Clone Information

BLAST Search Result

Clone Name	rbasd24o21
Clone Library Name	barley_pub

No.	Definition	Score (bits)	E Value
1	gb\|AF542969.2\| Triticum aestivum ribosomal protein L19 mRNA, com...	192	3e-46
2	gb\|AY389581.1\| Hyacinthus orientalis ribosomal protein L19 (RPL1...	98	1e-17
3	gb\|DP000009.1\| Oryza sativa (japonica cultivar-group) chromosome 3	98	1e-17
4	gb\|AC134885.1\| Genomic sequence for Oryza sativa, Nipponbare str...	98	1e-17
5	dbj\|AP008209.1\| Oryza sativa (japonica cultivar-group) genomic D...	98	1e-17
6	dbj\|AK102721.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	98	1e-17
7	dbj\|AK059309.1\| Oryza sativa (japonica cultivar-group) cDNA clon...	98	1e-17
8	gb\|AY103679.1\| Zea mays PCO152526 mRNA sequence	94	2e-16
9	gb\|BT019233.1\| Zea mays clone Contig906.F mRNA sequence	74	2e-10
10	gb\|BT016537.1\| Zea mays clone Contig370 mRNA sequence	74	2e-10
11	gb\|AY103638.1\| Zea mays PCO153348 mRNA sequence	74	2e-10
12	dbj\|D29721.1\|RICYK34 Oryza sativa mRNA, partial homologous to ri...	70	3e-09
13	gb\|BT016919.1\| Zea mays clone E04912701B11.c mRNA sequence	60	3e-06
14	gb\|AC147962.1\| Oryza sativa chromosome 3 BAC OSJNBa0083K01 genom...	60	3e-06
15	gb\|AC128645.5\| Oryza sativa chromosome 3 BAC OSJNBb0016P23 genom...	60	3e-06
16	gb\|AY104244.1\| Zea mays PCO075323 mRNA sequence	60	3e-06
17	gb\|BT016443.1\| Zea mays clone Contig276 mRNA sequence	54	2e-04
18	dbj\|AP008213.1\| Oryza sativa (japonica cultivar-group) genomic D...	54	2e-04
19	dbj\|AP004300.3\| Oryza sativa (japonica cultivar-group) genomic D...	54	2e-04
20	ref\|NM_112551.2\| Arabidopsis thaliana structural constituent of ...	52	7e-04
21	gb\|AY090335.1\| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, comp...	52	7e-04
22	gb\|AY045610.1\| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, comp...	52	7e-04
23	gb\|AY089073.1\| Arabidopsis thaliana clone 27978 mRNA, complete s...	52	7e-04
24	dbj\|AB022217.1\| Arabidopsis thaliana genomic DNA, chromosome 3, ...	52	7e-04
25	emb\|CR730601.2\|CNS0GQOE Tetraodon nigroviridis full-length cDNA	44	0.17
26	emb\|CR725565.1\|CNS0GMSJ Tetraodon nigroviridis full-length cDNA	44	0.17
27	emb\|CR701659.2\|CNS0G4CN Tetraodon nigroviridis full-length cDNA	44	0.17
28	emb\|CR670272.2\|CNS0FG5I Tetraodon nigroviridis full-length cDNA	44	0.17
29	emb\|CR666708.2\|CNS0FDEI Tetraodon nigroviridis full-length cDNA	44	0.17
30	emb\|CR666702.1\|CNS0FDEC Tetraodon nigroviridis full-length cDNA	44	0.17
31	emb\|CR665691.2\|CNS0FCM9 Tetraodon nigroviridis full-length cDNA	44	0.17
32	emb\|CR663076.2\|CNS0FALM Tetraodon nigroviridis full-length cDNA	44	0.17
33	ref\|XM_578500.1\| PREDICTED: Rattus norvegicus similar to novel p...	44	0.17
34	ref\|XM_757154.1\| Ustilago maydis 521 hypothetical protein (UM061...	42	0.67
35	emb\|CR674700.2\|CNS0FJKI Tetraodon nigroviridis full-length cDNA	42	0.67
36	emb\|AL646095.27\| Mouse DNA sequence from clone RP23-17P18 on chr...	42	0.67
37	gb\|AC064800.8\| Homo sapiens chromosome 18, clone CTD-2001I24, co...	42	0.67
38	dbj\|D21304.1\|RICSS504 Oryza sativa SS504 mRNA for ribosomal prot...	42	0.67
39	dbj\|AP006618.1\| Nocardia farcinica IFM 10152 DNA, complete genome	42	0.67
40	emb\|CT573326.1\| Pseudomonas entomophila str. L48 chromosome,comp...	42	0.67
41	ref\|XM_479458.1\| Oryza sativa (japonica cultivar-group), mRNA	40	2.6
42	ref\|XM_425588.1\| PREDICTED: Gallus gallus similar to insulin rec...	40	2.6
43	gb\|AC115037.16\| Mus musculus chromosome 12, clone RP24-276C17, c...	40	2.6
44	gb\|AC154422.2\| Mus musculus BAC clone RP24-218O2 from chromosome...	40	2.6
45	gb\|AC134439.4\| Mus musculus BAC clone RP24-494I18 from chromosom...	40	2.6
46	ref\|XM_534494.2\| PREDICTED: Canis familiaris similar to cyclin A...	40	2.6
47	emb\|CR734938.2\|CNS0GTUX Tetraodon nigroviridis full-length cDNA	40	2.6
48	emb\|CR734860.2\|CNS0GTSR Tetraodon nigroviridis full-length cDNA	40	2.6
49	emb\|CR734745.2\|CNS0GTPK Tetraodon nigroviridis full-length cDNA	40	2.6
50	emb\|CR734619.2\|CNS0GTM2 Tetraodon nigroviridis full-length cDNA	40	2.6
51	emb\|CR734317.2\|CNS0GTDO Tetraodon nigroviridis full-length cDNA	40	2.6
52	emb\|CR734201.2\|CNS0GTAG Tetraodon nigroviridis full-length cDNA	40	2.6
53	emb\|CR674675.2\|CNS0FJJT Tetraodon nigroviridis full-length cDNA	40	2.6
54	emb\|CR669989.2\|CNS0FFXN Tetraodon nigroviridis full-length cDNA	40	2.6
55	emb\|CR665304.2\|CNS0FCBI Tetraodon nigroviridis full-length cDNA	40	2.6
56	emb\|CR663336.2\|CNS0FASU Tetraodon nigroviridis full-length cDNA	40	2.6
57	emb\|CR679070.2\|CNS0FMX6 Tetraodon nigroviridis full-length cDNA	40	2.6
58	emb\|CR678868.2\|CNS0FMRK Tetraodon nigroviridis full-length cDNA	40	2.6
59	emb\|CR675606.2\|CNS0FK9O Tetraodon nigroviridis full-length cDNA	40	2.6
60	emb\|CR733921.2\|CNS0GT2O Tetraodon nigroviridis full-length cDNA	40	2.6
61	emb\|CR733890.2\|CNS0GT1T Tetraodon nigroviridis full-length cDNA	40	2.6
62	emb\|CR733527.2\|CNS0GSRQ Tetraodon nigroviridis full-length cDNA	40	2.6
63	emb\|CR733521.2\|CNS0GSRK Tetraodon nigroviridis full-length cDNA	40	2.6
64	emb\|CR733736.2\|CNS0GSXJ Tetraodon nigroviridis full-length cDNA	40	2.6
65	emb\|CR733705.2\|CNS0GSWO Tetraodon nigroviridis full-length cDNA	40	2.6
66	emb\|CR733407.2\|CNS0GSOO Tetraodon nigroviridis full-length cDNA	40	2.6
67	emb\|CR733171.2\|CNS0GSL0 Tetraodon nigroviridis full-length cDNA	40	2.6
68	emb\|CR733146.2\|CNS0GSKM Tetraodon nigroviridis full-length cDNA	40	2.6
69	emb\|CR732834.2\|CNS0GSDY Tetraodon nigroviridis full-length cDNA	40	2.6
70	emb\|CR732787.2\|CNS0GSCU Tetraodon nigroviridis full-length cDNA	40	2.6
71	emb\|CR733017.1\|CNS0GSI9 Tetraodon nigroviridis full-length cDNA	40	2.6
72	emb\|CR733000.1\|CNS0GSHV Tetraodon nigroviridis full-length cDNA	40	2.6
73	emb\|CR732678.2\|CNS0GSA2 Tetraodon nigroviridis full-length cDNA	40	2.6
74	emb\|CR732624.2\|CNS0GS8L Tetraodon nigroviridis full-length cDNA	40	2.6
75	emb\|CR732541.2\|CNS0GS6A Tetraodon nigroviridis full-length cDNA	40	2.6
76	emb\|CR732527.2\|CNS0GS5W Tetraodon nigroviridis full-length cDNA	40	2.6
77	emb\|CR732475.2\|CNS0GS4G Tetraodon nigroviridis full-length cDNA	40	2.6
78	emb\|CR732352.2\|CNS0GS11 Tetraodon nigroviridis full-length cDNA	40	2.6
79	emb\|CR732285.2\|CNS0GRZ6 Tetraodon nigroviridis full-length cDNA	40	2.6
80	emb\|CR732550.1\|CNS0GS6J Tetraodon nigroviridis full-length cDNA	40	2.6
81	emb\|CR732516.1\|CNS0GS5L Tetraodon nigroviridis full-length cDNA	40	2.6
82	emb\|CR732234.2\|CNS0GRXR Tetraodon nigroviridis full-length cDNA	40	2.6
83	emb\|CR732116.2\|CNS0GRUH Tetraodon nigroviridis full-length cDNA	40	2.6
84	emb\|CR732086.2\|CNS0GRTN Tetraodon nigroviridis full-length cDNA	40	2.6
85	emb\|CR732006.2\|CNS0GRRF Tetraodon nigroviridis full-length cDNA	40	2.6
86	emb\|CR731943.2\|CNS0GRPO Tetraodon nigroviridis full-length cDNA	40	2.6
87	emb\|CR731942.2\|CNS0GRPN Tetraodon nigroviridis full-length cDNA	40	2.6
88	emb\|CR731863.2\|CNS0GRNG Tetraodon nigroviridis full-length cDNA	40	2.6
89	emb\|CR731768.2\|CNS0GRKT Tetraodon nigroviridis full-length cDNA	40	2.6
90	emb\|CR731748.2\|CNS0GRK9 Tetraodon nigroviridis full-length cDNA	40	2.6
91	emb\|CR731913.1\|CNS0GROU Tetraodon nigroviridis full-length cDNA	40	2.6
92	emb\|CR731709.2\|CNS0GRJ6 Tetraodon nigroviridis full-length cDNA	40	2.6
93	emb\|CR731490.2\|CNS0GRD3 Tetraodon nigroviridis full-length cDNA	40	2.6
94	emb\|CR731489.2\|CNS0GRD2 Tetraodon nigroviridis full-length cDNA	40	2.6
95	emb\|CR731487.2\|CNS0GRD0 Tetraodon nigroviridis full-length cDNA	40	2.6
96	emb\|CR731350.2\|CNS0GR97 Tetraodon nigroviridis full-length cDNA	40	2.6
97	emb\|CR731274.2\|CNS0GR73 Tetraodon nigroviridis full-length cDNA	40	2.6
98	emb\|CR731259.2\|CNS0GR6O Tetraodon nigroviridis full-length cDNA	40	2.6
99	emb\|CR731697.1\|CNS0GRIU Tetraodon nigroviridis full-length cDNA	40	2.6
