ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd25j23 |
|---|---|
| Clone Library Name | barley_pub |
>emb|X96979.1|HVLTP7A2B H.vulgare mRNA for lipid transfer protein 7a2b Length = 755 Score = 260 bits (131), Expect = 1e-66 Identities = 149/155 (96%), Gaps = 1/155 (0%) Strand = Plus / Minus Query: 1 tgctagtggnccttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccg 60 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 466 tgctagtggaccttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccg 407 Query: 61 nacttgccgngcacgccggcanaccttgcccatgttgatggccttgatgctggtagcgag 120 |||||||| |||| |||| | |||||||||||||||||||||||||||||||||||||| Sbjct: 406 cacttgccgggcactccgg-agaccttgcccatgttgatggccttgatgctggtagcgag 348 Query: 121 gctcttgaggcacctgcacgccgtctgccggtccg 155 ||||||||||||||||||||||||||||||||||| Sbjct: 347 gctcttgaggcacctgcacgccgtctgccggtccg 313
>emb|X68656.1|HVCW19 H.vulgare Cw-19 mRNA Length = 660 Score = 236 bits (119), Expect = 2e-59 Identities = 137/143 (95%), Gaps = 1/143 (0%) Strand = Plus / Minus Query: 1 tgctagtggnccttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccg 60 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 404 tgctagtggaccttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccg 345 Query: 61 nacttgccgngcacgccggcanaccttgcccatgttgatggccttgatgctggtagcgag 120 |||||||| ||||||||| | |||||||||||||||||| ||||||||||||||||||| Sbjct: 344 cacttgccgggcacgccgg-agaccttgcccatgttgatgcccttgatgctggtagcgag 286 Query: 121 gctcttgaggcacctgcacgccg 143 ||||||||||||||||||||||| Sbjct: 285 gctcttgaggcacctgcacgccg 263
>gb|AY226580.1| Triticum aestivum lipid transfer protein 3 (LTP3) mRNA, complete cds Length = 555 Score = 198 bits (100), Expect = 3e-48 Identities = 122/129 (94%), Gaps = 1/129 (0%) Strand = Plus / Minus Query: 13 ttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgngc 72 |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| || Sbjct: 435 ttgttgcagttggtggacatgctgatggggaagggcacgctgacgccgcacttgccgggc 376 Query: 73 acgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgaggca 132 ||||||| | ||||||||||||||||||| |||||||||||| ||||||||||||||||| Sbjct: 375 acgccgg-agaccttgcccatgttgatggacttgatgctggtggcgaggctcttgaggca 317 Query: 133 cctgcacgc 141 ||||||||| Sbjct: 316 cctgcacgc 308
>emb|AJ852548.1| Triticum aestivum ltp9.4b gene for type 1 non specific lipid transfer protein precursor, exons 1-2 Length = 2000 Score = 192 bits (97), Expect = 2e-46 Identities = 122/130 (93%), Gaps = 1/130 (0%) Strand = Plus / Minus Query: 12 cttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgng 71 ||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| | Sbjct: 1364 cttgttgcagttggtggacatgctgatggggaagggcacgctgacgccgcacttgccggg 1305 Query: 72 cacgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgaggc 131 |||||||| | |||||| |||||||||||| |||||||||||| |||||||||||||||| Sbjct: 1304 cacgccgg-agaccttgtccatgttgatggacttgatgctggtggcgaggctcttgaggc 1246 Query: 132 acctgcacgc 141 |||||||||| Sbjct: 1245 acctgcacgc 1236
>emb|AJ852561.1| Triticum aestivum mRNA for type 1 non specific lipid transfer protein precursor (ltp9.4b gene) Length = 776 Score = 190 bits (96), Expect = 8e-46 Identities = 121/129 (93%), Gaps = 1/129 (0%) Strand = Plus / Minus Query: 13 ttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgngc 72 |||||||||| ||||||||||||||||||||||||||||||||||||| |||||||| || Sbjct: 427 ttgttgcagttggtggacatgctgatggggaagggcacgctgacgccgcacttgccgggc 368 Query: 73 acgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgaggca 132 ||||||| | |||||| |||||||||||| |||||||||||| ||||||||||||||||| Sbjct: 367 acgccgg-agaccttgtccatgttgatggacttgatgctggtggcgaggctcttgaggca 309 Query: 133 cctgcacgc 141 ||||||||| Sbjct: 308 cctgcacgc 300
>emb|AJ784900.2| Triticum aestivum mRNA for type 1 non-specific lipid transfer protein precursor (ltp9.4 gene) Length = 771 Score = 180 bits (91), Expect = 8e-43 Identities = 116/124 (93%), Gaps = 1/124 (0%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgngcacgcc 77 ||||| ||||||||||||||||||||||||||| ||||||||| |||||||| ||||||| Sbjct: 429 gcagttggtggacatgctgatggggaagggcacactgacgccgcacttgccgggcacgcc 370 Query: 78 ggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgaggcacctgc 137 || | ||||||||||||||||||| |||||||||||| |||||||||||||||||||||| Sbjct: 369 gg-agaccttgcccatgttgatggacttgatgctggtggcgaggctcttgaggcacctgc 311 Query: 138 acgc 141 |||| Sbjct: 310 acgc 307
>emb|AJ852541.1| Triticum aestivum ltp9.4a gene for type 1 non specific lipid transfer protein precursor, exons 1-2 Length = 1965 Score = 180 bits (91), Expect = 8e-43 Identities = 116/124 (93%), Gaps = 1/124 (0%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgngcacgcc 77 ||||| ||||||||||||||||||||||||||| ||||||||| |||||||| ||||||| Sbjct: 1197 gcagttggtggacatgctgatggggaagggcacactgacgccgcacttgccgggcacgcc 1138 Query: 78 ggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgaggcacctgc 137 || | ||||||||||||||||||| |||||||||||| |||||||||||||||||||||| Sbjct: 1137 gg-agaccttgcccatgttgatggacttgatgctggtggcgaggctcttgaggcacctgc 1079 Query: 138 acgc 141 |||| Sbjct: 1078 acgc 1075
