ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日：2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd25j21
Clone Library Name barley_pub
No. Definition Score
(bits)		 E
Value
1gb|AC134053.4| Oryza sativa (japonica cultivar-group) chromosome... 167 4e-38
2dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic D... 167 4e-38
3dbj|AK100677.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 4e-38
4dbj|AK065369.1| Oryza sativa (japonica cultivar-group) cDNA clon... 167 4e-38
5gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome... 167 4e-38
6ref|NM_122248.2| Arabidopsis thaliana unknown protein AT5G23410 ... 92 2e-15
7dbj|AB018110.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 92 2e-15
8dbj|AB007647.1| Arabidopsis thaliana genomic DNA, chromosome 5, ... 84 4e-13
9dbj|AK117315.1| Arabidopsis thaliana mRNA for unknown protein, c... 84 4e-13
10ref|NM_105475.3| Arabidopsis thaliana FKF1 (FLAVIN-BINDING KELCH... 76 1e-10
11gb|AY113029.1| Arabidopsis thaliana At1g68050/T23K23_10 mRNA, co... 76 1e-10
12gb|AY064999.1| Arabidopsis thaliana At1g68050/T23K23_10 mRNA, co... 76 1e-10
13gb|AC012563.7|AC012563 Arabidopsis thaliana chromosome 1 BAC T23... 76 1e-10
14emb|BX815970.1|CNS0AEMF Arabidopsis thaliana Full-length cDNA Co... 76 1e-10
15gb|AF252296.1|AF252296 Arabidopsis thaliana Adagio 3 (ADO3) mRNA... 68 2e-08
16gb|AF216523.2|AF216523 Arabidopsis thaliana FKF1 mRNA, complete cds 68 2e-08
17gb|AY371291.1| Mesembryanthemum crystallinum FKF1 (FKF1) mRNA, c... 54 4e-04
18dbj|AP004911.1| Lotus japonicus genomic DNA, chromosome 4, clone... 50 0.006
19gb|AC132575.3| Mus musculus BAC clone RP24-425F2 from chromosome... 42 1.4
20gb|AC007922.13| Homo sapiens chromosome 18, clone RP11-178F10, c... 42 1.4
21gb|AC087799.43| Mus musculus strain C57BL/6J chromosome 16 clone... 42 1.4
22gb|AC090244.17| Homo sapiens chromosome 18, clone RP11-758N17, c... 42 1.4
23emb|AJ538745.1|NTA538745 Nicotiana tabacum cDNA-AFLP-fragment BC... 42 1.4
24gb|CP000080.1| Leishmania major strain Friedlin chromosome 29, c... 40 5.6
25ref|XM_842586.1| Leishmania major strain Friedlin hypothetical p... 40 5.6
26gb|AC112998.15| Mus musculus chromosome 3, clone RP23-147E7, com... 40 5.6
27emb|CR956410.6| Pig DNA sequence from clone PigE-123H20 on chrom... 40 5.6
28emb|AL512599.33| Human DNA sequence from clone RP11-115D7 on chr... 40 5.6
29emb|AL359676.19| Human DNA sequence from clone RP11-735G4 on chr... 40 5.6
30emb|BX021609.1|CNS08OU5 Single read from an extremity of a full-... 40 5.6
31gb|AC106881.9| Homo sapiens BAC clone RP11-710C12 from 4, comple... 40 5.6
32gb|AC027342.5| Homo sapiens chromosome 5 clone CTD-2294O13, comp... 40 5.6
33ref|XM_318537.2| Anopheles gambiae str. PEST ENSANGP00000019642 ... 40 5.6
34emb|AL355835.3|CNS05TCP Human chromosome 14 DNA sequence BAC R-1... 40 5.6
35emb|AL161751.3|CNS01RHG Human chromosome 14 DNA sequence BAC R-9... 40 5.6
36gb|AC142228.4| Mus musculus BAC clone RP23-427M10 from 3, comple... 40 5.6 
>gb|AC134053.4| Oryza sativa (japonica cultivar-group) chromosome 11 clone
             OSJNBb0005H02, complete sequence
          Length = 144882