100	emb\|CR731209.2\|CNS0GR5A Tetraodon nigroviridis full-length cDNA	40	2.6
101	emb\|CR731161.2\|CNS0GR3Y Tetraodon nigroviridis full-length cDNA	40	2.6
102	emb\|CR731122.2\|CNS0GR2V Tetraodon nigroviridis full-length cDNA	40	2.6
103	emb\|CR731059.2\|CNS0GR14 Tetraodon nigroviridis full-length cDNA	40	2.6
104	emb\|CR730764.2\|CNS0GQSX Tetraodon nigroviridis full-length cDNA	40	2.6
105	emb\|CR730736.2\|CNS0GQS5 Tetraodon nigroviridis full-length cDNA	40	2.6
106	emb\|CR730730.2\|CNS0GQRZ Tetraodon nigroviridis full-length cDNA	40	2.6
107	emb\|CR730636.2\|CNS0GQPD Tetraodon nigroviridis full-length cDNA	40	2.6
108	emb\|CR730453.2\|CNS0GQKA Tetraodon nigroviridis full-length cDNA	40	2.6
109	emb\|CR730445.2\|CNS0GQK2 Tetraodon nigroviridis full-length cDNA	40	2.6
110	emb\|CR730400.2\|CNS0GQIT Tetraodon nigroviridis full-length cDNA	40	2.6
111	emb\|CR730359.2\|CNS0GQHO Tetraodon nigroviridis full-length cDNA	40	2.6
112	emb\|CR730352.2\|CNS0GQHH Tetraodon nigroviridis full-length cDNA	40	2.6
113	emb\|CR730543.1\|CNS0GQMS Tetraodon nigroviridis full-length cDNA	40	2.6
114	emb\|CR730350.1\|CNS0GQHF Tetraodon nigroviridis full-length cDNA	40	2.6
115	emb\|CR730237.1\|CNS0GQEB Tetraodon nigroviridis full-length cDNA	40	2.6
116	emb\|CR730101.2\|CNS0GQAJ Tetraodon nigroviridis full-length cDNA	40	2.6
117	emb\|CR730023.2\|CNS0GQ8D Tetraodon nigroviridis full-length cDNA	40	2.6
118	emb\|CR729895.2\|CNS0GQ4T Tetraodon nigroviridis full-length cDNA	40	2.6
119	emb\|CR729802.2\|CNS0GQ28 Tetraodon nigroviridis full-length cDNA	40	2.6
120	emb\|CR729759.2\|CNS0GQ11 Tetraodon nigroviridis full-length cDNA	40	2.6
121	emb\|CR730008.1\|CNS0GQ7Y Tetraodon nigroviridis full-length cDNA	40	2.6
122	emb\|CR729595.2\|CNS0GPWH Tetraodon nigroviridis full-length cDNA	40	2.6
123	emb\|CR729540.2\|CNS0GPUY Tetraodon nigroviridis full-length cDNA	40	2.6
124	emb\|CR729523.2\|CNS0GPUH Tetraodon nigroviridis full-length cDNA	40	2.6
125	emb\|CR729479.2\|CNS0GPT9 Tetraodon nigroviridis full-length cDNA	40	2.6
126	emb\|CR729476.2\|CNS0GPT6 Tetraodon nigroviridis full-length cDNA	40	2.6
127	emb\|CR729461.2\|CNS0GPSR Tetraodon nigroviridis full-length cDNA	40	2.6
128	emb\|CR729392.2\|CNS0GPQU Tetraodon nigroviridis full-length cDNA	40	2.6
129	emb\|CR729384.2\|CNS0GPQM Tetraodon nigroviridis full-length cDNA	40	2.6
130	emb\|CR729353.2\|CNS0GPPR Tetraodon nigroviridis full-length cDNA	40	2.6
131	emb\|CR729321.2\|CNS0GPOV Tetraodon nigroviridis full-length cDNA	40	2.6
132	emb\|CR729208.2\|CNS0GPLQ Tetraodon nigroviridis full-length cDNA	40	2.6
133	emb\|CR729126.2\|CNS0GPJG Tetraodon nigroviridis full-length cDNA	40	2.6
134	emb\|CR729048.2\|CNS0GPHA Tetraodon nigroviridis full-length cDNA	40	2.6
135	emb\|CR728810.2\|CNS0GPAO Tetraodon nigroviridis full-length cDNA	40	2.6
136	emb\|CR728802.2\|CNS0GPAG Tetraodon nigroviridis full-length cDNA	40	2.6
137	emb\|CR728751.2\|CNS0GP91 Tetraodon nigroviridis full-length cDNA	40	2.6
138	emb\|CR728744.2\|CNS0GP8U Tetraodon nigroviridis full-length cDNA	40	2.6
139	emb\|CR728704.2\|CNS0GP7Q Tetraodon nigroviridis full-length cDNA	40	2.6
140	emb\|CR728853.1\|CNS0GPBV Tetraodon nigroviridis full-length cDNA	40	2.6
141	emb\|CR728729.1\|CNS0GP8F Tetraodon nigroviridis full-length cDNA	40	2.6
142	emb\|CR728599.2\|CNS0GP4T Tetraodon nigroviridis full-length cDNA	40	2.6
143	emb\|CR728477.2\|CNS0GP1F Tetraodon nigroviridis full-length cDNA	40	2.6
144	emb\|CR728401.2\|CNS0GOZB Tetraodon nigroviridis full-length cDNA	40	2.6
145	emb\|CR728366.2\|CNS0GOYC Tetraodon nigroviridis full-length cDNA	40	2.6
146	emb\|CR728355.2\|CNS0GOY1 Tetraodon nigroviridis full-length cDNA	40	2.6
147	emb\|CR728273.2\|CNS0GOVR Tetraodon nigroviridis full-length cDNA	40	2.6
148	emb\|CR728246.2\|CNS0GOV0 Tetraodon nigroviridis full-length cDNA	40	2.6
149	emb\|CR728233.2\|CNS0GOUN Tetraodon nigroviridis full-length cDNA	40	2.6
150	emb\|CR728363.1\|CNS0GOY9 Tetraodon nigroviridis full-length cDNA	40	2.6
151	emb\|CR728131.2\|CNS0GORT Tetraodon nigroviridis full-length cDNA	40	2.6
152	emb\|CR728120.2\|CNS0GORI Tetraodon nigroviridis full-length cDNA	40	2.6
153	emb\|CR728090.2\|CNS0GOQO Tetraodon nigroviridis full-length cDNA	40	2.6
154	emb\|CR728077.2\|CNS0GOQB Tetraodon nigroviridis full-length cDNA	40	2.6
155	emb\|CR727845.2\|CNS0GOJV Tetraodon nigroviridis full-length cDNA	40	2.6
156	emb\|CR727809.2\|CNS0GOIV Tetraodon nigroviridis full-length cDNA	40	2.6
157	emb\|CR727774.2\|CNS0GOHW Tetraodon nigroviridis full-length cDNA	40	2.6
158	emb\|CR727770.2\|CNS0GOHS Tetraodon nigroviridis full-length cDNA	40	2.6
159	emb\|CR727768.2\|CNS0GOHQ Tetraodon nigroviridis full-length cDNA	40	2.6
160	emb\|CR727700.2\|CNS0GOFU Tetraodon nigroviridis full-length cDNA	40	2.6
161	emb\|CR727698.2\|CNS0GOFS Tetraodon nigroviridis full-length cDNA	40	2.6
162	emb\|CR727855.1\|CNS0GOK5 Tetraodon nigroviridis full-length cDNA	40	2.6
163	emb\|CR727511.2\|CNS0GOAL Tetraodon nigroviridis full-length cDNA	40	2.6
164	emb\|CR727452.2\|CNS0GO8Y Tetraodon nigroviridis full-length cDNA	40	2.6
165	emb\|CR727328.2\|CNS0GO5I Tetraodon nigroviridis full-length cDNA	40	2.6
166	emb\|CR727264.2\|CNS0GO3Q Tetraodon nigroviridis full-length cDNA	40	2.6
167	emb\|CR727230.2\|CNS0GO2S Tetraodon nigroviridis full-length cDNA	40	2.6
168	emb\|CR727197.2\|CNS0GO1V Tetraodon nigroviridis full-length cDNA	40	2.6
169	emb\|CR727468.1\|CNS0GO9E Tetraodon nigroviridis full-length cDNA	40	2.6
170	emb\|CR727082.2\|CNS0GNYO Tetraodon nigroviridis full-length cDNA	40	2.6
171	emb\|CR727060.2\|CNS0GNY2 Tetraodon nigroviridis full-length cDNA	40	2.6
172	emb\|CR726968.2\|CNS0GNVI Tetraodon nigroviridis full-length cDNA	40	2.6
173	emb\|CR726930.2\|CNS0GNUG Tetraodon nigroviridis full-length cDNA	40	2.6
174	emb\|CR726905.2\|CNS0GNTR Tetraodon nigroviridis full-length cDNA	40	2.6
175	emb\|CR726785.2\|CNS0GNQF Tetraodon nigroviridis full-length cDNA	40	2.6
176	emb\|CR726748.2\|CNS0GNPE Tetraodon nigroviridis full-length cDNA	40	2.6
177	emb\|CR726769.1\|CNS0GNPZ Tetraodon nigroviridis full-length cDNA	40	2.6
178	emb\|CR726597.2\|CNS0GNL7 Tetraodon nigroviridis full-length cDNA	40	2.6
179	emb\|CR726514.2\|CNS0GNIW Tetraodon nigroviridis full-length cDNA	40	2.6
180	emb\|CR726461.2\|CNS0GNHF Tetraodon nigroviridis full-length cDNA	40	2.6
181	emb\|CR726437.2\|CNS0GNGR Tetraodon nigroviridis full-length cDNA	40	2.6
182	emb\|CR726399.2\|CNS0GNFP Tetraodon nigroviridis full-length cDNA	40	2.6
183	emb\|CR726381.2\|CNS0GNF7 Tetraodon nigroviridis full-length cDNA	40	2.6
184	emb\|CR726309.2\|CNS0GND7 Tetraodon nigroviridis full-length cDNA	40	2.6
185	emb\|CR726206.2\|CNS0GNAC Tetraodon nigroviridis full-length cDNA	40	2.6
186	emb\|CR726196.2\|CNS0GNA2 Tetraodon nigroviridis full-length cDNA	40	2.6
187	emb\|CR726132.2\|CNS0GN8A Tetraodon nigroviridis full-length cDNA	40	2.6
188	emb\|CR726077.2\|CNS0GN6R Tetraodon nigroviridis full-length cDNA	40	2.6
189	emb\|CR725958.2\|CNS0GN3G Tetraodon nigroviridis full-length cDNA	40	2.6
190	emb\|CR725938.2\|CNS0GN2W Tetraodon nigroviridis full-length cDNA	40	2.6
191	emb\|CR725897.2\|CNS0GN1R Tetraodon nigroviridis full-length cDNA	40	2.6
192	emb\|CR725343.2\|CNS0GMMD Tetraodon nigroviridis full-length cDNA	40	2.6
193	emb\|CR725771.2\|CNS0GMY9 Tetraodon nigroviridis full-length cDNA	40	2.6
194	emb\|CR725738.2\|CNS0GMXC Tetraodon nigroviridis full-length cDNA	40	2.6
195	emb\|CR725654.2\|CNS0GMV0 Tetraodon nigroviridis full-length cDNA	40	2.6
196	emb\|CR725159.2\|CNS0GMH9 Tetraodon nigroviridis full-length cDNA	40	2.6
197	emb\|CR725155.2\|CNS0GMH5 Tetraodon nigroviridis full-length cDNA	40	2.6
198	emb\|CR725112.2\|CNS0GMFY Tetraodon nigroviridis full-length cDNA	40	2.6
199	emb\|CR725078.2\|CNS0GMF0 Tetraodon nigroviridis full-length cDNA	40	2.6
