BL6/J chromosome 6 clone RP23-284I15, complete
             sequence
          Length = 198551

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 603   caattttcctgaccacatct 622
             ||||||||||||||||||||
Sbjct: 34407 caattttcctgaccacatct 34388
to top
>gb|AE017334.2| Bacillus anthracis str. 'Ames Ancestor', complete genome
          Length = 5227419

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 525     atttcacaatatctccactt 544
               ||||||||||||||||||||
Sbjct: 1771537 atttcacaatatctccactt 1771518
to top
>gb|AE017225.1| Bacillus anthracis str. Sterne, complete genome
          Length = 5228663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 525     atttcacaatatctccactt 544
               ||||||||||||||||||||
Sbjct: 1771481 atttcacaatatctccactt 1771462
to top
>ref|XM_707544.1| Candida albicans SC5314 hypothetical protein (CaO19.4183), mRNA
          Length = 2664

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 555  tgacaccagtacttgcatca 574
            ||||||||||||||||||||
Sbjct: 2473 tgacaccagtacttgcatca 2454
to top
>ref|XM_707694.1| Candida albicans SC5314 hypothetical protein (CaO19.11659), mRNA
          Length = 2664

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 555  tgacaccagtacttgcatca 574
            ||||||||||||||||||||
Sbjct: 2473 tgacaccagtacttgcatca 2454
to top
>gb|AC121497.15| Mus musculus chromosome 6, clone RP23-2M23, complete sequence
          Length = 231059

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 603    caattttcctgaccacatct 622
              ||||||||||||||||||||
Sbjct: 121424 caattttcctgaccacatct 121443
to top
>gb|AC078859.13| Homo sapiens 3 BAC RP11-588N12 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 176802

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 601    tccaattttcctgaccacat 620
              ||||||||||||||||||||
Sbjct: 167390 tccaattttcctgaccacat 167409
to top
>gb|AC135048.2| Homo sapiens chromosome 16 clone RP11-1072A3, complete sequence
          Length = 177719

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 611   ctgaccacatctctatgcctcagt 634
             |||||||||||||| |||||||||
Sbjct: 28786 ctgaccacatctctgtgcctcagt 28763
to top
>gb|AC125119.2| Mus musculus BAC clone RP24-266E24 from chromosome 6, complete
            sequence
          Length = 194445

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 595  cttccctccaattttcctga 614
            ||||||||||||||||||||
Sbjct: 3544 cttccctccaattttcctga 3563
to top
>gb|DQ153261.1| Bacillus weihenstephanensis strain WSBC 10394 NheA (nheA), NheB
            (nheB), and NheC (nheC) genes, complete cds
          Length = 4517

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 525  atttcacaatatctccactt 544
            ||||||||||||||||||||
Sbjct: 1496 atttcacaatatctccactt 1477
to top
>gb|DQ153260.1| Bacillus weihenstephanensis strain WSBC 10386 NheA (nheA), NheB
            (nheB), and NheC (nheC) genes, complete cds
          Length = 4524

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 525  atttcacaatatctccactt 544
            ||||||||||||||||||||
Sbjct: 1497 atttcacaatatctccactt 1478
to top
>gb|DQ153259.1| Bacillus weihenstephanensis strain WSBC 10204 NheA (nheA), NheB
            (nheB), and NheC (nheC) genes, complete cds
          Length = 4504

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 525  atttcacaatatctccactt 544
            ||||||||||||||||||||
Sbjct: 1511 atttcacaatatctccactt 1492
to top
>gb|DQ153258.1| Bacillus weihenstephanensis strain NVH 453-92 NheA (nheA), NheB
            (nheB), and NheC (nheC) genes, complete cds
          Length = 4513

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 525  atttcacaatatctccactt 544
            ||||||||||||||||||||
Sbjct: 1494 atttcacaatatctccactt 1475
to top
>gb|DQ153257.1| Bacillus cereus strain NVH 0075-95 NheA (nheA), NheB (nheB), and NheC
            (nheC) genes, complete cds
          Length = 4463

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 525  atttcacaatatctccactt 544
            ||||||||||||||||||||
Sbjct: 1476 atttcacaatatctccactt 1457
to top
>gb|CP000001.1| Bacillus cereus E33L, complete genome
          Length = 5300915

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 525     atttcacaatatctccactt 544
               ||||||||||||||||||||
Sbjct: 1796891 atttcacaatatctccactt 1796872
to top
>emb|AL442071.30| Human DNA sequence from clone RP11-420K8 on chromosome 1 Contains part
             of the MACF1 gene for microtubule-actin crosslinking
             factor 1, a novel gene, a heat shock 10kDa protein 1
             (chaperonin 10) (HSPE1) pseudogene and a CpG island,
             complete sequence
          Length = 121295