>gb|AF439446.1|AF439446 Setaria italica lipid transfer protein mRNA, complete cds Length = 851 Score = 111 bits (56), Expect = 6e-22 Identities = 123/145 (84%), Gaps = 1/145 (0%) Strand = Plus / Minus Query: 11 ccttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgn 70 ||||||||||||||||||||||||||||| |||| |||||| ||||||| |||||||| Sbjct: 424 ccttgttgcagtcggtggacatgctgatgcggaatggcacggagacgccgcacttgccgg 365 Query: 71 gcacgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgagg 130 | | |||||| || |||||||||||| ||||||| || ||||||||||||||| Sbjct: 364 ggatgccggc-gacggtgcccatgttgagcttcttgatggtgccggcgaggctcttgagg 306 Query: 131 cacctgcacgccgtctgccggtccg 155 |||| |||||||| ||||||||||| Sbjct: 305 caccggcacgccgcctgccggtccg 281
>dbj|AK064888.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000K13, full insert sequence Length = 737 Score = 75.8 bits (38), Expect = 3e-11 Identities = 117/143 (81%), Gaps = 1/143 (0%) Strand = Plus / Minus Query: 11 ccttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgn 70 ||||||||||||||||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 479 ccttgttgcagtcggtggagaggctgatggggaagccgacgttgacgccgcacttgccgg 420 Query: 71 gcacgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgagg 130 | |||||||| || |||| | ||||| | |||||||||| ||||||||||||||| Sbjct: 419 ggacgccggc-gacggtgccgaggttgagcgacttgatgctgccggcgaggctcttgagg 361 Query: 131 cacctgcacgccgtctgccggtc 153 || | ||| |||| ||| ||||| Sbjct: 360 cagcggcaggccgcctggcggtc 338
>dbj|AK061740.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-E11, full insert sequence Length = 1437 Score = 75.8 bits (38), Expect = 3e-11 Identities = 117/143 (81%), Gaps = 1/143 (0%) Strand = Plus / Minus Query: 11 ccttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgn 70 ||||||||||||||||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 1161 ccttgttgcagtcggtggagaggctgatggggaagccgacgttgacgccgcacttgccgg 1102 Query: 71 gcacgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgagg 130 | |||||||| || |||| | ||||| | |||||||||| ||||||||||||||| Sbjct: 1101 ggacgccggc-gacggtgccgaggttgagcgacttgatgctgccggcgaggctcttgagg 1043 Query: 131 cacctgcacgccgtctgccggtc 153 || | ||| |||| ||| ||||| Sbjct: 1042 cagcggcaggccgcctggcggtc 1020
>gb|AC123514.2| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBb0004B05, complete sequence Length = 121223 Score = 73.8 bits (37), Expect = 1e-10 Identities = 116/142 (81%), Gaps = 1/142 (0%) Strand = Plus / Minus Query: 12 cttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgng 71 |||||||||||||||||| | ||||||||||||| ||| |||||||| |||||||| | Sbjct: 702 cttgttgcagtcggtggagaggctgatggggaagccgacgttgacgccgcacttgccggg 643 Query: 72 cacgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgaggc 131 |||||||| || |||| | ||||| | |||||||||| |||||||||||||||| Sbjct: 642 gacgccggc-gacggtgccgaggttgagcgacttgatgctgccggcgaggctcttgaggc 584 Query: 132 acctgcacgccgtctgccggtc 153 | | ||| |||| ||| ||||| Sbjct: 583 agcggcaggccgcctggcggtc 562
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete sequence Length = 28386948 Score = 73.8 bits (37), Expect = 1e-10 Identities = 116/142 (81%), Gaps = 1/142 (0%) Strand = Plus / Minus Query: 12 cttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgng 71 |||||||||||||||||| | ||||||||||||| ||| |||||||| |||||||| | Sbjct: 722411 cttgttgcagtcggtggagaggctgatggggaagccgacgttgacgccgcacttgccggg 722352 Query: 72 cacgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgaggc 131 |||||||| || |||| | ||||| | |||||||||| |||||||||||||||| Sbjct: 722351 gacgccggc-gacggtgccgaggttgagcgacttgatgctgccggcgaggctcttgaggc 722293 Query: 132 acctgcacgccgtctgccggtc 153 | | ||| |||| ||| ||||| Sbjct: 722292 agcggcaggccgcctggcggtc 722271 Score = 46.1 bits (23), Expect = 0.031 Identities = 49/58 (84%) Strand = Plus / Minus Query: 12 cttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccg 69 |||| ||||||| ||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 714881 cttgctgcagtcagtggagaggctgatggggaagccgacgttgacgccgcacttgccg 714824 Score = 38.2 bits (19), Expect = 7.4 Identities = 30/34 (88%) Strand = Plus / Minus Query: 33 gctgatggggaagggcacgctgacgccgnacttg 66 |||||||| | |||| |||||||||||| ||||| Sbjct: 13090040 gctgatggtgtaggggacgctgacgccgcacttg 13090007