 Score =  167 bits (84), Expect = 4e-38
 Identities = 210/252 (83%)
 Strand = Plus / Plus

                                                                         
Query: 163   catcttcgtcgggcctgcttgcgaggcagagctcgtggagctcattcaggatccactcct 222
             ||||||||||||||||||| |||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 53167 catcttcgtcgggcctgctcgcgaggcacagctcatggagctcattgagaatccactcct 53226

                                                                         
Query: 223   ctccgctgtgtccaccaagaaccaagaccctagtgccaccaaccacgcaggtgctgtgtc 282
             | ||  |||| ||||| || || |  ||||| ||||| ||||||||||| ||||| || |
Sbjct: 53227 ccccagtgtggccacccaggacaagaaccctggtgccgccaaccacgcatgtgctatgac 53286

                                                                         
Query: 283   cccaagcgaacttgggtggctgccccgggacgttcaggattctccatgtcggtttttcct 342
             |||| ||||||||||||||||| || ||||||||||  || ||||||||||| || ||||
Sbjct: 53287 cccaggcgaacttgggtggctggccagggacgttcaaaatcctccatgtcggcttctcct 53346

                                                                         
Query: 343   cagccggatcaagcaagaagagctcagcgggtgagtgcagcccagcgattgagccgccaa 402
             | || || || || | ||| ||||  | ||| ||||||||||||||||| ||||| || |
Sbjct: 53347 ccgctgggtcgaggaggaacagctgtgagggcgagtgcagcccagcgatggagccaccga 53406

                         
Query: 403   atatgatgatcc 414
             ||||||| ||||
Sbjct: 53407 atatgattatcc 53418
to top
>dbj|AP008217.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 11, complete
                sequence
          Length = 28386948

 Score =  167 bits (84), Expect = 4e-38
 Identities = 210/252 (83%)
 Strand = Plus / Plus

                                                                            
Query: 163      catcttcgtcgggcctgcttgcgaggcagagctcgtggagctcattcaggatccactcct 222
                ||||||||||||||||||| |||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 19478890 catcttcgtcgggcctgctcgcgaggcacagctcatggagctcattgagaatccactcct 19478949

                                                                            
Query: 223      ctccgctgtgtccaccaagaaccaagaccctagtgccaccaaccacgcaggtgctgtgtc 282
                | ||  |||| ||||| || || |  ||||| ||||| ||||||||||| ||||| || |
Sbjct: 19478950 ccccagtgtggccacccaggacaagaaccctggtgccgccaaccacgcatgtgctatgac 19479009

                                                                            
Query: 283      cccaagcgaacttgggtggctgccccgggacgttcaggattctccatgtcggtttttcct 342
                |||| ||||||||||||||||| || ||||||||||  || ||||||||||| || ||||
Sbjct: 19479010 cccaggcgaacttgggtggctggccagggacgttcaaaatcctccatgtcggcttctcct 19479069

                                                                            
Query: 343      cagccggatcaagcaagaagagctcagcgggtgagtgcagcccagcgattgagccgccaa 402
                | || || || || | ||| ||||  | ||| ||||||||||||||||| ||||| || |
Sbjct: 19479070 ccgctgggtcgaggaggaacagctgtgagggcgagtgcagcccagcgatggagccaccga 19479129

                            
Query: 403      atatgatgatcc 414
                ||||||| ||||
Sbjct: 19479130 atatgattatcc 19479141
to top
>dbj|AK100677.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023113D18, full
            insert sequence
          Length = 2190

 Score =  167 bits (84), Expect = 4e-38
 Identities = 210/252 (83%)
 Strand = Plus / Minus

                                                                        
Query: 163  catcttcgtcgggcctgcttgcgaggcagagctcgtggagctcattcaggatccactcct 222
            ||||||||||||||||||| |||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 1982 catcttcgtcgggcctgctcgcgaggcacagctcatggagctcattgagaatccactcct 1923