200	emb\|CR725138.1\|CNS0GMGO Tetraodon nigroviridis full-length cDNA	40	2.6
201	emb\|CR725006.2\|CNS0GMD0 Tetraodon nigroviridis full-length cDNA	40	2.6
202	emb\|CR724070.2\|CNS0GLN0 Tetraodon nigroviridis full-length cDNA	40	2.6
203	emb\|CR724338.1\|CNS0GLUG Tetraodon nigroviridis full-length cDNA	40	2.6
204	emb\|CR724015.2\|CNS0GLLH Tetraodon nigroviridis full-length cDNA	40	2.6
205	emb\|CR724596.2\|CNS0GM1M Tetraodon nigroviridis full-length cDNA	40	2.6
206	emb\|CR724667.1\|CNS0GM3L Tetraodon nigroviridis full-length cDNA	40	2.6
207	emb\|CR724565.1\|CNS0GM0R Tetraodon nigroviridis full-length cDNA	40	2.6
208	emb\|CR724528.2\|CNS0GLZQ Tetraodon nigroviridis full-length cDNA	40	2.6
209	emb\|CR724360.2\|CNS0GLV2 Tetraodon nigroviridis full-length cDNA	40	2.6
210	emb\|CR724300.2\|CNS0GLTE Tetraodon nigroviridis full-length cDNA	40	2.6
211	emb\|CR724282.2\|CNS0GLSW Tetraodon nigroviridis full-length cDNA	40	2.6
212	emb\|CR724280.2\|CNS0GLSU Tetraodon nigroviridis full-length cDNA	40	2.6
213	emb\|CR724253.2\|CNS0GLS3 Tetraodon nigroviridis full-length cDNA	40	2.6
214	emb\|CR724251.2\|CNS0GLS1 Tetraodon nigroviridis full-length cDNA	40	2.6
215	emb\|CR724205.2\|CNS0GLQR Tetraodon nigroviridis full-length cDNA	40	2.6
216	emb\|CR724188.2\|CNS0GLQA Tetraodon nigroviridis full-length cDNA	40	2.6
217	emb\|CR724181.2\|CNS0GLQ3 Tetraodon nigroviridis full-length cDNA	40	2.6
218	emb\|CR724168.2\|CNS0GLPQ Tetraodon nigroviridis full-length cDNA	40	2.6
219	emb\|CR723912.2\|CNS0GLIM Tetraodon nigroviridis full-length cDNA	40	2.6
220	emb\|CR723911.2\|CNS0GLIL Tetraodon nigroviridis full-length cDNA	40	2.6
221	emb\|CR723764.2\|CNS0GLEI Tetraodon nigroviridis full-length cDNA	40	2.6
222	emb\|CR723745.2\|CNS0GLDZ Tetraodon nigroviridis full-length cDNA	40	2.6
223	emb\|CR723671.2\|CNS0GLBX Tetraodon nigroviridis full-length cDNA	40	2.6
224	emb\|CR723564.2\|CNS0GL8Y Tetraodon nigroviridis full-length cDNA	40	2.6
225	emb\|CR723560.2\|CNS0GL8U Tetraodon nigroviridis full-length cDNA	40	2.6
226	emb\|CR723534.2\|CNS0GL84 Tetraodon nigroviridis full-length cDNA	40	2.6
227	emb\|CR723422.2\|CNS0GL50 Tetraodon nigroviridis full-length cDNA	40	2.6
228	emb\|CR723376.2\|CNS0GL3Q Tetraodon nigroviridis full-length cDNA	40	2.6
229	emb\|CR723358.2\|CNS0GL38 Tetraodon nigroviridis full-length cDNA	40	2.6
230	emb\|CR723250.2\|CNS0GL08 Tetraodon nigroviridis full-length cDNA	40	2.6
231	emb\|CR723440.1\|CNS0GL5I Tetraodon nigroviridis full-length cDNA	40	2.6
232	emb\|CR704785.2\|CNS0G6RH Tetraodon nigroviridis full-length cDNA	40	2.6
233	emb\|CR704638.2\|CNS0G6NE Tetraodon nigroviridis full-length cDNA	40	2.6
234	emb\|CR704437.2\|CNS0G6HT Tetraodon nigroviridis full-length cDNA	40	2.6
235	emb\|CR704152.2\|CNS0G69W Tetraodon nigroviridis full-length cDNA	40	2.6
236	emb\|CR704013.2\|CNS0G661 Tetraodon nigroviridis full-length cDNA	40	2.6
237	emb\|CR703966.2\|CNS0G64Q Tetraodon nigroviridis full-length cDNA	40	2.6
238	emb\|CR703408.2\|CNS0G5P8 Tetraodon nigroviridis full-length cDNA	40	2.6
239	emb\|CR702969.2\|CNS0G5D1 Tetraodon nigroviridis full-length cDNA	40	2.6
240	emb\|CR702718.2\|CNS0G562 Tetraodon nigroviridis full-length cDNA	40	2.6
241	emb\|CR701374.2\|CNS0G44Q Tetraodon nigroviridis full-length cDNA	40	2.6
242	emb\|CR699783.2\|CNS0G2WJ Tetraodon nigroviridis full-length cDNA	40	2.6
243	emb\|CR700355.1\|CNS0G3CF Tetraodon nigroviridis full-length cDNA	40	2.6
244	emb\|CR699574.2\|CNS0G2QQ Tetraodon nigroviridis full-length cDNA	40	2.6
245	emb\|CR699486.2\|CNS0G2OA Tetraodon nigroviridis full-length cDNA	40	2.6
246	emb\|CR699308.2\|CNS0G2JC Tetraodon nigroviridis full-length cDNA	40	2.6
247	emb\|CR699110.2\|CNS0G2DU Tetraodon nigroviridis full-length cDNA	40	2.6
248	emb\|CR699082.2\|CNS0G2D2 Tetraodon nigroviridis full-length cDNA	40	2.6
249	emb\|CR698802.2\|CNS0G25A Tetraodon nigroviridis full-length cDNA	40	2.6
250	emb\|CR698139.2\|CNS0G1MV Tetraodon nigroviridis full-length cDNA	40	2.6
251	emb\|CR697716.2\|CNS0G1B4 Tetraodon nigroviridis full-length cDNA	40	2.6
252	emb\|CR696613.2\|CNS0G0GH Tetraodon nigroviridis full-length cDNA	40	2.6
253	emb\|CR696489.2\|CNS0G0D1 Tetraodon nigroviridis full-length cDNA	40	2.6
254	emb\|CR696377.2\|CNS0G09X Tetraodon nigroviridis full-length cDNA	40	2.6
255	emb\|CR696169.2\|CNS0G045 Tetraodon nigroviridis full-length cDNA	40	2.6
256	emb\|CR695863.2\|CNS0FZVN Tetraodon nigroviridis full-length cDNA	40	2.6
257	emb\|CR695350.2\|CNS0FZHE Tetraodon nigroviridis full-length cDNA	40	2.6
258	emb\|CR692024.2\|CNS0FWX0 Tetraodon nigroviridis full-length cDNA	40	2.6
259	emb\|CR695077.2\|CNS0FZ9T Tetraodon nigroviridis full-length cDNA	40	2.6
260	emb\|CR694910.2\|CNS0FZ56 Tetraodon nigroviridis full-length cDNA	40	2.6
261	emb\|CR694798.2\|CNS0FZ22 Tetraodon nigroviridis full-length cDNA	40	2.6
262	emb\|CR694700.2\|CNS0FYZC Tetraodon nigroviridis full-length cDNA	40	2.6
263	emb\|CR694477.2\|CNS0FYT5 Tetraodon nigroviridis full-length cDNA	40	2.6
264	emb\|CR694091.2\|CNS0FYIF Tetraodon nigroviridis full-length cDNA	40	2.6
265	emb\|CR694048.2\|CNS0FYH8 Tetraodon nigroviridis full-length cDNA	40	2.6
266	emb\|CR693278.2\|CNS0FXVU Tetraodon nigroviridis full-length cDNA	40	2.6
267	emb\|CR693275.1\|CNS0FXVR Tetraodon nigroviridis full-length cDNA	40	2.6
268	emb\|CR693057.2\|CNS0FXPP Tetraodon nigroviridis full-length cDNA	40	2.6
269	emb\|CR692936.2\|CNS0FXMC Tetraodon nigroviridis full-length cDNA	40	2.6
270	emb\|CR692775.2\|CNS0FXHV Tetraodon nigroviridis full-length cDNA	40	2.6
271	emb\|CR692006.2\|CNS0FWWI Tetraodon nigroviridis full-length cDNA	40	2.6
272	emb\|CR691739.2\|CNS0FWP3 Tetraodon nigroviridis full-length cDNA	40	2.6
273	emb\|CR691469.1\|CNS0FWHL Tetraodon nigroviridis full-length cDNA	40	2.6
274	emb\|CR685948.2\|CNS0FS88 Tetraodon nigroviridis full-length cDNA	40	2.6
275	emb\|CR690788.2\|CNS0FVYO Tetraodon nigroviridis full-length cDNA	40	2.6
276	emb\|CR690630.2\|CNS0FVUA Tetraodon nigroviridis full-length cDNA	40	2.6
277	emb\|CR690305.2\|CNS0FVL9 Tetraodon nigroviridis full-length cDNA	40	2.6
278	emb\|CR688034.2\|CNS0FTU6 Tetraodon nigroviridis full-length cDNA	40	2.6
279	emb\|CR687568.2\|CNS0FTH8 Tetraodon nigroviridis full-length cDNA	40	2.6
280	emb\|CR687349.2\|CNS0FTB5 Tetraodon nigroviridis full-length cDNA	40	2.6
281	emb\|CR686388.2\|CNS0FSKG Tetraodon nigroviridis full-length cDNA	40	2.6
282	emb\|CR685713.2\|CNS0FS1P Tetraodon nigroviridis full-length cDNA	40	2.6
283	emb\|CR685007.2\|CNS0FRI3 Tetraodon nigroviridis full-length cDNA	40	2.6
284	emb\|CR684453.2\|CNS0FR2P Tetraodon nigroviridis full-length cDNA	40	2.6
285	emb\|CR682922.2\|CNS0FPW6 Tetraodon nigroviridis full-length cDNA	40	2.6
286	emb\|CR682801.2\|CNS0FPST Tetraodon nigroviridis full-length cDNA	40	2.6
287	emb\|CR682337.2\|CNS0FPFX Tetraodon nigroviridis full-length cDNA	40	2.6
288	emb\|CR681713.2\|CNS0FOYL Tetraodon nigroviridis full-length cDNA	40	2.6
289	emb\|CR681617.2\|CNS0FOVX Tetraodon nigroviridis full-length cDNA	40	2.6
290	emb\|CR681259.2\|CNS0FOLZ Tetraodon nigroviridis full-length cDNA	40	2.6
291	emb\|CR681245.2\|CNS0FOLL Tetraodon nigroviridis full-length cDNA	40	2.6
292	emb\|CR681233.2\|CNS0FOL9 Tetraodon nigroviridis full-length cDNA	40	2.6
293	emb\|CR681212.2\|CNS0FOKO Tetraodon nigroviridis full-length cDNA	40	2.6
294	emb\|CR681203.2\|CNS0FOKF Tetraodon nigroviridis full-length cDNA	40	2.6
295	emb\|CR681186.2\|CNS0FOJY Tetraodon nigroviridis full-length cDNA	40	2.6
296	emb\|CR681181.2\|CNS0FOJT Tetraodon nigroviridis full-length cDNA	40	2.6
297	emb\|CR681173.2\|CNS0FOJL Tetraodon nigroviridis full-length cDNA	40	2.6
298	emb\|CR681169.2\|CNS0FOJH Tetraodon nigroviridis full-length cDNA	40	2.6
299	emb\|CR681164.2\|CNS0FOJC Tetraodon nigroviridis full-length cDNA	40	2.6