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence Length = 28369397 Score = 73.8 bits (37), Expect = 1e-10 Identities = 116/142 (81%), Gaps = 1/142 (0%) Strand = Plus / Minus Query: 12 cttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgng 71 |||||||||||||||||| | ||||||||||||| ||| |||||||| |||||||| | Sbjct: 722411 cttgttgcagtcggtggagaggctgatggggaagccgacgttgacgccgcacttgccggg 722352 Query: 72 cacgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgaggc 131 |||||||| || |||| | ||||| | |||||||||| |||||||||||||||| Sbjct: 722351 gacgccggc-gacggtgccgaggttgagcgacttgatgctgccggcgaggctcttgaggc 722293 Query: 132 acctgcacgccgtctgccggtc 153 | | ||| |||| ||| ||||| Sbjct: 722292 agcggcaggccgcctggcggtc 722271 Score = 46.1 bits (23), Expect = 0.031 Identities = 49/58 (84%) Strand = Plus / Minus Query: 12 cttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccg 69 |||| ||||||| ||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 714881 cttgctgcagtcagtggagaggctgatggggaagccgacgttgacgccgcacttgccg 714824 Score = 38.2 bits (19), Expect = 7.4 Identities = 30/34 (88%) Strand = Plus / Minus Query: 33 gctgatggggaagggcacgctgacgccgnacttg 66 |||||||| | |||| |||||||||||| ||||| Sbjct: 13170219 gctgatggtgtaggggacgctgacgccgcacttg 13170186
>emb|BX000512.1|CNS08CE2 Oryza sativa chromosome 11, . BAC OSJNBa0025K19 of library OSJNBa from chromosome 11 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 181322 Score = 73.8 bits (37), Expect = 1e-10 Identities = 116/142 (81%), Gaps = 1/142 (0%) Strand = Plus / Plus Query: 12 cttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgng 71 |||||||||||||||||| | ||||||||||||| ||| |||||||| |||||||| | Sbjct: 20561 cttgttgcagtcggtggagaggctgatggggaagccgacgttgacgccgcacttgccggg 20620 Query: 72 cacgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgaggc 131 |||||||| || |||| | ||||| | |||||||||| |||||||||||||||| Sbjct: 20621 gacgccggc-gacggtgccgaggttgagcgacttgatgctgccggcgaggctcttgaggc 20679 Query: 132 acctgcacgccgtctgccggtc 153 | | ||| |||| ||| ||||| Sbjct: 20680 agcggcaggccgcctggcggtc 20701 Score = 46.1 bits (23), Expect = 0.031 Identities = 49/58 (84%) Strand = Plus / Plus Query: 12 cttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccg 69 |||| ||||||| ||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 28091 cttgctgcagtcagtggagaggctgatggggaagccgacgttgacgccgcacttgccg 28148
>dbj|AK060108.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-308-C09, full insert sequence Length = 1196 Score = 71.9 bits (36), Expect = 5e-10 Identities = 115/141 (81%), Gaps = 1/141 (0%) Strand = Plus / Minus Query: 13 ttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgngc 72 ||||||||||||||||| | ||||||||||||| ||| |||||||| |||||||| | Sbjct: 429 ttgttgcagtcggtggagaggctgatggggaagccgacgttgacgccgcacttgccgggg 370 Query: 73 acgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgaggca 132 |||||||| || |||| | ||||| | |||||||||| ||||||||||||||||| Sbjct: 369 acgccggc-gacggtgccgaggttgagcgacttgatgctgccggcgaggctcttgaggca 311 Query: 133 cctgcacgccgtctgccggtc 153 | ||| |||| ||| ||||| Sbjct: 310 gcggcaggccgcctggcggtc 290
>emb|AJ704771.1| Oryza sativa (japonica cultivar-group) mRNA for lipid transfer protein (ltp2 gene) Length = 417 Score = 67.9 bits (34), Expect = 8e-09 Identities = 116/143 (81%), Gaps = 1/143 (0%) Strand = Plus / Minus Query: 11 ccttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgn 70 ||||||||||||||||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 379 ccttgttgcagtcggtggagaggctgatggggaagccgacgttgacgccgcacttgccgg 320 Query: 71 gcacgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgagg 130 | ||||| || || |||| | ||||| | |||||||||| ||||||||||||||| Sbjct: 319 ggacgccagc-gacggtgccgaggttgagcgacttgatgctgccggcgaggctcttgagg 261 Query: 131 cacctgcacgccgtctgccggtc 153 || | ||| |||| ||| ||||| Sbjct: 260 cagcggcaggccgcctggcggtc 238
>dbj|AP008218.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 12, complete sequence Length = 27566993 Score = 65.9 bits (33), Expect = 3e-08 Identities = 115/142 (80%), Gaps = 1/142 (0%) Strand = Plus / Minus Query: 12 cttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgng 71 |||||||||||||||||| | ||||||||||||| ||| |||||||| | |||||| | Sbjct: 760383 cttgttgcagtcggtggagaggctgatggggaagccaacgttgacgccgcatttgccggg 760324 Query: 72 cacgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgaggc 131 |||||||| || |||| | ||||| | |||||||||| |||||||||||||||| Sbjct: 760323 gacgccggc-gacggtgccgaggttgagcgacttgatgctgccggcgaggctcttgaggc 760265 Query: 132 acctgcacgccgtctgccggtc 153 | | ||| |||| ||| ||||| Sbjct: 760264 agcggcaggccgcctggcggtc 760243 Score = 46.1 bits (23), Expect = 0.031 Identities = 49/58 (84%) Strand = Plus / Minus Query: 12 cttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccg 69 |||| ||||||| ||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 745591 cttgctgcagtcagtggagaggctgatggggaagccgacgttgacgccgcacttgccg 745534 Score = 38.2 bits (19), Expect = 7.4 Identities = 30/34 (88%) Strand = Plus / Minus Query: 33 gctgatggggaagggcacgctgacgccgnacttg 66 |||||||| | |||| |||||||||||| ||||| Sbjct: 736726 gctgatggtgtaggggacgctgacgccgcacttg 736693