                                                                        
Query: 223  ctccgctgtgtccaccaagaaccaagaccctagtgccaccaaccacgcaggtgctgtgtc 282
            | ||  |||| ||||| || || |  ||||| ||||| ||||||||||| ||||| || |
Sbjct: 1922 ccccagtgtggccacccaggacaagaaccctggtgccgccaaccacgcatgtgctatgac 1863

                                                                        
Query: 283  cccaagcgaacttgggtggctgccccgggacgttcaggattctccatgtcggtttttcct 342
            |||| ||||||||||||||||| || ||||||||||  || ||||||||||| || ||||
Sbjct: 1862 cccaggcgaacttgggtggctggccagggacgttcaaaatcctccatgtcggcttctcct 1803

                                                                        
Query: 343  cagccggatcaagcaagaagagctcagcgggtgagtgcagcccagcgattgagccgccaa 402
            | || || || || | ||| ||||  | ||| ||||||||||||||||| ||||| || |
Sbjct: 1802 ccgctgggtcgaggaggaacagctgtgagggcgagtgcagcccagcgatggagccaccga 1743

                        
Query: 403  atatgatgatcc 414
            ||||||| ||||
Sbjct: 1742 atatgattatcc 1731
to top
>dbj|AK065369.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013023A04, full
            insert sequence
          Length = 3839

 Score =  167 bits (84), Expect = 4e-38
 Identities = 210/252 (83%)
 Strand = Plus / Minus

                                                                        
Query: 163  catcttcgtcgggcctgcttgcgaggcagagctcgtggagctcattcaggatccactcct 222
            ||||||||||||||||||| |||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 3620 catcttcgtcgggcctgctcgcgaggcacagctcatggagctcattgagaatccactcct 3561

                                                                        
Query: 223  ctccgctgtgtccaccaagaaccaagaccctagtgccaccaaccacgcaggtgctgtgtc 282
            | ||  |||| ||||| || || |  ||||| ||||| ||||||||||| ||||| || |
Sbjct: 3560 ccccagtgtggccacccaggacaagaaccctggtgccgccaaccacgcatgtgctatgac 3501

                                                                        
Query: 283  cccaagcgaacttgggtggctgccccgggacgttcaggattctccatgtcggtttttcct 342
            |||| ||||||||||||||||| || ||||||||||  || ||||||||||| || ||||
Sbjct: 3500 cccaggcgaacttgggtggctggccagggacgttcaaaatcctccatgtcggcttctcct 3441

                                                                        
Query: 343  cagccggatcaagcaagaagagctcagcgggtgagtgcagcccagcgattgagccgccaa 402
            | || || || || | ||| ||||  | ||| ||||||||||||||||| ||||| || |
Sbjct: 3440 ccgctgggtcgaggaggaacagctgtgagggcgagtgcagcccagcgatggagccaccga 3381

                        
Query: 403  atatgatgatcc 414
            ||||||| ||||
Sbjct: 3380 atatgattatcc 3369
to top
>gb|DP000010.1| Oryza sativa (japonica cultivar-group) chromosome 11, complete sequence
          Length = 28369397

 Score =  167 bits (84), Expect = 4e-38
 Identities = 210/252 (83%)
 Strand = Plus / Plus

                                                                            
Query: 163      catcttcgtcgggcctgcttgcgaggcagagctcgtggagctcattcaggatccactcct 222
                ||||||||||||||||||| |||||||| ||||| ||||||||||| || ||||||||||
Sbjct: 19638064 catcttcgtcgggcctgctcgcgaggcacagctcatggagctcattgagaatccactcct 19638123

                                                                            
Query: 223      ctccgctgtgtccaccaagaaccaagaccctagtgccaccaaccacgcaggtgctgtgtc 282
                | ||  |||| ||||| || || |  ||||| ||||| ||||||||||| ||||| || |
Sbjct: 19638124 ccccagtgtggccacccaggacaagaaccctggtgccgccaaccacgcatgtgctatgac 19638183