300	emb\|CR681147.2\|CNS0FOIV Tetraodon nigroviridis full-length cDNA	40	2.6
301	emb\|CR681106.2\|CNS0FOHQ Tetraodon nigroviridis full-length cDNA	40	2.6
302	emb\|CR681093.2\|CNS0FOHD Tetraodon nigroviridis full-length cDNA	40	2.6
303	emb\|CR681089.2\|CNS0FOH9 Tetraodon nigroviridis full-length cDNA	40	2.6
304	emb\|CR681087.2\|CNS0FOH7 Tetraodon nigroviridis full-length cDNA	40	2.6
305	emb\|CR681065.2\|CNS0FOGL Tetraodon nigroviridis full-length cDNA	40	2.6
306	emb\|CR681059.2\|CNS0FOGF Tetraodon nigroviridis full-length cDNA	40	2.6
307	emb\|CR681053.2\|CNS0FOG9 Tetraodon nigroviridis full-length cDNA	40	2.6
308	emb\|CR681421.2\|CNS0FOQH Tetraodon nigroviridis full-length cDNA	40	2.6
309	emb\|CR681418.2\|CNS0FOQE Tetraodon nigroviridis full-length cDNA	40	2.6
310	emb\|CR681412.2\|CNS0FOQ8 Tetraodon nigroviridis full-length cDNA	40	2.6
311	emb\|CR681407.2\|CNS0FOQ3 Tetraodon nigroviridis full-length cDNA	40	2.6
312	emb\|CR681375.2\|CNS0FOP7 Tetraodon nigroviridis full-length cDNA	40	2.6
313	emb\|CR681373.2\|CNS0FOP5 Tetraodon nigroviridis full-length cDNA	40	2.6
314	emb\|CR681362.2\|CNS0FOOU Tetraodon nigroviridis full-length cDNA	40	2.6
315	emb\|CR681357.2\|CNS0FOOP Tetraodon nigroviridis full-length cDNA	40	2.6
316	emb\|CR681345.2\|CNS0FOOD Tetraodon nigroviridis full-length cDNA	40	2.6
317	emb\|CR681317.2\|CNS0FONL Tetraodon nigroviridis full-length cDNA	40	2.6
318	emb\|CR681297.2\|CNS0FON1 Tetraodon nigroviridis full-length cDNA	40	2.6
319	emb\|CR681291.2\|CNS0FOMV Tetraodon nigroviridis full-length cDNA	40	2.6
320	emb\|CR681287.2\|CNS0FOMR Tetraodon nigroviridis full-length cDNA	40	2.6
321	emb\|CR681265.2\|CNS0FOM5 Tetraodon nigroviridis full-length cDNA	40	2.6
322	emb\|CR681038.2\|CNS0FOFU Tetraodon nigroviridis full-length cDNA	40	2.6
323	emb\|CR681036.2\|CNS0FOFS Tetraodon nigroviridis full-length cDNA	40	2.6
324	emb\|CR681033.2\|CNS0FOFP Tetraodon nigroviridis full-length cDNA	40	2.6
325	emb\|CR681013.2\|CNS0FOF5 Tetraodon nigroviridis full-length cDNA	40	2.6
326	emb\|CR681000.2\|CNS0FOES Tetraodon nigroviridis full-length cDNA	40	2.6
327	emb\|CR680996.2\|CNS0FOEO Tetraodon nigroviridis full-length cDNA	40	2.6
328	emb\|CR680994.2\|CNS0FOEM Tetraodon nigroviridis full-length cDNA	40	2.6
329	emb\|CR680974.2\|CNS0FOE2 Tetraodon nigroviridis full-length cDNA	40	2.6
330	emb\|CR680962.2\|CNS0FODQ Tetraodon nigroviridis full-length cDNA	40	2.6
331	emb\|CR680922.2\|CNS0FOCM Tetraodon nigroviridis full-length cDNA	40	2.6
332	emb\|CR680909.2\|CNS0FOC9 Tetraodon nigroviridis full-length cDNA	40	2.6
333	emb\|CR680901.2\|CNS0FOC1 Tetraodon nigroviridis full-length cDNA	40	2.6
334	emb\|CR680898.2\|CNS0FOBY Tetraodon nigroviridis full-length cDNA	40	2.6
335	emb\|CR680870.2\|CNS0FOB6 Tetraodon nigroviridis full-length cDNA	40	2.6
336	emb\|CR680818.2\|CNS0FO9Q Tetraodon nigroviridis full-length cDNA	40	2.6
337	emb\|CR680814.2\|CNS0FO9M Tetraodon nigroviridis full-length cDNA	40	2.6
338	emb\|CR680812.2\|CNS0FO9K Tetraodon nigroviridis full-length cDNA	40	2.6
339	emb\|CR680800.2\|CNS0FO98 Tetraodon nigroviridis full-length cDNA	40	2.6
340	emb\|CR681102.1\|CNS0FOHM Tetraodon nigroviridis full-length cDNA	40	2.6
341	emb\|CR680948.1\|CNS0FODC Tetraodon nigroviridis full-length cDNA	40	2.6
342	emb\|CR680760.2\|CNS0FO84 Tetraodon nigroviridis full-length cDNA	40	2.6
343	emb\|CR680754.2\|CNS0FO7Y Tetraodon nigroviridis full-length cDNA	40	2.6
344	emb\|CR680738.2\|CNS0FO7I Tetraodon nigroviridis full-length cDNA	40	2.6
345	emb\|CR680732.2\|CNS0FO7C Tetraodon nigroviridis full-length cDNA	40	2.6
346	emb\|CR680722.2\|CNS0FO72 Tetraodon nigroviridis full-length cDNA	40	2.6
347	emb\|CR680699.2\|CNS0FO6F Tetraodon nigroviridis full-length cDNA	40	2.6
348	emb\|CR680614.2\|CNS0FO42 Tetraodon nigroviridis full-length cDNA	40	2.6
349	emb\|CR680604.2\|CNS0FO3S Tetraodon nigroviridis full-length cDNA	40	2.6
350	emb\|CR680598.2\|CNS0FO3M Tetraodon nigroviridis full-length cDNA	40	2.6
351	emb\|CR680582.2\|CNS0FO36 Tetraodon nigroviridis full-length cDNA	40	2.6
352	emb\|CR680581.2\|CNS0FO35 Tetraodon nigroviridis full-length cDNA	40	2.6
353	emb\|CR680569.2\|CNS0FO2T Tetraodon nigroviridis full-length cDNA	40	2.6
354	emb\|CR680560.2\|CNS0FO2K Tetraodon nigroviridis full-length cDNA	40	2.6
355	emb\|CR680557.2\|CNS0FO2H Tetraodon nigroviridis full-length cDNA	40	2.6
356	emb\|CR680550.2\|CNS0FO2A Tetraodon nigroviridis full-length cDNA	40	2.6
357	emb\|CR680545.2\|CNS0FO25 Tetraodon nigroviridis full-length cDNA	40	2.6
358	emb\|CR680544.2\|CNS0FO24 Tetraodon nigroviridis full-length cDNA	40	2.6
359	emb\|CR680525.2\|CNS0FO1L Tetraodon nigroviridis full-length cDNA	40	2.6
360	emb\|CR680519.2\|CNS0FO1F Tetraodon nigroviridis full-length cDNA	40	2.6
361	emb\|CR680501.2\|CNS0FO0X Tetraodon nigroviridis full-length cDNA	40	2.6
362	emb\|CR680498.2\|CNS0FO0U Tetraodon nigroviridis full-length cDNA	40	2.6
363	emb\|CR680493.2\|CNS0FO0P Tetraodon nigroviridis full-length cDNA	40	2.6
364	emb\|CR680477.2\|CNS0FO09 Tetraodon nigroviridis full-length cDNA	40	2.6
365	emb\|CR680476.2\|CNS0FO08 Tetraodon nigroviridis full-length cDNA	40	2.6
366	emb\|CR680474.2\|CNS0FO06 Tetraodon nigroviridis full-length cDNA	40	2.6
367	emb\|CR680463.2\|CNS0FNZV Tetraodon nigroviridis full-length cDNA	40	2.6
368	emb\|CR680461.2\|CNS0FNZT Tetraodon nigroviridis full-length cDNA	40	2.6
369	emb\|CR680459.2\|CNS0FNZR Tetraodon nigroviridis full-length cDNA	40	2.6
370	emb\|CR680431.2\|CNS0FNYZ Tetraodon nigroviridis full-length cDNA	40	2.6
371	emb\|CR680408.2\|CNS0FNYC Tetraodon nigroviridis full-length cDNA	40	2.6
372	emb\|CR680393.2\|CNS0FNXX Tetraodon nigroviridis full-length cDNA	40	2.6
373	emb\|CR680368.2\|CNS0FNX8 Tetraodon nigroviridis full-length cDNA	40	2.6
374	emb\|CR680352.2\|CNS0FNWS Tetraodon nigroviridis full-length cDNA	40	2.6
375	emb\|CR680346.2\|CNS0FNWM Tetraodon nigroviridis full-length cDNA	40	2.6
376	emb\|CR680341.2\|CNS0FNWH Tetraodon nigroviridis full-length cDNA	40	2.6
377	emb\|CR680322.2\|CNS0FNVY Tetraodon nigroviridis full-length cDNA	40	2.6
378	emb\|CR680292.2\|CNS0FNV4 Tetraodon nigroviridis full-length cDNA	40	2.6
379	emb\|CR680289.2\|CNS0FNV1 Tetraodon nigroviridis full-length cDNA	40	2.6
380	emb\|CR680287.2\|CNS0FNUZ Tetraodon nigroviridis full-length cDNA	40	2.6
381	emb\|CR680282.2\|CNS0FNUU Tetraodon nigroviridis full-length cDNA	40	2.6
382	emb\|CR680275.2\|CNS0FNUN Tetraodon nigroviridis full-length cDNA	40	2.6
383	emb\|CR680274.2\|CNS0FNUM Tetraodon nigroviridis full-length cDNA	40	2.6
384	emb\|CR680587.1\|CNS0FO3B Tetraodon nigroviridis full-length cDNA	40	2.6
385	emb\|CR680166.2\|CNS0FNRM Tetraodon nigroviridis full-length cDNA	40	2.6
386	emb\|CR680071.2\|CNS0FNOZ Tetraodon nigroviridis full-length cDNA	40	2.6
387	emb\|CR680064.2\|CNS0FNOS Tetraodon nigroviridis full-length cDNA	40	2.6
388	emb\|CR680044.2\|CNS0FNO8 Tetraodon nigroviridis full-length cDNA	40	2.6
389	emb\|CR680018.2\|CNS0FNNI Tetraodon nigroviridis full-length cDNA	40	2.6
390	emb\|CR680013.2\|CNS0FNND Tetraodon nigroviridis full-length cDNA	40	2.6
391	emb\|CR679982.2\|CNS0FNMI Tetraodon nigroviridis full-length cDNA	40	2.6
392	emb\|CR679980.2\|CNS0FNMG Tetraodon nigroviridis full-length cDNA	40	2.6
393	emb\|CR679979.2\|CNS0FNMF Tetraodon nigroviridis full-length cDNA	40	2.6
394	emb\|CR679950.2\|CNS0FNLM Tetraodon nigroviridis full-length cDNA	40	2.6
395	emb\|CR679943.2\|CNS0FNLF Tetraodon nigroviridis full-length cDNA	40	2.6
396	emb\|CR679879.2\|CNS0FNJN Tetraodon nigroviridis full-length cDNA	40	2.6
397	emb\|CR679856.2\|CNS0FNJ0 Tetraodon nigroviridis full-length cDNA	40	2.6
398	emb\|CR679837.2\|CNS0FNIH Tetraodon nigroviridis full-length cDNA	40	2.6
399	emb\|CR679817.2\|CNS0FNHX Tetraodon nigroviridis full-length cDNA	40	2.6
400	emb\|CR679804.2\|CNS0FNHK Tetraodon nigroviridis full-length cDNA	40	2.6