>gb|DP000011.1| Oryza sativa (japonica cultivar-group) chromosome 12, complete sequence Length = 27492551 Score = 65.9 bits (33), Expect = 3e-08 Identities = 115/142 (80%), Gaps = 1/142 (0%) Strand = Plus / Minus Query: 12 cttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgng 71 |||||||||||||||||| | ||||||||||||| ||| |||||||| | |||||| | Sbjct: 760383 cttgttgcagtcggtggagaggctgatggggaagccaacgttgacgccgcatttgccggg 760324 Query: 72 cacgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgaggc 131 |||||||| || |||| | ||||| | |||||||||| |||||||||||||||| Sbjct: 760323 gacgccggc-gacggtgccgaggttgagcgacttgatgctgccggcgaggctcttgaggc 760265 Query: 132 acctgcacgccgtctgccggtc 153 | | ||| |||| ||| ||||| Sbjct: 760264 agcggcaggccgcctggcggtc 760243 Score = 46.1 bits (23), Expect = 0.031 Identities = 49/58 (84%) Strand = Plus / Minus Query: 12 cttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccg 69 |||| ||||||| ||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 745591 cttgctgcagtcagtggagaggctgatggggaagccgacgttgacgccgcacttgccg 745534 Score = 38.2 bits (19), Expect = 7.4 Identities = 30/34 (88%) Strand = Plus / Minus Query: 33 gctgatggggaagggcacgctgacgccgnacttg 66 |||||||| | |||| |||||||||||| ||||| Sbjct: 736726 gctgatggtgtaggggacgctgacgccgcacttg 736693
>emb|BX000511.2|CNS08CE1 Oryza sativa chromosome 12, . BAC OJ1136_E08 of library Monsanto from chromosome 12 of cultivar Nipponbare of ssp. japonica of Oryza sativa (rice), complete sequence Length = 118211 Score = 65.9 bits (33), Expect = 3e-08 Identities = 115/142 (80%), Gaps = 1/142 (0%) Strand = Plus / Plus Query: 12 cttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccgng 71 |||||||||||||||||| | ||||||||||||| ||| |||||||| | |||||| | Sbjct: 18751 cttgttgcagtcggtggagaggctgatggggaagccaacgttgacgccgcatttgccggg 18810 Query: 72 cacgccggcanaccttgcccatgttgatggccttgatgctggtagcgaggctcttgaggc 131 |||||||| || |||| | ||||| | |||||||||| |||||||||||||||| Sbjct: 18811 gacgccggc-gacggtgccgaggttgagcgacttgatgctgccggcgaggctcttgaggc 18869 Query: 132 acctgcacgccgtctgccggtc 153 | | ||| |||| ||| ||||| Sbjct: 18870 agcggcaggccgcctggcggtc 18891 Score = 46.1 bits (23), Expect = 0.031 Identities = 49/58 (84%) Strand = Plus / Plus Query: 12 cttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccg 69 |||| ||||||| ||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 33543 cttgctgcagtcagtggagaggctgatggggaagccgacgttgacgccgcacttgccg 33600 Score = 38.2 bits (19), Expect = 7.4 Identities = 30/34 (88%) Strand = Plus / Plus Query: 33 gctgatggggaagggcacgctgacgccgnacttg 66 |||||||| | |||| |||||||||||| ||||| Sbjct: 42408 gctgatggtgtaggggacgctgacgccgcacttg 42441
>emb|X71669.1|SVTLP1R S.vulgare ltp1 mRNA Length = 717 Score = 52.0 bits (26), Expect = 5e-04 Identities = 43/49 (87%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| |||||||||||| ||||| Sbjct: 292 gcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttg 244
>emb|X71667.1|SVLTP1 S.vulgare ltp1 gene Length = 1499 Score = 52.0 bits (26), Expect = 5e-04 Identities = 43/49 (87%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| |||||||||||| ||||| Sbjct: 995 gcagtcggtggaggtgctgatggtgtaggggacgctgacgccgcacttg 947
>dbj|AK073363.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033030A16, full insert sequence Length = 760 Score = 48.1 bits (24), Expect = 0.008 Identities = 50/59 (84%) Strand = Plus / Minus Query: 11 ccttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccg 69 ||||| ||||||| ||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 437 ccttgctgcagtcagtggagaggctgatggggaagccgacgttgacgccgcacttgccg 379
>dbj|AK070192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023041I08, full insert sequence Length = 2914 Score = 48.1 bits (24), Expect = 0.008 Identities = 50/59 (84%) Strand = Plus / Minus Query: 11 ccttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccg 69 ||||| ||||||| ||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 2524 ccttgctgcagtcagtggagaggctgatggggaagccgacgttgacgccgcacttgccg 2466
>dbj|AK062690.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-106-A02, full insert sequence Length = 646 Score = 48.1 bits (24), Expect = 0.008 Identities = 50/59 (84%) Strand = Plus / Minus Query: 11 ccttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccg 69 ||||| ||||||| ||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 431 ccttgctgcagtcagtggagaggctgatggggaagccgacgttgacgccgcacttgccg 373