                                                                            
Query: 283      cccaagcgaacttgggtggctgccccgggacgttcaggattctccatgtcggtttttcct 342
                |||| ||||||||||||||||| || ||||||||||  || ||||||||||| || ||||
Sbjct: 19638184 cccaggcgaacttgggtggctggccagggacgttcaaaatcctccatgtcggcttctcct 19638243

                                                                            
Query: 343      cagccggatcaagcaagaagagctcagcgggtgagtgcagcccagcgattgagccgccaa 402
                | || || || || | ||| ||||  | ||| ||||||||||||||||| ||||| || |
Sbjct: 19638244 ccgctgggtcgaggaggaacagctgtgagggcgagtgcagcccagcgatggagccaccga 19638303

                            
Query: 403      atatgatgatcc 414
                ||||||| ||||
Sbjct: 19638304 atatgattatcc 19638315
to top
>ref|NM_122248.2| Arabidopsis thaliana unknown protein AT5G23410 mRNA, complete cds
          Length = 458

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 112/134 (83%)
 Strand = Plus / Minus

                                                                       
Query: 204 tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 263
           ||||| || ||||| ||||| ||  |||| |||||||| ||||| || ||||| || |||
Sbjct: 209 tcattgagtatccattcctcaccattgtgaccaccaaggaccaatactctagttcctcca 150

                                                                       
Query: 264 accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 323
           || ||||| ||||| ||||||||||| ||||||||||| | ||| ||||| |||||||| 
Sbjct: 149 acaacgcatgtgctatgtccccaagctaacttgggtggtttccctgggacattcaggatc 90

                         
Query: 324 ctccatgtcggttt 337
           ||||||| ||||||
Sbjct: 89  ctccatgacggttt 76
to top
>dbj|AB018110.1| Arabidopsis thaliana genomic DNA, chromosome 5, TAC clone:K19M13
          Length = 42563

 Score = 91.7 bits (46), Expect = 2e-15
 Identities = 112/134 (83%)
 Strand = Plus / Plus

                                                                        
Query: 204  tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 263
            ||||| || ||||| ||||| ||  |||| |||||||| ||||| || ||||| || |||
Sbjct: 7454 tcattgagtatccattcctcaccattgtgaccaccaaggaccaatactctagttcctcca 7513

                                                                        
Query: 264  accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 323
            || ||||| ||||| ||||||||||| ||||||||||| | ||| ||||| |||||||| 
Sbjct: 7514 acaacgcatgtgctatgtccccaagctaacttgggtggtttccctgggacattcaggatc 7573

                          
Query: 324  ctccatgtcggttt 337
            ||||||| ||||||
Sbjct: 7574 ctccatgacggttt 7587
to top
>dbj|AB007647.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MJB21
          Length = 78369

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                         
Query: 204   tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 263
             ||||| || ||||| ||||| ||  |||| |||||||| ||||| || ||||| || |||
Sbjct: 41321 tcattgagtatccattcctcaccattgtgaccaccaaggaccaatactctagttcctcca 41262

                                                                         
Query: 264   accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 323
             || ||||| ||||| ||||||||||| ||||||||||| | ||| ||||| || ||||| 
Sbjct: 41261 acaacgcatgtgctatgtccccaagctaacttgggtggtttccctgggacatttaggatc 41202

                           
Query: 324   ctccatgtcggttt 337
             ||||||| ||||||
Sbjct: 41201 ctccatgacggttt 41188
to top
>dbj|AK117315.1| Arabidopsis thaliana mRNA for unknown protein, complete cds, clone:
           RAFL16-88-C20
          Length = 897

 Score = 83.8 bits (42), Expect = 4e-13
 Identities = 111/134 (82%)
 Strand = Plus / Minus

                                                                       
Query: 204 tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 263
           ||||| || ||||| ||||| ||  |||| |||||||| ||||| || ||||| || |||
Sbjct: 710 tcattgagtatccattcctcaccattgtgaccaccaaggaccaatactctagttcctcca 651

