>ref|XM_627368.1| Cryptosporidium parvum Iowa II hypothetical protein (cgd8_4840),
            partial mRNA
          Length = 7230

 Score = 48.1 bits (24), Expect = 0.022
 Identities = 24/24 (100%)
 Strand = Plus / Minus

                                    
Query: 132  gaagttgaagttgtagctgttgat 155
            ||||||||||||||||||||||||
Sbjct: 6802 gaagttgaagttgtagctgttgat 6779

>emb|CR683301.2|CNS0FQ6P Tetraodon nigroviridis full-length cDNA
          Length = 815

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 323 tcaccttcttctccatggtct 343
           |||||||||||||||||||||
Sbjct: 160 tcaccttcttctccatggtct 140

>ref|XM_660787.1| Cryptosporidium hominis TU502 Myb-like DNA-binding domain
            (Chro.80556) partial mRNA
          Length = 5922

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                     
Query: 132  gaagttgaagttgtagctgttgatg 156
            |||| ||||||||||||||||||||
Sbjct: 5524 gaagctgaagttgtagctgttgatg 5500

>emb|CR648095.2|CNS0EZ1H Tetraodon nigroviridis full-length cDNA
          Length = 1458

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 323 tcaccttcttctccatggtct 343
           |||||||||||||||||||||
Sbjct: 852 tcaccttcttctccatggtct 832

>emb|CR639300.2|CNS0ES96 Tetraodon nigroviridis full-length cDNA
          Length = 1478

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 323 tcaccttcttctccatggtct 343
           |||||||||||||||||||||
Sbjct: 861 tcaccttcttctccatggtct 841

>emb|CR962120.1|PTB065B04 Pan troglodytes chromosome X BAC PTB-065B04, complete sequence
          Length = 35005

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 57    attgatgataattaagataaa 77
             |||||||||||||||||||||
Sbjct: 24109 attgatgataattaagataaa 24129

>emb|AL589794.7| Human DNA sequence from clone RP11-564C4 on chromosome 10 Contains the
             3' end of the gene for apobec-1 complementation factor
             (ACF) (ASP), the gene for a novel protein similar to
             N-acylsphingosine amidohydrolase (non-lysosomal
             ceramidase) 2 (ASAH2), the cathepsin L-like 2 (CTSLL2)
             pseudogene, three novel pseudogenes (KIAA1553), a novel
             gene, a protein geranylgeranyltransferase type I beta
             subunit (PGGT1B) pseudogene and a CpG island, complete
             sequence
          Length = 178899

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 324   caccttcttctccatggtctg 344
             |||||||||||||||||||||
Sbjct: 47031 caccttcttctccatggtctg 47051

>gb|CP000083.1| Colwellia psychrerythraea 34H, complete genome
          Length = 5373180

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 60     gatgataattaagataaagcg 80
              |||||||||||||||||||||
Sbjct: 319934 gatgataattaagataaagcg 319914

>gb|AC023702.4| Drosophila melanogaster X BAC RP98-24L2 (Roswell Park Cancer Institute
              Drosophila BAC Library) complete sequence
          Length = 159970

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                       
Query: 126    agtgtcgaagttgaagttgtagctg 150
              ||||||||||||||||||| |||||
Sbjct: 118453 agtgtcgaagttgaagttgaagctg 118429

>gb|AC130390.4| Drosophila melanogaster X BAC RP98-21O19 (Roswell Park Cancer Institute
             Drosophila BAC Library) complete sequence
          Length = 184175

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 126   agtgtcgaagttgaagttgtagctg 150
             ||||||||||||||||||| |||||
Sbjct: 59958 agtgtcgaagttgaagttgaagctg 59934

>gb|AE003448.4| Drosophila melanogaster chromosome X, section 32 of 74 of the complete
             sequence
          Length = 318665

 Score = 42.1 bits (21), Expect = 1.3
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                      
Query: 126   agtgtcgaagttgaagttgtagctg 150
             ||||||||||||||||||| |||||
Sbjct: 86847 agtgtcgaagttgaagttgaagctg 86823

>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete
                sequence
          Length = 30731886

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                        
Query: 248      tgctcctggtcgcgatggccatga 271
                ||||||||| ||||||||||||||
Sbjct: 20701156 tgctcctggccgcgatggccatga 20701133

>ref|XM_218601.3| PREDICTED: Rattus norvegicus similar to hypothetical protein
           FLJ23311 (predicted) (LOC308607), mRNA
          Length = 3460

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 246 ggtgctcctggtcgcgatgg 265
           ||||||||||||||||||||
Sbjct: 264 ggtgctcctggtcgcgatgg 283

>dbj|AP003682.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC
              clone:P0427B07
          Length = 172058

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 248    tgctcctggtcgcgatggccatga 271
              ||||||||| ||||||||||||||
Sbjct: 123563 tgctcctggccgcgatggccatga 123540

>ref|XM_309208.2| Anopheles gambiae str. PEST ENSANGP00000005397 (ENSANGG00000004156),
            partial mRNA
          Length = 7809

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 140  agttgtagctgttgatgccg 159
            ||||||||||||||||||||
Sbjct: 2962 agttgtagctgttgatgccg 2943

>dbj|AK072932.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023144J15, full
           insert sequence
          Length = 842

 Score = 40.1 bits (20), Expect = 5.3
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                   
Query: 248 tgctcctggtcgcgatggccatga 271
           ||||||||| ||||||||||||||
Sbjct: 591 tgctcctggccgcgatggccatga 614


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 2,597,798
Number of Sequences: 3902068
Number of extensions: 2597798
Number of successful extensions: 48805
Number of sequences better than 10.0: 16
Number of HSP's better than 10.0 without gapping: 16
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 48762
Number of HSP's gapped (non-prelim): 43
length of query: 394
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 372
effective length of database: 17,147,199,772
effective search space: 6378758315184
effective search space used: 6378758315184
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)