>dbj|AK061182.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-209-D09, full insert sequence Length = 928 Score = 48.1 bits (24), Expect = 0.008 Identities = 50/59 (84%) Strand = Plus / Minus Query: 11 ccttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccg 69 ||||| ||||||| ||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 436 ccttgctgcagtcagtggagaggctgatggggaagccgacgttgacgccgcacttgccg 378
>dbj|AK059737.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-202-D08, full insert sequence Length = 853 Score = 48.1 bits (24), Expect = 0.008 Identities = 50/59 (84%) Strand = Plus / Minus Query: 11 ccttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccg 69 ||||| ||||||| ||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 431 ccttgctgcagtcagtggagaggctgatggggaagccgacgttgacgccgcacttgccg 373
>dbj|AK059714.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-032-F09, full insert sequence Length = 773 Score = 48.1 bits (24), Expect = 0.008 Identities = 50/59 (84%) Strand = Plus / Minus Query: 11 ccttgttgcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttgccg 69 ||||| ||||||| ||||| | ||||||||||||| ||| |||||||| |||||||| Sbjct: 436 ccttgctgcagtcagtggagaggctgatggggaagccgacgttgacgccgcacttgccg 378
>gb|BT018347.1| Zea mays clone EL01T0403E02.c mRNA sequence Length = 827 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 432 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 384
>emb|X71668.1|SVLTP2 S.vulgare ltp2 gene Length = 1800 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 963 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 915
>gb|U66105.1|ZMU66105 Zea mays phospholipid transfer protein mRNA, complete cds Length = 770 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 421 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 373
>gb|DQ147213.1| Zea diploperennis isolate d7B phospholipid transfer protein 1 (plt1) gene, partial cds Length = 698 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 331 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 283
>gb|DQ147210.1| Zea diploperennis isolate d4 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 323 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 275
>gb|DQ147209.1| Zea diploperennis isolate d4a phospholipid transfer protein 1 (plt1) gene, partial cds Length = 514 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 323 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 275
>gb|DQ147207.1| Zea diploperennis isolate d2 phospholipid transfer protein 1 (plt1) gene, partial cds Length = 699 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 316 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 268
>gb|DQ147205.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 804 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 432 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 384
>gb|DQ147204.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 780 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 414 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 366
>gb|DQ147203.1| Zea mays subsp. parviglumis isolate p12 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 714 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 339 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 291
>gb|DQ147202.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 648 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 438 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 390
>gb|DQ147201.1| Zea mays subsp. parviglumis isolate p11a phospholipid transfer protein 1 (plt1) gene, complete cds Length = 829 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 451 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 403
>gb|DQ147199.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 453 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 405
>gb|DQ147198.1| Zea mays subsp. parviglumis isolate p6 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 821 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 448 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 400
>gb|DQ147197.1| Zea mays subsp. parviglumis isolate p5 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 832 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 451 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 403
>gb|DQ147196.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 835 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 448 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 400
>gb|DQ147194.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 814 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 448 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 400
>gb|DQ147193.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 1 (plt1) gene, complete cds Length = 831 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 449 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 401