                                                                       
Query: 264 accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 323
           || ||||| ||||| ||||||||||| ||||||||||| | ||| ||||| || ||||| 
Sbjct: 650 acaacgcatgtgctatgtccccaagctaacttgggtggtttccctgggacatttaggatc 591

                         
Query: 324 ctccatgtcggttt 337
           ||||||| ||||||
Sbjct: 590 ctccatgacggttt 577
to top
>ref|NM_105475.3| Arabidopsis thaliana FKF1 (FLAVIN-BINDING KELCH DOMAIN F BOX
            PROTEIN); signal transducer/ ubiquitin-protein ligase
            AT1G68050 (FKF1) mRNA, complete cds
          Length = 2113

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                        
Query: 204  tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 263
            ||||| || ||||| ||||| ||  |||| |||||||| ||||| || ||||| || |||
Sbjct: 1875 tcattgagtatccattcctcaccagtgtgaccaccaaggaccaatactctagttcctcca 1816

                                                                        
Query: 264  accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 323
            || ||||| ||||| ||||||||||| ||||| || || | ||| ||||| |||||||| 
Sbjct: 1815 acaacgcatgtgctatgtccccaagctaacttaggcggtttcccggggacattcaggatc 1756

                          
Query: 324  ctccatgtcggttt 337
            ||||||| ||||||
Sbjct: 1755 ctccatgacggttt 1742
to top
>gb|AY113029.1| Arabidopsis thaliana At1g68050/T23K23_10 mRNA, complete cds
          Length = 1860

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                        
Query: 204  tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 263
            ||||| || ||||| ||||| ||  |||| |||||||| ||||| || ||||| || |||
Sbjct: 1814 tcattgagtatccattcctcaccagtgtgaccaccaaggaccaatactctagttcctcca 1755

                                                                        
Query: 264  accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 323
            || ||||| ||||| ||||||||||| ||||| || || | ||| ||||| |||||||| 
Sbjct: 1754 acaacgcatgtgctatgtccccaagctaacttaggcggtttcccggggacattcaggatc 1695

                          
Query: 324  ctccatgtcggttt 337
            ||||||| ||||||
Sbjct: 1694 ctccatgacggttt 1681
to top
>gb|AY064999.1| Arabidopsis thaliana At1g68050/T23K23_10 mRNA, complete cds
          Length = 2105

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                        
Query: 204  tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 263
            ||||| || ||||| ||||| ||  |||| |||||||| ||||| || ||||| || |||
Sbjct: 1876 tcattgagtatccattcctcaccagtgtgaccaccaaggaccaatactctagttcctcca 1817

                                                                        
Query: 264  accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 323
            || ||||| ||||| ||||||||||| ||||| || || | ||| ||||| |||||||| 
Sbjct: 1816 acaacgcatgtgctatgtccccaagctaacttaggcggtttcccggggacattcaggatc 1757

                          
Query: 324  ctccatgtcggttt 337
            ||||||| ||||||
Sbjct: 1756 ctccatgacggttt 1743
to top
>gb|AC012563.7|AC012563 Arabidopsis thaliana chromosome 1 BAC T23K23 genomic sequence, complete
             sequence
          Length = 101966

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 110/134 (82%)
 Strand = Plus / Plus

                                                                         
Query: 204   tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 263
             ||||| || ||||| ||||| ||  |||| |||||||| ||||| || ||||| || |||
Sbjct: 33739 tcattgagtatccattcctcaccagtgtgaccaccaaggaccaatactctagttcctcca 33798

                                                                         
Query: 264   accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 323
             || ||||| ||||| ||||||||||| ||||| || || | ||| ||||| |||||||| 
Sbjct: 33799 acaacgcatgtgctatgtccccaagctaacttaggcggtttcccggggacattcaggatc 33858

                           
Query: 324   ctccatgtcggttt 337
             ||||||| ||||||
Sbjct: 33859 ctccatgacggttt 33872
to top
>emb|BX815970.1|CNS0AEMF Arabidopsis thaliana Full-length cDNA Complete sequence from clone
            GSLTPGH1ZH06 of Hormone Treated Callus of strain col-0 of
            Arabidopsis thaliana (thale cress)
          Length = 2071