401	emb\|CR679779.2\|CNS0FNGV Tetraodon nigroviridis full-length cDNA	40	2.6
402	emb\|CR679770.2\|CNS0FNGM Tetraodon nigroviridis full-length cDNA	40	2.6
403	emb\|CR679761.2\|CNS0FNGD Tetraodon nigroviridis full-length cDNA	40	2.6
404	emb\|CR679753.2\|CNS0FNG5 Tetraodon nigroviridis full-length cDNA	40	2.6
405	emb\|CR679721.2\|CNS0FNF9 Tetraodon nigroviridis full-length cDNA	40	2.6
406	emb\|CR679787.1\|CNS0FNH3 Tetraodon nigroviridis full-length cDNA	40	2.6
407	emb\|CR679764.1\|CNS0FNGG Tetraodon nigroviridis full-length cDNA	40	2.6
408	emb\|CR679706.2\|CNS0FNEU Tetraodon nigroviridis full-length cDNA	40	2.6
409	emb\|CR679694.2\|CNS0FNEI Tetraodon nigroviridis full-length cDNA	40	2.6
410	emb\|CR679688.2\|CNS0FNEC Tetraodon nigroviridis full-length cDNA	40	2.6
411	emb\|CR679677.2\|CNS0FNE1 Tetraodon nigroviridis full-length cDNA	40	2.6
412	emb\|CR679661.2\|CNS0FNDL Tetraodon nigroviridis full-length cDNA	40	2.6
413	emb\|CR679652.2\|CNS0FNDC Tetraodon nigroviridis full-length cDNA	40	2.6
414	emb\|CR679635.2\|CNS0FNCV Tetraodon nigroviridis full-length cDNA	40	2.6
415	emb\|CR679631.2\|CNS0FNCR Tetraodon nigroviridis full-length cDNA	40	2.6
416	emb\|CR679609.2\|CNS0FNC5 Tetraodon nigroviridis full-length cDNA	40	2.6
417	emb\|CR679602.2\|CNS0FNBY Tetraodon nigroviridis full-length cDNA	40	2.6
418	emb\|CR679272.2\|CNS0FN2S Tetraodon nigroviridis full-length cDNA	40	2.6
419	emb\|CR679259.2\|CNS0FN2F Tetraodon nigroviridis full-length cDNA	40	2.6
420	emb\|CR679240.2\|CNS0FN1W Tetraodon nigroviridis full-length cDNA	40	2.6
421	emb\|CR679227.2\|CNS0FN1J Tetraodon nigroviridis full-length cDNA	40	2.6
422	emb\|CR679225.2\|CNS0FN1H Tetraodon nigroviridis full-length cDNA	40	2.6
423	emb\|CR679615.1\|CNS0FNCB Tetraodon nigroviridis full-length cDNA	40	2.6
424	emb\|CR679589.1\|CNS0FNBL Tetraodon nigroviridis full-length cDNA	40	2.6
425	emb\|CR679289.1\|CNS0FN39 Tetraodon nigroviridis full-length cDNA	40	2.6
426	emb\|CR679211.1\|CNS0FN13 Tetraodon nigroviridis full-length cDNA	40	2.6
427	emb\|CR679197.2\|CNS0FN0P Tetraodon nigroviridis full-length cDNA	40	2.6
428	emb\|CR679194.2\|CNS0FN0M Tetraodon nigroviridis full-length cDNA	40	2.6
429	emb\|CR679175.2\|CNS0FN03 Tetraodon nigroviridis full-length cDNA	40	2.6
430	emb\|CR679581.2\|CNS0FNBD Tetraodon nigroviridis full-length cDNA	40	2.6
431	emb\|CR679571.2\|CNS0FNB3 Tetraodon nigroviridis full-length cDNA	40	2.6
432	emb\|CR679537.2\|CNS0FNA5 Tetraodon nigroviridis full-length cDNA	40	2.6
433	emb\|CR679519.2\|CNS0FN9N Tetraodon nigroviridis full-length cDNA	40	2.6
434	emb\|CR679506.2\|CNS0FN9A Tetraodon nigroviridis full-length cDNA	40	2.6
435	emb\|CR679491.2\|CNS0FN8V Tetraodon nigroviridis full-length cDNA	40	2.6
436	emb\|CR679472.2\|CNS0FN8C Tetraodon nigroviridis full-length cDNA	40	2.6
437	emb\|CR679464.2\|CNS0FN84 Tetraodon nigroviridis full-length cDNA	40	2.6
438	emb\|CR679459.2\|CNS0FN7Z Tetraodon nigroviridis full-length cDNA	40	2.6
439	emb\|CR679448.2\|CNS0FN7O Tetraodon nigroviridis full-length cDNA	40	2.6
440	emb\|CR679447.2\|CNS0FN7N Tetraodon nigroviridis full-length cDNA	40	2.6
441	emb\|CR679422.2\|CNS0FN6Y Tetraodon nigroviridis full-length cDNA	40	2.6
442	emb\|CR679415.2\|CNS0FN6R Tetraodon nigroviridis full-length cDNA	40	2.6
443	emb\|CR679400.2\|CNS0FN6C Tetraodon nigroviridis full-length cDNA	40	2.6
444	emb\|CR679396.2\|CNS0FN68 Tetraodon nigroviridis full-length cDNA	40	2.6
445	emb\|CR679381.2\|CNS0FN5T Tetraodon nigroviridis full-length cDNA	40	2.6
446	emb\|CR679377.2\|CNS0FN5P Tetraodon nigroviridis full-length cDNA	40	2.6
447	emb\|CR679371.2\|CNS0FN5J Tetraodon nigroviridis full-length cDNA	40	2.6
448	emb\|CR679368.2\|CNS0FN5G Tetraodon nigroviridis full-length cDNA	40	2.6
449	emb\|CR678932.2\|CNS0FMTC Tetraodon nigroviridis full-length cDNA	40	2.6
450	emb\|CR678920.2\|CNS0FMT0 Tetraodon nigroviridis full-length cDNA	40	2.6
451	emb\|CR678897.2\|CNS0FMSD Tetraodon nigroviridis full-length cDNA	40	2.6
452	emb\|CR678893.2\|CNS0FMS9 Tetraodon nigroviridis full-length cDNA	40	2.6
453	emb\|CR678892.2\|CNS0FMS8 Tetraodon nigroviridis full-length cDNA	40	2.6
454	emb\|CR678890.2\|CNS0FMS6 Tetraodon nigroviridis full-length cDNA	40	2.6
455	emb\|CR678821.2\|CNS0FMQ9 Tetraodon nigroviridis full-length cDNA	40	2.6
456	emb\|CR678819.2\|CNS0FMQ7 Tetraodon nigroviridis full-length cDNA	40	2.6
457	emb\|CR678813.2\|CNS0FMQ1 Tetraodon nigroviridis full-length cDNA	40	2.6
458	emb\|CR678812.2\|CNS0FMQ0 Tetraodon nigroviridis full-length cDNA	40	2.6
459	emb\|CR678805.2\|CNS0FMPT Tetraodon nigroviridis full-length cDNA	40	2.6
460	emb\|CR678803.2\|CNS0FMPR Tetraodon nigroviridis full-length cDNA	40	2.6
461	emb\|CR678801.2\|CNS0FMPP Tetraodon nigroviridis full-length cDNA	40	2.6
462	emb\|CR678796.2\|CNS0FMPK Tetraodon nigroviridis full-length cDNA	40	2.6
463	emb\|CR678790.2\|CNS0FMPE Tetraodon nigroviridis full-length cDNA	40	2.6
464	emb\|CR678786.2\|CNS0FMPA Tetraodon nigroviridis full-length cDNA	40	2.6
465	emb\|CR678780.2\|CNS0FMP4 Tetraodon nigroviridis full-length cDNA	40	2.6
466	emb\|CR678777.2\|CNS0FMP1 Tetraodon nigroviridis full-length cDNA	40	2.6
467	emb\|CR678773.2\|CNS0FMOX Tetraodon nigroviridis full-length cDNA	40	2.6
468	emb\|CR678749.2\|CNS0FMO9 Tetraodon nigroviridis full-length cDNA	40	2.6
469	emb\|CR678743.2\|CNS0FMO3 Tetraodon nigroviridis full-length cDNA	40	2.6
470	emb\|CR678736.2\|CNS0FMNW Tetraodon nigroviridis full-length cDNA	40	2.6
471	emb\|CR679134.2\|CNS0FMYY Tetraodon nigroviridis full-length cDNA	40	2.6
472	emb\|CR679129.2\|CNS0FMYT Tetraodon nigroviridis full-length cDNA	40	2.6
473	emb\|CR679128.2\|CNS0FMYS Tetraodon nigroviridis full-length cDNA	40	2.6
474	emb\|CR679123.2\|CNS0FMYN Tetraodon nigroviridis full-length cDNA	40	2.6
475	emb\|CR679107.2\|CNS0FMY7 Tetraodon nigroviridis full-length cDNA	40	2.6
476	emb\|CR679096.2\|CNS0FMXW Tetraodon nigroviridis full-length cDNA	40	2.6
477	emb\|CR679086.2\|CNS0FMXM Tetraodon nigroviridis full-length cDNA	40	2.6
478	emb\|CR679059.2\|CNS0FMWV Tetraodon nigroviridis full-length cDNA	40	2.6
479	emb\|CR679043.2\|CNS0FMWF Tetraodon nigroviridis full-length cDNA	40	2.6
480	emb\|CR679026.2\|CNS0FMVY Tetraodon nigroviridis full-length cDNA	40	2.6
481	emb\|CR678994.2\|CNS0FMV2 Tetraodon nigroviridis full-length cDNA	40	2.6
482	emb\|CR678984.2\|CNS0FMUS Tetraodon nigroviridis full-length cDNA	40	2.6
483	emb\|CR678969.2\|CNS0FMUD Tetraodon nigroviridis full-length cDNA	40	2.6
484	emb\|CR678966.2\|CNS0FMUA Tetraodon nigroviridis full-length cDNA	40	2.6
485	emb\|CR678956.2\|CNS0FMU0 Tetraodon nigroviridis full-length cDNA	40	2.6
486	emb\|CR678951.2\|CNS0FMTV Tetraodon nigroviridis full-length cDNA	40	2.6
487	emb\|CR677635.2\|CNS0FLTO Tetraodon nigroviridis full-length cDNA	40	2.6
488	emb\|CR677632.2\|CNS0FLTL Tetraodon nigroviridis full-length cDNA	40	2.6
489	emb\|CR677629.2\|CNS0FLTI Tetraodon nigroviridis full-length cDNA	40	2.6
490	emb\|CR677624.2\|CNS0FLTD Tetraodon nigroviridis full-length cDNA	40	2.6
491	emb\|CR677603.2\|CNS0FLST Tetraodon nigroviridis full-length cDNA	40	2.6
492	emb\|CR677590.2\|CNS0FLSH Tetraodon nigroviridis full-length cDNA	40	2.6
493	emb\|CR677583.2\|CNS0FLSA Tetraodon nigroviridis full-length cDNA	40	2.6
494	emb\|CR677568.2\|CNS0FLRV Tetraodon nigroviridis full-length cDNA	40	2.6
495	emb\|CR677557.2\|CNS0FLRK Tetraodon nigroviridis full-length cDNA	40	2.6
496	emb\|CR677556.2\|CNS0FLRJ Tetraodon nigroviridis full-length cDNA	40	2.6
497	emb\|CR677540.2\|CNS0FLR3 Tetraodon nigroviridis full-length cDNA	40	2.6
498	emb\|CR677529.2\|CNS0FLQS Tetraodon nigroviridis full-length cDNA	40	2.6
499	emb\|CR677528.2\|CNS0FLQR Tetraodon nigroviridis full-length cDNA	40	2.6
500	emb\|CR677526.2\|CNS0FLQP Tetraodon nigroviridis full-length cDNA	40	2.6