>gb|DQ147192.1| Zea diploperennis isolate d8L phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 342 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 294
>gb|DQ147191.1| Zea diploperennis isolate d7 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 342 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 294
>gb|DQ147190.1| Zea diploperennis isolate d5b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 342 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 294
>gb|DQ147189.1| Zea diploperennis isolate d5 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 342 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 294
>gb|DQ147188.1| Zea diploperennis isolate d6 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 342 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 294
>gb|DQ147187.1| Zea diploperennis isolate d4 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 342 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 294
>gb|DQ147186.1| Zea diploperennis isolate d3b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 342 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 294
>gb|DQ147185.1| Zea diploperennis isolate d3a phospholipid transfer protein 2 (plt2) gene, partial cds Length = 635 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 342 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 294
>gb|DQ147184.1| Zea diploperennis isolate d2 phospholipid transfer protein 2 (plt2) gene, partial cds Length = 639 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 342 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 294
>gb|DQ147183.1| Zea diploperennis isolate d1b phospholipid transfer protein 2 (plt2) gene, partial cds Length = 613 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 316 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 268
>gb|DQ147182.1| Zea diploperennis isolate d1a phospholipid transfer protein 2 (pl2) gene, partial cds Length = 613 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 316 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 268
>gb|DQ147181.1| Zea mays subsp. parviglumis isolate p15 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 413 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 365
>gb|DQ147180.1| Zea mays subsp. parviglumis isolate p14 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 413 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 365
>gb|DQ147179.1| Zea mays subsp. parviglumis isolate p13 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 829 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 412 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 364
>gb|DQ147178.1| Zea mays subsp. parviglumis isolate p12G phospholipid transfer protein 2 (plt2) gene, complete cds Length = 816 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 413 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 365
>gb|DQ147177.1| Zea mays subsp. parviglumis isolate p11 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 413 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 365
>gb|DQ147176.1| Zea mays subsp. parviglumis isolate p9 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 826 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 413 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 365
>gb|DQ147175.1| Zea mays subsp. parviglumis isolate p8 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 818 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 413 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 365
>gb|DQ147174.1| Zea mays subsp. parviglumis isolate p6U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 822 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 413 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 365
>gb|DQ147173.1| Zea mays subsp. parviglumis isolate p6L phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 413 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 365
>gb|DQ147172.1| Zea mays subsp. parviglumis isolate p5_U phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 413 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 365
>gb|DQ147171.1| Zea mays subsp. parviglumis isolate p4 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 832 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 413 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 365
>gb|DQ147170.1| Zea mays subsp. parviglumis isolate p3 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 820 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 413 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 365
>gb|DQ147169.1| Zea mays subsp. parviglumis isolate p2 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 413 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 365