 Score = 75.8 bits (38), Expect = 1e-10
 Identities = 110/134 (82%)
 Strand = Plus / Minus

                                                                        
Query: 204  tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 263
            ||||| || ||||| ||||| ||  |||| |||||||| ||||| || ||||| || |||
Sbjct: 1839 tcattgagtatccattcctcaccagtgtgaccaccaaggaccaatactctagttcctcca 1780

                                                                        
Query: 264  accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 323
            || ||||| ||||| ||||||||||| ||||| || || | ||| ||||| |||||||| 
Sbjct: 1779 acaacgcatgtgctatgtccccaagctaacttaggcggtttcccggggacattcaggatc 1720

                          
Query: 324  ctccatgtcggttt 337
            ||||||| ||||||
Sbjct: 1719 ctccatgacggttt 1706
to top
>gb|AF252296.1|AF252296 Arabidopsis thaliana Adagio 3 (ADO3) mRNA, complete cds
          Length = 2066

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 109/134 (81%)
 Strand = Plus / Minus

                                                                        
Query: 204  tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 263
            ||||| || ||||| ||||| ||  |||| |||||||| ||||| || ||||| || |||
Sbjct: 1839 tcattgagtatccattcctcaccagtgtgaccaccaaggaccaatactctagttcctcca 1780

                                                                        
Query: 264  accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 323
            || ||||| ||| | ||||||||||| ||||| || || | ||| ||||| |||||||| 
Sbjct: 1779 acaacgcatgtgttatgtccccaagctaacttaggcggtttcccggggacattcaggatc 1720

                          
Query: 324  ctccatgtcggttt 337
            ||||||| ||||||
Sbjct: 1719 ctccatgacggttt 1706
to top
>gb|AF216523.2|AF216523 Arabidopsis thaliana FKF1 mRNA, complete cds
          Length = 2066

 Score = 67.9 bits (34), Expect = 2e-08
 Identities = 109/134 (81%)
 Strand = Plus / Minus

                                                                        
Query: 204  tcattcaggatccactcctctccgctgtgtccaccaagaaccaagaccctagtgccacca 263
            ||||| || ||||| ||||| ||  |||| |||||||| ||||| || ||||| || |||
Sbjct: 1839 tcattgagtatccattcctcaccagtgtgaccaccaaggaccaatactctagttcctcca 1780

                                                                        
Query: 264  accacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttcaggatt 323
            || ||||| ||| | ||||||||||| ||||| || || | ||| ||||| |||||||| 
Sbjct: 1779 acaacgcatgtgttatgtccccaagctaacttaggcggtttcccggggacattcaggatc 1720

                          
Query: 324  ctccatgtcggttt 337
            ||||||| ||||||
Sbjct: 1719 ctccatgacggttt 1706
to top
>gb|AY371291.1| Mesembryanthemum crystallinum FKF1 (FKF1) mRNA, complete cds
          Length = 2189

 Score = 54.0 bits (27), Expect = 4e-04
 Identities = 78/95 (82%)
 Strand = Plus / Minus

                                                                        
Query: 258  ccaccaaccacgcaggtgctgtgtccccaagcgaacttgggtggctgccccgggacgttc 317
            |||||||||||||| || ||||| ||||| || ||||| |||||||| || || ||||| 
Sbjct: 1883 ccaccaaccacgcacgtactgtggccccacgcaaacttaggtggctgaccgggaacgtta 1824

                                               
Query: 318  aggattctccatgtcggtttttcctcagccggatc 352
            | ||| ||||| | |||||| ||||| | ||||||
Sbjct: 1823 atgatcctccaagacggtttctcctctgacggatc 1789
to top
>dbj|AP004911.1| Lotus japonicus genomic DNA, chromosome 4, clone:LjT13O11, TM0069,
             complete sequence
          Length = 103659