>gb|AF542969.2| Triticum aestivum ribosomal protein L19 mRNA, complete cds
          Length = 854

 Score =  192 bits (97), Expect = 3e-46
 Identities = 163/185 (88%), Gaps = 11/185 (5%)
 Strand = Plus / Minus

                                                                       
Query: 24  taccagaaag-ctaaagcttcaagtcagaccttcacttcttggccttctttggtgccgct 82
           |||||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||| 
Sbjct: 670 taccagaaaggctaaagcttcatgtcagaacttcacttcttggccttctttggtgccgc- 612

                                                                       
Query: 83  gctgccggagctgganctgtngccgctggtgccggtgcatgatctctggggccctggggg 142
                   ||||||| |||  ||||||||||| |||||||||||||| ||||| ||||| 
Sbjct: 611 --------agctggagctgcagccgctggtgctggtgcatgatctctcgggccntggggc 560

                                                                       
Query: 143 -antctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgctt 201
            | ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||
Sbjct: 559 caatctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcgcgctt 500

                
Query: 202 ggcct 206
           |||||
Sbjct: 499 ggcct 495

to top

>gb|AY389581.1| Hyacinthus orientalis ribosomal protein L19 (RPL19) mRNA, complete
           cds
          Length = 664

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 55/57 (96%)
 Strand = Plus / Minus

                                                                    
Query: 148 ctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggc 204
           ||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||
Sbjct: 557 ctcctccctcctggcaatctttctctctctgcttgccttgctcttggcacgcttggc 501

to top

>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3
          Length = 36102668

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 58/61 (95%)
 Strand = Plus / Plus

                                                                            
Query: 146      ctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcc 205
                ||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 12517459 ctctcctccctcctggcaatcttcctctcacggcttgccttgctcttggcacgcttagcc 12517518

                 
Query: 206      t 206
                |
Sbjct: 12517519 t 12517519



 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                  
Query: 157      cctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcct 206
                |||||||||||||||||| |  || |||||||||||||||||||| ||||
Sbjct: 21047212 cctggcaatcttcctctcacgactggccttgctcttggcacgcttagcct 21047261

to top

>gb|AC134885.1| Genomic sequence for Oryza sativa, Nipponbare strain, clone OJ1125B03,
             from chromosome 3, complete sequence
          Length = 124550

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 58/61 (95%)
 Strand = Plus / Minus

                                                                         
Query: 146   ctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcc 205
             ||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 70482 ctctcctccctcctggcaatcttcctctcacggcttgccttgctcttggcacgcttagcc 70423

              
Query: 206   t 206
             |
Sbjct: 70422 t 70422

to top

>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete
                sequence
          Length = 36192742

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 58/61 (95%)
 Strand = Plus / Plus

                                                                            
Query: 146      ctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcc 205
                ||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 12514222 ctctcctccctcctggcaatcttcctctcacggcttgccttgctcttggcacgcttagcc 12514281

                 
Query: 206      t 206
                |
Sbjct: 12514282 t 12514282



 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                                  
Query: 157      cctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcct 206
                |||||||||||||||||| |  || |||||||||||||||||||| ||||
Sbjct: 21040241 cctggcaatcttcctctcacgactggccttgctcttggcacgcttagcct 21040290

to top

>dbj|AK102721.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033105G07, full
           insert sequence
          Length = 914

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 58/61 (95%)
 Strand = Plus / Minus

                                                                       
Query: 146 ctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcc 205
           ||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 631 ctctcctccctcctggcaatcttcctctcacggcttgccttgctcttggcacgcttagcc 572

            
Query: 206 t 206
           |
Sbjct: 571 t 571



 Score = 46.1 bits (23), Expect = 0.043
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 54  ttcacttcttggccttctttggtgccgctgc 84
           |||||||||| |||||||| |||||||||||
Sbjct: 720 ttcacttctttgccttcttaggtgccgctgc 690

to top

>dbj|AK059309.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-025-G06, full
           insert sequence
          Length = 1121

 Score = 97.6 bits (49), Expect = 1e-17
 Identities = 58/61 (95%)
 Strand = Plus / Minus

                                                                       
Query: 146 ctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcc 205
           ||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |||
Sbjct: 632 ctctcctccctcctggcaatcttcctctcacggcttgccttgctcttggcacgcttagcc 573

            
Query: 206 t 206
           |
Sbjct: 572 t 572



 Score = 46.1 bits (23), Expect = 0.043
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 54  ttcacttcttggccttctttggtgccgctgc 84
           |||||||||| |||||||| |||||||||||
Sbjct: 721 ttcacttctttgccttcttaggtgccgctgc 691

to top

>gb|AY103679.1| Zea mays PCO152526 mRNA sequence
          Length = 1051

 Score = 93.7 bits (47), Expect = 2e-16
 Identities = 73/82 (89%)
 Strand = Plus / Minus

                                                                       
Query: 125 tctctggggccctgggggantctctcctccctcctggcaatcttcctctccctgcttgcc 184
           ||||| ||||||||||  |  |||||||||||||| |||||||||||||| | |||||||
Sbjct: 638 tctcttgggccctgggccagcctctcctccctcctagcaatcttcctctcacggcttgcc 579

                                 
Query: 185 ttgctcttggcacgcttggcct 206
           |||||||| |||||||||||||
Sbjct: 578 ttgctctttgcacgcttggcct 557

to top

>gb|BT019233.1| Zea mays clone Contig906.F mRNA sequence
          Length = 1470

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 55/61 (90%)
 Strand = Plus / Plus

                                                                       
Query: 146 ctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcc 205
           |||||||||||||| || ||||||||||| | ||| |||||||||||||| |||||||||
Sbjct: 290 ctctcctccctcctagcgatcttcctctcacggctcgccttgctcttggcgcgcttggcc 349

            
Query: 206 t 206
           |
Sbjct: 350 t 350

to top

>gb|BT016537.1| Zea mays clone Contig370 mRNA sequence
          Length = 956

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 55/61 (90%)
 Strand = Plus / Minus

                                                                       
Query: 146 ctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcc 205
           |||||||||||||| || ||||||||||| | ||| |||||||||||||| |||||||||
Sbjct: 726 ctctcctccctcctagcgatcttcctctcacggctcgccttgctcttggcgcgcttggcc 667

            
Query: 206 t 206
           |
Sbjct: 666 t 666

to top

>gb|AY103638.1| Zea mays PCO153348 mRNA sequence
          Length = 1258

 Score = 73.8 bits (37), Expect = 2e-10
 Identities = 55/61 (90%)
 Strand = Plus / Minus

                                                                       
Query: 146 ctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcc 205
           |||||||||||||| || ||||||||||| | ||| |||||||||||||| |||||||||
Sbjct: 921 ctctcctccctcctagcgatcttcctctcacggctcgccttgctcttggcgcgcttggcc 862

            
Query: 206 t 206
           |
Sbjct: 861 t 861

to top

>dbj|D29721.1|RICYK34 Oryza sativa mRNA, partial homologous to ribosomal protein L19 gene
          Length = 369