>gb|DQ147168.1| Zea mays subsp. parviglumis isolate p1 phospholipid transfer protein 2 (plt2) gene, complete cds Length = 824 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 413 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 365
>gb|M57249.1|MZEPLTPA Maize phospholipid transfer protein mRNA, 3' end Length = 677 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 262 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 214
>gb|J04176.1|MZEPLTP Maize phospholipid transfer protein mRNA, complete cds. of clone 9C2 Length = 813 Score = 44.1 bits (22), Expect = 0.12 Identities = 42/49 (85%) Strand = Plus / Minus Query: 18 gcagtcggtggacatgctgatggggaagggcacgctgacgccgnacttg 66 |||||||||||| ||||||||| | |||| | |||||||||| ||||| Sbjct: 449 gcagtcggtggaggtgctgatggtgtaggggatgctgacgccgcacttg 401
>ref|XM_465784.1| Oryza sativa (japonica cultivar-group), mRNA Length = 492 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 84 ccttgcccatgttgatggcc 103 |||||||||||||||||||| Sbjct: 451 ccttgcccatgttgatggcc 432
>gb|CP000135.1| Rhizobium etli CFN 42 plasmid p42b, complete sequence Length = 184338 Score = 40.1 bits (20), Expect = 1.9 Identities = 20/20 (100%) Strand = Plus / Minus Query: 21 gtcggtggacatgctgatgg 40 |||||||||||||||||||| Sbjct: 49102 gtcggtggacatgctgatgg 49083
>gb|U18127.1|HVU18127 Hordeum vulgare phospholipid transfer protein precursor gene, complete cds Length = 573 Score = 40.1 bits (20), Expect = 1.9 Identities = 31/35 (88%) Strand = Plus / Minus Query: 32 tgctgatggggaagggcacgctgacgccgnacttg 66 ||||||||| | |||| |||||||||||| ||||| Sbjct: 404 tgctgatggagtaggggacgctgacgccgcacttg 370
>ref|XM_477975.1| Oryza sativa (japonica cultivar-group), mRNA Length = 783 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 131 cacctgcacgccgtctgcc 149 ||||||||||||||||||| Sbjct: 75 cacctgcacgccgtctgcc 57
>gb|AF107258.1| Homo sapiens chromosome 21q22.1 PAC 295E05A, complete sequence Length = 154311 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 28 gacatgctgatggggaagg 46 ||||||||||||||||||| Sbjct: 80905 gacatgctgatggggaagg 80887
>gb|AC135561.3| Oryza sativa (japonica cultivar-group) chromosome 11 clone OSJNBa0086N07 map S790A, complete sequence Length = 178523 Score = 38.2 bits (19), Expect = 7.4 Identities = 30/34 (88%) Strand = Plus / Plus Query: 33 gctgatggggaagggcacgctgacgccgnacttg 66 |||||||| | |||| |||||||||||| ||||| Sbjct: 94040 gctgatggtgtaggggacgctgacgccgcacttg 94073
>gb|AC161374.6| Mus musculus BAC clone RP23-266O23 from chromosome 14, complete sequence Length = 202929 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 24 ggtggacatgctgatgggg 42 ||||||||||||||||||| Sbjct: 13558 ggtggacatgctgatgggg 13540
>emb|CR956650.4| Pig DNA sequence from clone CH242-171I16 on chromosome 6, complete sequence Length = 165704 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 85 cttgcccatgttgatggcc 103 ||||||||||||||||||| Sbjct: 68299 cttgcccatgttgatggcc 68317
>gb|AC163638.2| Mus musculus BAC clone RP23-188H10 from chromosome 14, complete sequence Length = 203950 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 24 ggtggacatgctgatgggg 42 ||||||||||||||||||| Sbjct: 98917 ggtggacatgctgatgggg 98935
>gb|AY335439.1| Streptomyces exfoliatus LieB (lieB) gene, complete cds Length = 3938 Score = 38.2 bits (19), Expect = 7.4 Identities = 25/27 (92%) Strand = Plus / Minus Query: 125 ttgaggcacctgcacgccgtctgccgg 151 |||||||| ||||| |||||||||||| Sbjct: 446 ttgaggcatctgcaagccgtctgccgg 420
>gb|CP000323.1| Psychrobacter cryohalolentis K5, complete genome Length = 3059876 Score = 38.2 bits (19), Expect = 7.4 Identities = 22/23 (95%) Strand = Plus / Minus Query: 90 ccatgttgatggccttgatgctg 112 ||||||||||| ||||||||||| Sbjct: 1715590 ccatgttgatgcccttgatgctg 1715568
>emb|Z37114.1|HVLTPPA H.vulgare (clone pKG2316) mRNA for lipid transfer protein precursor Length = 627 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 122 ctcttgaggcacctgcacg 140 ||||||||||||||||||| Sbjct: 241 ctcttgaggcacctgcacg 223
>emb|X68655.1|HVCW18 H.vulgare Cw-18 mRNA Length = 732 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 122 ctcttgaggcacctgcacg 140 ||||||||||||||||||| Sbjct: 312 ctcttgaggcacctgcacg 294
>emb|X56547.1|HSBLT4 H. vulgare BLT4 mRNA Length = 724 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 122 ctcttgaggcacctgcacg 140 ||||||||||||||||||| Sbjct: 310 ctcttgaggcacctgcacg 292
>dbj|AP007255.1| Magnetospirillum magneticum AMB-1 DNA, complete genome Length = 4967148 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 91 catgttgatggccttgatg 109 ||||||||||||||||||| Sbjct: 603671 catgttgatggccttgatg 603689