 Score = 50.1 bits (25), Expect = 0.006
 Identities = 136/173 (78%)
 Strand = Plus / Minus

                                                                         
Query: 243   accaagaccctagtgccaccaaccacgcaggtgctgtgtccccaagcgaacttgggtggc 302
             ||||| |||||||| || |||||||| || ||||| || |||||||| ||||| || || 
Sbjct: 54961 accaacaccctagtccctccaaccacacaagtgctatgaccccaagcaaacttaggaggt 54902

                                                                         
Query: 303   tgccccgggacgttcaggattctccatgtcggtttttcctcagccggatcaagcaagaag 362
             ||||| || || || ||||| |||||||  ||||| || ||||  || || | ||  || 
Sbjct: 54901 tgccctggaacattgaggatcctccatgatggtttctcttcagaagggtccaacagaaac 54842

                                                                  
Query: 363   agctcagcgggtgagtgcagcccagcgattgagccgccaaatatgatgatcct 415
             |||| ||  |||||||| || ||||| || || || |||||||||||||||||
Sbjct: 54841 agctgagatggtgagtgaagaccagcaatggaccctccaaatatgatgatcct 54789
to top
>gb|AC132575.3| Mus musculus BAC clone RP24-425F2 from chromosome 16, complete sequence
          Length = 139828

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 17    gaacaacaaggtatactaaaa 37
             |||||||||||||||||||||
Sbjct: 98976 gaacaacaaggtatactaaaa 98996
to top
>gb|AC007922.13| Homo sapiens chromosome 18, clone RP11-178F10, complete sequence
          Length = 140555

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 92    ctgagagggagatgaaatgaa 112
             |||||||||||||||||||||
Sbjct: 15955 ctgagagggagatgaaatgaa 15935
to top
>gb|AC087799.43| Mus musculus strain C57BL/6J chromosome 16 clone rp23-198m10, complete
              sequence
          Length = 208011

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 17     gaacaacaaggtatactaaaa 37
              |||||||||||||||||||||
Sbjct: 198754 gaacaacaaggtatactaaaa 198734
to top
>gb|AC090244.17| Homo sapiens chromosome 18, clone RP11-758N17, complete sequence
          Length = 169144

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 92    ctgagagggagatgaaatgaa 112
             |||||||||||||||||||||
Sbjct: 94193 ctgagagggagatgaaatgaa 94173
to top
>emb|AJ538745.1|NTA538745 Nicotiana tabacum cDNA-AFLP-fragment BC4-M44-043
          Length = 183

 Score = 42.1 bits (21), Expect = 1.4
 Identities = 45/53 (84%)
 Strand = Plus / Minus

                                                                
Query: 243 accaagaccctagtgccaccaaccacgcaggtgctgtgtccccaagcgaactt 295
           ||||||||||| || || |||||||| || ||||| || |||||||| |||||
Sbjct: 86  accaagacccttgttcctccaaccacacatgtgctatgaccccaagcaaactt 34
to top
>gb|CP000080.1| Leishmania major strain Friedlin chromosome 29, complete sequence
          Length = 1212674

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 182   tgcgaggcagagctcgtgga 201
             ||||||||||||||||||||
Sbjct: 68992 tgcgaggcagagctcgtgga 68973
to top
>ref|XM_842586.1| Leishmania major strain Friedlin hypothetical protein (LMJ_0656)
            partial mRNA
          Length = 4731

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                
Query: 182  tgcgaggcagagctcgtgga 201
            ||||||||||||||||||||
Sbjct: 2353 tgcgaggcagagctcgtgga 2372
to top
>gb|AC112998.15| Mus musculus chromosome 3, clone RP23-147E7, complete sequence
          Length = 203273

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 84     aagaaaagctgagagggaga 103
              ||||||||||||||||||||
Sbjct: 180770 aagaaaagctgagagggaga 180751
to top
>emb|CR956410.6| Pig DNA sequence from clone PigE-123H20 on chromosome 7, complete
             sequence
          Length = 175487