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 111   gatttgcagagatttgagag 130
             ||||||||||||||||||||
Sbjct: 73430 gatttgcagagatttgagag 73449
to top
>emb|AL161740.16| Human DNA sequence from clone RP6-239D12 on chromosome 1p32.1-33
             Contains 3' end of the DAB1 gene for disabled homolog 1
             (Drosophila), a novel gene and the 5' end of a novel gene,
             complete sequence
          Length = 60856

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 290   ttctggagaacgtaagggag 309
             ||||||||||||||||||||
Sbjct: 16675 ttctggagaacgtaagggag 16656
to top
>emb|AL606470.15| Mouse DNA sequence from clone RP23-293J11 on chromosome 11 Contains a
              Friedreich ataxia protein (Frda) pseudogene, complete
              sequence
          Length = 203970

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 108    acagatttgcagagatttga 127
              ||||||||||||||||||||
Sbjct: 132052 acagatttgcagagatttga 132033
to top
>gb|DQ019312.1| Bacillus cereus strain F4430/73 non-hemolytic enterotoxin operon,
            partial sequence
          Length = 3160

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 525  atttcacaatatctccactt 544
            ||||||||||||||||||||
Sbjct: 1357 atttcacaatatctccactt 1338
to top
>dbj|AP007171.1| Aspergillus oryzae RIB40 genomic DNA, SC011
          Length = 2505489

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 39     catattacggcaaatataca 58
              ||||||||||||||||||||
Sbjct: 454371 catattacggcaaatataca 454390
to top
>gb|AF325332.1|F325326S07 Homo sapiens macrophin 1 isoforms (MACF1) gene, exons 22, 23, and 24
          Length = 6799

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 111  gatttgcagagatttgagag 130
            ||||||||||||||||||||
Sbjct: 2679 gatttgcagagatttgagag 2698
to top
>dbj|AP008214.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8,
              complete sequence
          Length = 28434780

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 261    aactcatcttcgacgacccc 280
              ||||||||||||||||||||
Sbjct: 753684 aactcatcttcgacgacccc 753665
to top
>gb|AC140063.13| Homo sapiens 12 BAC RP11-292I17 (Roswell Park Cancer Institute Human
             BAC Library) complete sequence
          Length = 61695

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 26/28 (92%)
 Strand = Plus / Minus

                                         
Query: 103   tgtgtacagatttgcagagatttgagag 130
             |||||||||||||||||| | |||||||
Sbjct: 15534 tgtgtacagatttgcagacaattgagag 15507
to top
>gb|AC108476.5| Homo sapiens BAC clone RP11-1413K20 from 2, complete sequence
          Length = 139342

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 619    atctctatgcctcagtgatc 638
              ||||||||||||||||||||
Sbjct: 128853 atctctatgcctcagtgatc 128834
to top
>gb|AC135050.3| Homo sapiens chromosome 16 clone RP11-196G11, complete sequence
          Length = 182230

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 611   ctgaccacatctctatgcctcagt 634
             |||||||||||||| |||||||||
Sbjct: 33823 ctgaccacatctctgtgcctcagt 33846
to top
>gb|AC108846.15| Mus musculus chromosome 9, clone RP23-12I4, complete sequence
          Length = 212729

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 474    caaggaggccaaaagaaggg 493
              ||||||||||||||||||||
Sbjct: 169783 caaggaggccaaaagaaggg 169802
to top
>gb|AC154008.1| Mus musculus 6 BAC RP24-470H20 (Roswell Park Cancer Institute (C57BL/6J
             Male) Mouse BAC Library) complete sequence
          Length = 139613

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 595   cttccctccaattttcctga 614
             ||||||||||||||||||||
Sbjct: 76001 cttccctccaattttcctga 76020
to top
>dbj|AP005657.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 8, PAC
             clone:P0427G12
          Length = 185545

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 261   aactcatcttcgacgacccc 280
             ||||||||||||||||||||
Sbjct: 52904 aactcatcttcgacgacccc 52885
to top
>dbj|AB099298.1| Bacillus thuringiensis genes for non hemolytic enterotoxin A, non
           hemolytic enterotoxin B, non hemolytic enterotoxin C,
           complete cds
          Length = 3594

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 604 atttcacaatatctccactt 585
to top
>emb|AJ937161.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain SL
          Length = 463

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 323 atttcacaatatctccactt 304
to top
>emb|AJ937160.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain SD
          Length = 417