>gb|AC092724.2| Homo sapiens chromosome 16 clone RP11-571O6, complete sequence Length = 176521 Score = 38.2 bits (19), Expect = 7.4 Identities = 22/23 (95%) Strand = Plus / Plus Query: 92 atgttgatggccttgatgctggt 114 |||||||||||||||||| |||| Sbjct: 138762 atgttgatggccttgatggtggt 138784
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 131 cacctgcacgccgtctgcc 149 ||||||||||||||||||| Sbjct: 16094408 cacctgcacgccgtctgcc 16094390
>dbj|AP005256.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0038F09 Length = 166568 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 131 cacctgcacgccgtctgcc 149 ||||||||||||||||||| Sbjct: 64741 cacctgcacgccgtctgcc 64723
>dbj|BS000175.1| Pan troglodytes chromosome 22 clone:PTB-091H17, map 22, complete sequences Length = 183155 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 28 gacatgctgatggggaagg 46 ||||||||||||||||||| Sbjct: 112675 gacatgctgatggggaagg 112657
>emb|Y08691.1|OSLPI O.sativa mRNA for lipid transfer protein Length = 799 Score = 38.2 bits (19), Expect = 7.4 Identities = 30/34 (88%) Strand = Plus / Minus Query: 33 gctgatggggaagggcacgctgacgccgnacttg 66 |||||||| | |||| |||||||||||| ||||| Sbjct: 421 gctgatggtgtaggggacgctgacgccgcacttg 388
>emb|X83435.1|OSLTPA15 O.sativa mRNA for lipid transfer protein, a15 Length = 511 Score = 38.2 bits (19), Expect = 7.4 Identities = 30/34 (88%) Strand = Plus / Minus Query: 33 gctgatggggaagggcacgctgacgccgnacttg 66 |||||||| | |||| |||||||||||| ||||| Sbjct: 396 gctgatggtgtaggggacgctgacgccgcacttg 363
>emb|AJ338906.1|HSA338906 Homo sapiens genomic sequence surrounding NotI site, clone NL1-VH5R Length = 804 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 35 tgatggggaagggcacgct 53 ||||||||||||||||||| Sbjct: 290 tgatggggaagggcacgct 272
>dbj|AK071260.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023086A05, full insert sequence Length = 843 Score = 38.2 bits (19), Expect = 7.4 Identities = 30/34 (88%) Strand = Plus / Minus Query: 33 gctgatggggaagggcacgctgacgccgnacttg 66 |||||||| | |||| |||||||||||| ||||| Sbjct: 440 gctgatggtgtaggggacgctgacgccgcacttg 407
>dbj|AK061288.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-212-H12, full insert sequence Length = 846 Score = 38.2 bits (19), Expect = 7.4 Identities = 30/34 (88%) Strand = Plus / Minus Query: 33 gctgatggggaagggcacgctgacgccgnacttg 66 |||||||| | |||| |||||||||||| ||||| Sbjct: 439 gctgatggtgtaggggacgctgacgccgcacttg 406
>dbj|AK059808.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-205-A04, full insert sequence Length = 995 Score = 38.2 bits (19), Expect = 7.4 Identities = 30/34 (88%) Strand = Plus / Minus Query: 33 gctgatggggaagggcacgctgacgccgnacttg 66 |||||||| | |||| |||||||||||| ||||| Sbjct: 653 gctgatggtgtaggggacgctgacgccgcacttg 620
>dbj|AP000237.3| Homo sapiens genomic DNA, chromosome 21 clone:RP11-269P7, complete sequence Length = 153265 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 28 gacatgctgatggggaagg 46 ||||||||||||||||||| Sbjct: 114944 gacatgctgatggggaagg 114926
>dbj|AP001706.1| Homo sapiens genomic DNA, chromosome 21q, section 50/105 Length = 340000 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Minus Query: 28 gacatgctgatggggaagg 46 ||||||||||||||||||| Sbjct: 142188 gacatgctgatggggaagg 142170
>gb|U77295.1|OSU77295 Oryza sativa lipid transfer protein (LTP) mRNA, complete cds Length = 799 Score = 38.2 bits (19), Expect = 7.4 Identities = 30/34 (88%) Strand = Plus / Minus Query: 33 gctgatggggaagggcacgctgacgccgnacttg 66 |||||||| | |||| |||||||||||| ||||| Sbjct: 421 gctgatggtgtaggggacgctgacgccgcacttg 388
>dbj|AP000196.1| Homo sapiens genomic DNA, chromosome 21q22.1, D21S226-AML region, clone B355D16-T1073, segment 2/8, complete sequence Length = 100000 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 28 gacatgctgatggggaagg 46 ||||||||||||||||||| Sbjct: 96830 gacatgctgatggggaagg 96848
>dbj|AP000092.1| Homo sapiens genomic DNA of 21q22.1, GART and AML related, B335D16-P10G11 region, segment 2/7 Length = 100000 Score = 38.2 bits (19), Expect = 7.4 Identities = 19/19 (100%) Strand = Plus / Plus Query: 28 gacatgctgatggggaagg 46 ||||||||||||||||||| Sbjct: 96830 gacatgctgatggggaagg 96848 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 724,707 Number of Sequences: 3902068 Number of extensions: 724707 Number of successful extensions: 49562 Number of sequences better than 10.0: 102 Number of HSP's better than 10.0 without gapping: 104 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 49243 Number of HSP's gapped (non-prelim): 312 length of query: 155 length of database: 17,233,045,268 effective HSP length: 22 effective length of query: 133 effective length of database: 17,147,199,772 effective search space: 2280577569676 effective search space used: 2280577569676 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 19 (38.2 bits)