 Score = 69.9 bits (35), Expect = 3e-09
 Identities = 56/62 (90%), Gaps = 1/62 (1%)
 Strand = Plus / Plus

                                                                       
Query: 146 ctctcctccctcctggcaatcttcctctc-cctgcttgccttgctcttggcacgcttggc 204
           ||||||| ||||||||||||||||||||| |  | |||||||||||||||||||||| ||
Sbjct: 259 ctctcctncctcctggcaatcttcctctcacgggtttgccttgctcttggcacgcttagc 318

             
Query: 205 ct 206
           ||
Sbjct: 319 ct 320



 Score = 46.1 bits (23), Expect = 0.043
 Identities = 29/31 (93%)
 Strand = Plus / Plus

                                          
Query: 54  ttcacttcttggccttctttggtgccgctgc 84
           |||||||||| |||||||| |||||||||||
Sbjct: 170 ttcacttctttgccttcttaggtgccgctgc 200

to top

>gb|BT016919.1| Zea mays clone E04912701B11.c mRNA sequence
          Length = 974

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 51/58 (87%)
 Strand = Plus / Plus

                                                                     
Query: 149 tcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcct 206
           ||||||||||| | ||||||||| || | | ||||||||||||| |||||||||||||
Sbjct: 347 tcctccctcctagaaatcttcctttcacgggttgccttgctctttgcacgcttggcct 404

to top

>gb|AC147962.1| Oryza sativa chromosome 3 BAC OSJNBa0083K01 genomic sequence, complete
             sequence
          Length = 167239

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Minus

                                                               
Query: 157   cctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcct 206
             |||||||||||||||||| |  || |||||||||||||||||||| ||||
Sbjct: 38066 cctggcaatcttcctctcacgactggccttgctcttggcacgcttagcct 38017

to top

>gb|AC128645.5| Oryza sativa chromosome 3 BAC OSJNBb0016P23 genomic sequence, complete
             sequence
          Length = 131250

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 45/50 (90%)
 Strand = Plus / Plus

                                                               
Query: 157   cctggcaatcttcctctccctgcttgccttgctcttggcacgcttggcct 206
             |||||||||||||||||| |  || |||||||||||||||||||| ||||
Sbjct: 24968 cctggcaatcttcctctcacgactggccttgctcttggcacgcttagcct 25017

to top

>gb|AY104244.1| Zea mays PCO075323 mRNA sequence
          Length = 924

 Score = 60.0 bits (30), Expect = 3e-06
 Identities = 54/62 (87%)
 Strand = Plus / Minus

                                                                       
Query: 145 tctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggc 204
           ||||||||||||||| |||||||| ||||| | |   |||||||||||||| ||||||||
Sbjct: 612 tctctcctccctccttgcaatctttctctcacgggaagccttgctcttggctcgcttggc 553

             
Query: 205 ct 206
           ||
Sbjct: 552 ct 551



 Score = 46.1 bits (23), Expect = 0.043
 Identities = 29/31 (93%)
 Strand = Plus / Minus

                                          
Query: 54  ttcacttcttggccttctttggtgccgctgc 84
           |||||||||| |||||||||||||| |||||
Sbjct: 700 ttcacttcttcgccttctttggtgcagctgc 670

to top

>gb|BT016443.1| Zea mays clone Contig276 mRNA sequence
          Length = 779

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 68/82 (82%)
 Strand = Plus / Minus

                                                                       
Query: 125 tctctggggccctgggggantctctcctccctcctggcaatcttcctctccctgcttgcc 184
           ||||| ||||||||||  |  ||||| |||||||| ||| |||||||||| |  || |||
Sbjct: 592 tctcttgggccctgggccagcctctcttccctcctagcattcttcctctcgcgactcgcc 533

                                 
Query: 185 ttgctcttggcacgcttggcct 206
           ||||||||||| ||| ||||||
Sbjct: 532 ttgctcttggcgcgcctggcct 511

to top

>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete
                sequence
          Length = 29644043

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                           
Query: 146      ctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggc 204
                ||||||| |||||||| ||||||||| ||   ||||||| ||||||||||| |||||||
Sbjct: 28305967 ctctcctacctcctggaaatcttcctttcttggcttgccatgctcttggcaagcttggc 28305909

to top

>dbj|AP004300.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC
             clone:P0470D12
          Length = 157248

 Score = 54.0 bits (27), Expect = 2e-04
 Identities = 51/59 (86%)
 Strand = Plus / Minus

                                                                        
Query: 146   ctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggc 204
             ||||||| |||||||| ||||||||| ||   ||||||| ||||||||||| |||||||
Sbjct: 31530 ctctcctacctcctggaaatcttcctttcttggcttgccatgctcttggcaagcttggc 31472

to top

>ref|NM_112551.2| Arabidopsis thaliana structural constituent of ribosome AT3G16780
           mRNA, complete cds
          Length = 847

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 145 tctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggc 204
           ||||||||| || ||||||| ||| ||||||||||| |||||| ||||   |||||||||
Sbjct: 597 tctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggc 538

             
Query: 205 ct 206
           ||
Sbjct: 537 ct 536

to top

>gb|AY090335.1| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, complete cds
          Length = 630

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 145 tctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggc 204
           ||||||||| || ||||||| ||| ||||||||||| |||||| ||||   |||||||||
Sbjct: 540 tctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggc 481

             
Query: 205 ct 206
           ||
Sbjct: 480 ct 479

to top

>gb|AY045610.1| Arabidopsis thaliana AT3g16780/MGL6_23 mRNA, complete cds
          Length = 814

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 145 tctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggc 204
           ||||||||| || ||||||| ||| ||||||||||| |||||| ||||   |||||||||
Sbjct: 583 tctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggc 524

             
Query: 205 ct 206
           ||
Sbjct: 523 ct 522

to top

>gb|AY089073.1| Arabidopsis thaliana clone 27978 mRNA, complete sequence
          Length = 812

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                       
Query: 145 tctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggc 204
           ||||||||| || ||||||| ||| ||||||||||| |||||| ||||   |||||||||
Sbjct: 595 tctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggc 536

             
Query: 205 ct 206
           ||
Sbjct: 535 ct 534

to top

>dbj|AB022217.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MGL6
          Length = 79459

 Score = 52.0 bits (26), Expect = 7e-04
 Identities = 53/62 (85%)
 Strand = Plus / Minus

                                                                         
Query: 145   tctctcctccctcctggcaatcttcctctccctgcttgccttgctcttggcacgcttggc 204
             ||||||||| || ||||||| ||| ||||||||||| |||||| ||||   |||||||||
Sbjct: 76032 tctctcctctcttctggcaaactttctctccctgctagccttgttcttaatacgcttggc 75973

               
Query: 205   ct 206
             ||
Sbjct: 75972 ct 75971

to top

>emb|CR730601.2|CNS0GQOE Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 58 cttcttggccttctttggtgcc 79
          ||||||||||||||||||||||
Sbjct: 82 cttcttggccttctttggtgcc 61

to top

>emb|CR725565.1|CNS0GMSJ Tetraodon nigroviridis full-length cDNA
          Length = 1233

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 58 cttcttggccttctttggtgcc 79
          ||||||||||||||||||||||
Sbjct: 70 cttcttggccttctttggtgcc 49

to top

>emb|CR701659.2|CNS0G4CN Tetraodon nigroviridis full-length cDNA
          Length = 528

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 58 cttcttggccttctttggtgcc 79
          ||||||||||||||||||||||
Sbjct: 84 cttcttggccttctttggtgcc 63

to top

>emb|CR670272.2|CNS0FG5I Tetraodon nigroviridis full-length cDNA
          Length = 1038

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 58 cttcttggccttctttggtgcc 79
          ||||||||||||||||||||||
Sbjct: 55 cttcttggccttctttggtgcc 34

to top

>emb|CR666708.2|CNS0FDEI Tetraodon nigroviridis full-length cDNA
          Length = 1237

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 58 cttcttggccttctttggtgcc 79
          ||||||||||||||||||||||
Sbjct: 78 cttcttggccttctttggtgcc 57

to top

>emb|CR666702.1|CNS0FDEC Tetraodon nigroviridis full-length cDNA
          Length = 1081

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 58 cttcttggccttctttggtgcc 79
          ||||||||||||||||||||||
Sbjct: 79 cttcttggccttctttggtgcc 58

to top

>emb|CR665691.2|CNS0FCM9 Tetraodon nigroviridis full-length cDNA
          Length = 1253

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 58 cttcttggccttctttggtgcc 79
          ||||||||||||||||||||||
Sbjct: 82 cttcttggccttctttggtgcc 61

to top

>emb|CR663076.2|CNS0FALM Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 22/22 (100%)
 Strand = Plus / Minus

                                
Query: 58 cttcttggccttctttggtgcc 79
          ||||||||||||||||||||||
Sbjct: 82 cttcttggccttctttggtgcc 61

to top

>ref|XM_578500.1| PREDICTED: Rattus norvegicus similar to novel protein (LOC502992),
           mRNA
          Length = 1143

 Score = 44.1 bits (22), Expect = 0.17
 Identities = 25/26 (96%)
 Strand = Plus / Plus

                                     
Query: 63  tggccttctttggtgccgctgctgcc 88
           |||||||||||||||| |||||||||
Sbjct: 825 tggccttctttggtgctgctgctgcc 850

to top

>ref|XM_757154.1| Ustilago maydis 521 hypothetical protein (UM06100.1) partial mRNA
          Length = 837

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                               
Query: 76 tgccgctgctgccggagctgg 96
          |||||||||||||||||||||
Sbjct: 11 tgccgctgctgccggagctgg 31

to top

>emb|CR674700.2|CNS0FJKI Tetraodon nigroviridis full-length cDNA
          Length = 809

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                
Query: 60  tcttggccttctttggtgccg 80
           |||||||||||||||||||||
Sbjct: 156 tcttggccttctttggtgccg 136

to top

>emb|AL646095.27| Mouse DNA sequence from clone RP23-17P18 on chromosome 11 Contains the
             3' end of the Asb3 gene for ankyrin repeat and SOCS
             box-containing protein 3 and two zinc finger protein
             pseudogenes, complete sequence
          Length = 173655

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 170   ctctccctgcttgccttgctc 190
             |||||||||||||||||||||
Sbjct: 73241 ctctccctgcttgccttgctc 73261

to top

>gb|AC064800.8| Homo sapiens chromosome 18, clone CTD-2001I24, complete sequence
          Length = 131409

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 172   ctccctgcttgccttgctctt 192
             |||||||||||||||||||||
Sbjct: 98973 ctccctgcttgccttgctctt 98993

to top

>dbj|D21304.1|RICSS504 Oryza sativa SS504 mRNA for ribosomal protein L19, partial sequence
          Length = 153

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 27/29 (93%)
 Strand = Plus / Minus

                                        
Query: 178 gcttgccttgctcttggcacgcttggcct 206
           ||||||||||||||||||| |||| ||||
Sbjct: 146 gcttgccttgctcttggcaagcttagcct 118

to top

>dbj|AP006618.1| Nocardia farcinica IFM 10152 DNA, complete genome
          Length = 6021225