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 363   agctcagcgggtgagtgcag 382
             ||||||||||||||||||||
Sbjct: 32953 agctcagcgggtgagtgcag 32972
to top
>emb|AL512599.33| Human DNA sequence from clone RP11-115D7 on chromosome 1 Contains the
              CAP1 gene for CAP, adenylate cyclase-associated protein 1
              (yeast), the PPT1 gene for palmitoyl-protein thioesterase 1
              (ceroid-lipofuscinosis, neuronal 1, infantile), an
              ornithine decarboxylase antizyme 1 (OAZ1) pseudogene, the
              5' end of the RLF gene for rearranged L-myc fusion sequence
              and a CpG island, complete sequence
          Length = 157750

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 89     aagctgagagggagatgaaatgaa 112
              |||||||||| |||||||||||||
Sbjct: 145970 aagctgagagtgagatgaaatgaa 145947
to top
>emb|AL359676.19| Human DNA sequence from clone RP11-735G4 on chromosome 6 Contains part
             of a novel gene, complete sequence
          Length = 40599

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 101   agatgaaatgaaggtaaggt 120
             ||||||||||||||||||||
Sbjct: 14438 agatgaaatgaaggtaaggt 14457
to top
>emb|BX021609.1|CNS08OU5 Single read from an extremity of a full-length cDNA clone made from
           Anopheles gambiae total adult females. 5-PRIME end of
           clone FK0AAA32AB12 of strain 6-9 of Anopheles gambiae
           (African malaria mosquito)
          Length = 754

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 379 gcagcccagcgattgagccg 398
           ||||||||||||||||||||
Sbjct: 432 gcagcccagcgattgagccg 413
to top
>gb|AC106881.9| Homo sapiens BAC clone RP11-710C12 from 4, complete sequence
          Length = 150889

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 327   catgtcggtttttcctcagc 346
             ||||||||||||||||||||
Sbjct: 85185 catgtcggtttttcctcagc 85204
to top
>gb|AC027342.5| Homo sapiens chromosome 5 clone CTD-2294O13, complete sequence
          Length = 112904

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 80    ttgtaagaaaagctgagagg 99
             ||||||||||||||||||||
Sbjct: 46384 ttgtaagaaaagctgagagg 46403
to top
>ref|XM_318537.2| Anopheles gambiae str. PEST ENSANGP00000019642 (ENSANGG00000017153),
            partial mRNA
          Length = 1578

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 379  gcagcccagcgattgagccg 398
            ||||||||||||||||||||
Sbjct: 1123 gcagcccagcgattgagccg 1104
to top
>emb|AL355835.3|CNS05TCP Human chromosome 14 DNA sequence BAC R-196N22 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 172374

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 63     ttcttttgcactcatttttgtaag 86
              ||||||| ||||||||||||||||
Sbjct: 115713 ttcttttccactcatttttgtaag 115736
to top
>emb|AL161751.3|CNS01RHG Human chromosome 14 DNA sequence BAC R-96D24 of library RPCI-11 from
              chromosome 14 of Homo sapiens (Human), complete sequence
          Length = 184692

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 63     ttcttttgcactcatttttgtaag 86
              ||||||| ||||||||||||||||
Sbjct: 151873 ttcttttccactcatttttgtaag 151896
to top
>gb|AC142228.4| Mus musculus BAC clone RP23-427M10 from 3, complete sequence
          Length = 171554

 Score = 40.1 bits (20), Expect = 5.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 84     aagaaaagctgagagggaga 103
              ||||||||||||||||||||
Sbjct: 169538 aagaaaagctgagagggaga 169557


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,377,465
Number of Sequences: 3902068
Number of extensions: 3377465
Number of successful extensions: 59669
Number of sequences better than 10.0: 36
Number of HSP's better than 10.0 without gapping: 36
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 59585
Number of HSP's gapped (non-prelim): 79
length of query: 415
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 393
effective length of database: 17,147,199,772
effective search space: 6738849510396
effective search space used: 6738849510396
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top