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 300 atttcacaatatctccactt 281
to top
>emb|AJ937156.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain BS
          Length = 663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 394 atttcacaatatctccactt 375
to top
>emb|AJ937155.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain 11
          Length = 663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 394 atttcacaatatctccactt 375
to top
>emb|AJ937154.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain SM
          Length = 360

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 242 atttcacaatatctccactt 223
to top
>emb|AJ937153.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain C33
          Length = 663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 394 atttcacaatatctccactt 375
to top
>emb|AJ937152.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain
           F2085/98
          Length = 436

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 294 atttcacaatatctccactt 275
to top
>emb|AJ937151.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain PF
          Length = 663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 394 atttcacaatatctccactt 375
to top
>emb|AJ937150.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain I15
          Length = 663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 394 atttcacaatatctccactt 375
to top
>emb|AJ937149.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain LMG
           17615
          Length = 654

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 394 atttcacaatatctccactt 375
to top
>emb|AJ937148.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain
           F4815/94
          Length = 663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 394 atttcacaatatctccactt 375
to top
>emb|AJ937147.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain
           F0285/78
          Length = 663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 394 atttcacaatatctccactt 375
to top
>emb|AJ937146.1| Bacillus thuringiensis partial nheA gene for Enterotoxin A, strain
           CIP 53137
          Length = 663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 394 atttcacaatatctccactt 375
to top
>emb|AJ937145.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain C13
          Length = 663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 394 atttcacaatatctccactt 375
to top
>emb|AJ937144.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain WSBC
           10204
          Length = 663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 394 atttcacaatatctccactt 375
to top
>emb|AJ937143.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain 1
          Length = 663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 394 atttcacaatatctccactt 375
to top
>emb|AJ937141.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain C35
          Length = 663

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 394 atttcacaatatctccactt 375
to top
>emb|AJ937140.1| Bacillus cereus partial nheA gene for Enterotoxin A, strain I21
          Length = 665

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 525 atttcacaatatctccactt 544
           ||||||||||||||||||||
Sbjct: 394 atttcacaatatctccactt 375
to top
>gb|CP000009.1| Gluconobacter oxydans 621H, complete genome
          Length = 2702173

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 393     ccgcaccagctttgctccac 412
               ||||||||||||||||||||
Sbjct: 2019792 ccgcaccagctttgctccac 2019773
to top
>gb|AY835995.1| Bacillus cereus isolate A6 non-hemolytic enterotoxin A (nheA),
            non-hemolytic enterotoxin B (nheB), and non-hemolytic
            enterotoxin C (nheC) genes, complete cds
          Length = 4187

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 525  atttcacaatatctccactt 544
            ||||||||||||||||||||
Sbjct: 1192 atttcacaatatctccactt 1173
to top
>gb|AE016877.1| Bacillus cereus ATCC 14579, complete genome
          Length = 5411809

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                       
Query: 51      aatatacatgcttgctctctttct 74
               ||||||| ||||||||||||||||
Sbjct: 4600484 aatatacgtgcttgctctctttct 4600507



 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 525     atttcacaatatctccactt 544
               ||||||||||||||||||||
Sbjct: 1765851 atttcacaatatctccactt 1765832
to top
>gb|AE016879.1| Bacillus anthracis str. Ames, complete genome
          Length = 5227293

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 525     atttcacaatatctccactt 544
               ||||||||||||||||||||
Sbjct: 1771414 atttcacaatatctccactt 1771395
to top
>gb|AE017194.1| Bacillus cereus ATCC 10987, complete genome
          Length = 5224283

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                   
Query: 525     atttcacaatatctccactt 544
               ||||||||||||||||||||
Sbjct: 1903336 atttcacaatatctccactt 1903317
to top
>gb|AC170997.2| Mus musculus BAC clone RP24-198N9 from chromosome 9, complete sequence
          Length = 146891

 Score = 40.1 bits (20), Expect = 8.9
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 474   caaggaggccaaaagaaggg 493
             ||||||||||||||||||||
Sbjct: 36353 caaggaggccaaaagaaggg 36372


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 5,150,241
Number of Sequences: 3902068
Number of extensions: 5150241
Number of successful extensions: 85991
Number of sequences better than 10.0: 58
Number of HSP's better than 10.0 without gapping: 58
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 85708
Number of HSP's gapped (non-prelim): 283
length of query: 652
length of database: 17,233,045,268
effective HSP length: 23
effective length of query: 629
effective length of database: 17,143,297,704
effective search space: 10783134255816
effective search space used: 10783134255816
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top