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 73      tggtgccgctgctgccggagc 93
               |||||||||||||||||||||
Sbjct: 4628229 tggtgccgctgctgccggagc 4628249

to top

>emb|CT573326.1| Pseudomonas entomophila str. L48 chromosome,complete sequence
          Length = 5888780

 Score = 42.1 bits (21), Expect = 0.67
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                    
Query: 73      tggtgccgctgctgccggagc 93
               |||||||||||||||||||||
Sbjct: 3413543 tggtgccgctgctgccggagc 3413563

to top

>ref|XM_479458.1| Oryza sativa (japonica cultivar-group),  mRNA
          Length = 165

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 41/48 (85%)
 Strand = Plus / Minus

                                                           
Query: 157 cctggcaatcttcctctccctgcttgccttgctcttggcacgcttggc 204
           ||||| ||||||||| ||   ||||||| ||||||||||| |||||||
Sbjct: 156 cctggaaatcttcctttcttggcttgccatgctcttggcaagcttggc 109

to top

>ref|XM_425588.1| PREDICTED: Gallus gallus similar to insulin receptor substrate 2
            (LOC428017), mRNA
          Length = 4089

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 72   ttggtgccgctgctgccggagctg 95
            ||||||| ||||||||||||||||
Sbjct: 1898 ttggtgctgctgctgccggagctg 1875

to top

>gb|AC115037.16| Mus musculus chromosome 12, clone RP24-276C17, complete sequence
          Length = 214848

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 147    tctcctccctcctggcaatcttcc 170
              ||||||||||||||| ||||||||
Sbjct: 119899 tctcctccctcctgggaatcttcc 119922

to top

>gb|AC154422.2| Mus musculus BAC clone RP24-218O2 from chromosome 13, complete sequence
          Length = 170866

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 167    ttcctctccctgcttgcctt 186
              ||||||||||||||||||||
Sbjct: 148482 ttcctctccctgcttgcctt 148463

to top

>gb|AC134439.4| Mus musculus BAC clone RP24-494I18 from chromosome 13, complete
             sequence
          Length = 133093

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 158   ctggcaatcttcctctccct 177
             ||||||||||||||||||||
Sbjct: 86934 ctggcaatcttcctctccct 86953

to top

>ref|XM_534494.2| PREDICTED: Canis familiaris similar to cyclin A1 (predicted)
           (LOC477302), mRNA
          Length = 1586

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 42  tcaagtcagaccttcacttc 61
           ||||||||||||||||||||
Sbjct: 485 tcaagtcagaccttcacttc 504

to top

>emb|CR734938.2|CNS0GTUX Tetraodon nigroviridis full-length cDNA
          Length = 718

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR734860.2|CNS0GTSR Tetraodon nigroviridis full-length cDNA
          Length = 847

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR734745.2|CNS0GTPK Tetraodon nigroviridis full-length cDNA
          Length = 716

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR734619.2|CNS0GTM2 Tetraodon nigroviridis full-length cDNA
          Length = 1074

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR734317.2|CNS0GTDO Tetraodon nigroviridis full-length cDNA
          Length = 718

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR734201.2|CNS0GTAG Tetraodon nigroviridis full-length cDNA
          Length = 731

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR674675.2|CNS0FJJT Tetraodon nigroviridis full-length cDNA
          Length = 718

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR669989.2|CNS0FFXN Tetraodon nigroviridis full-length cDNA
          Length = 722

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR665304.2|CNS0FCBI Tetraodon nigroviridis full-length cDNA
          Length = 719

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR663336.2|CNS0FASU Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR679070.2|CNS0FMX6 Tetraodon nigroviridis full-length cDNA
          Length = 716

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR678868.2|CNS0FMRK Tetraodon nigroviridis full-length cDNA
          Length = 724

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR675606.2|CNS0FK9O Tetraodon nigroviridis full-length cDNA
          Length = 719

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR733921.2|CNS0GT2O Tetraodon nigroviridis full-length cDNA
          Length = 725

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR733890.2|CNS0GT1T Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR733527.2|CNS0GSRQ Tetraodon nigroviridis full-length cDNA
          Length = 1072

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR733521.2|CNS0GSRK Tetraodon nigroviridis full-length cDNA
          Length = 1258

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 85 tcttggccttctttggtgcc 66

to top

>emb|CR733736.2|CNS0GSXJ Tetraodon nigroviridis full-length cDNA
          Length = 720

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR733705.2|CNS0GSWO Tetraodon nigroviridis full-length cDNA
          Length = 1231

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR733407.2|CNS0GSOO Tetraodon nigroviridis full-length cDNA
          Length = 1088

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR733171.2|CNS0GSL0 Tetraodon nigroviridis full-length cDNA
          Length = 1080

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR733146.2|CNS0GSKM Tetraodon nigroviridis full-length cDNA
          Length = 1071

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 65 tcttggccttctttggtgcc 46

to top

>emb|CR732834.2|CNS0GSDY Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 81 tcttggccttctttggtgcc 62

to top

>emb|CR732787.2|CNS0GSCU Tetraodon nigroviridis full-length cDNA
          Length = 1102

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR733017.1|CNS0GSI9 Tetraodon nigroviridis full-length cDNA
          Length = 1097

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 60  tcttggccttctttggtgcc 79
           ||||||||||||||||||||
Sbjct: 112 tcttggccttctttggtgcc 93

to top

>emb|CR733000.1|CNS0GSHV Tetraodon nigroviridis full-length cDNA
          Length = 1353

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 65 tcttggccttctttggtgcc 46

to top

>emb|CR732678.2|CNS0GSA2 Tetraodon nigroviridis full-length cDNA
          Length = 977

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR732624.2|CNS0GS8L Tetraodon nigroviridis full-length cDNA
          Length = 1201

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 61 tcttggccttctttggtgcc 42

to top

>emb|CR732541.2|CNS0GS6A Tetraodon nigroviridis full-length cDNA
          Length = 1079

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR732527.2|CNS0GS5W Tetraodon nigroviridis full-length cDNA
          Length = 1077

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR732475.2|CNS0GS4G Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR732352.2|CNS0GS11 Tetraodon nigroviridis full-length cDNA
          Length = 1254

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR732285.2|CNS0GRZ6 Tetraodon nigroviridis full-length cDNA
          Length = 1229

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 66 tcttggccttctttggtgcc 47

to top

>emb|CR732550.1|CNS0GS6J Tetraodon nigroviridis full-length cDNA
          Length = 1235

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR732516.1|CNS0GS5L Tetraodon nigroviridis full-length cDNA
          Length = 1256

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 73 tcttggccttctttggtgcc 54

to top

>emb|CR732234.2|CNS0GRXR Tetraodon nigroviridis full-length cDNA
          Length = 1089

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR732116.2|CNS0GRUH Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR732086.2|CNS0GRTN Tetraodon nigroviridis full-length cDNA
          Length = 1054

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 71 tcttggccttctttggtgcc 52

to top

>emb|CR732006.2|CNS0GRRF Tetraodon nigroviridis full-length cDNA
          Length = 1244

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 70 tcttggccttctttggtgcc 51

to top

>emb|CR731943.2|CNS0GRPO Tetraodon nigroviridis full-length cDNA
          Length = 1222

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 61 tcttggccttctttggtgcc 42

to top

>emb|CR731942.2|CNS0GRPN Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731863.2|CNS0GRNG Tetraodon nigroviridis full-length cDNA
          Length = 1256

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR731768.2|CNS0GRKT Tetraodon nigroviridis full-length cDNA
          Length = 1263

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR731748.2|CNS0GRK9 Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731913.1|CNS0GROU Tetraodon nigroviridis full-length cDNA
          Length = 1363

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR731709.2|CNS0GRJ6 Tetraodon nigroviridis full-length cDNA
          Length = 1268

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731490.2|CNS0GRD3 Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR731489.2|CNS0GRD2 Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731487.2|CNS0GRD0 Tetraodon nigroviridis full-length cDNA
          Length = 1251

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731350.2|CNS0GR97 Tetraodon nigroviridis full-length cDNA
          Length = 1089

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731274.2|CNS0GR73 Tetraodon nigroviridis full-length cDNA
          Length = 1269

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731259.2|CNS0GR6O Tetraodon nigroviridis full-length cDNA
          Length = 1088

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731697.1|CNS0GRIU Tetraodon nigroviridis full-length cDNA
          Length = 1234

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 71 tcttggccttctttggtgcc 52

to top

>emb|CR731209.2|CNS0GR5A Tetraodon nigroviridis full-length cDNA
          Length = 1263

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR731161.2|CNS0GR3Y Tetraodon nigroviridis full-length cDNA
          Length = 1074

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 71 tcttggccttctttggtgcc 52

to top

>emb|CR731122.2|CNS0GR2V Tetraodon nigroviridis full-length cDNA
          Length = 1266

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR731059.2|CNS0GR14 Tetraodon nigroviridis full-length cDNA
          Length = 1254

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR730764.2|CNS0GQSX Tetraodon nigroviridis full-length cDNA
          Length = 1064

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR730736.2|CNS0GQS5 Tetraodon nigroviridis full-length cDNA
          Length = 1029

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 20 tcttggccttctttggtgcc 1

to top

>emb|CR730730.2|CNS0GQRZ Tetraodon nigroviridis full-length cDNA
          Length = 1233

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 55 tcttggccttctttggtgcc 36

to top

>emb|CR730636.2|CNS0GQPD Tetraodon nigroviridis full-length cDNA
          Length = 1160

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 20 tcttggccttctttggtgcc 1

to top

>emb|CR730453.2|CNS0GQKA Tetraodon nigroviridis full-length cDNA
          Length = 1254

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR730445.2|CNS0GQK2 Tetraodon nigroviridis full-length cDNA
          Length = 1087

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR730400.2|CNS0GQIT Tetraodon nigroviridis full-length cDNA
          Length = 1258

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR730359.2|CNS0GQHO Tetraodon nigroviridis full-length cDNA
          Length = 1090

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR730352.2|CNS0GQHH Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR730543.1|CNS0GQMS Tetraodon nigroviridis full-length cDNA
          Length = 1074

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR730350.1|CNS0GQHF Tetraodon nigroviridis full-length cDNA
          Length = 1247

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 69 tcttggccttctttggtgcc 50

to top

>emb|CR730237.1|CNS0GQEB Tetraodon nigroviridis full-length cDNA
          Length = 1059

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 64 tcttggccttctttggtgcc 45

to top

>emb|CR730101.2|CNS0GQAJ Tetraodon nigroviridis full-length cDNA
          Length = 1081

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 77 tcttggccttctttggtgcc 58

to top

>emb|CR730023.2|CNS0GQ8D Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR729895.2|CNS0GQ4T Tetraodon nigroviridis full-length cDNA
          Length = 1249

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR729802.2|CNS0GQ28 Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR729759.2|CNS0GQ11 Tetraodon nigroviridis full-length cDNA
          Length = 1235

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 61 tcttggccttctttggtgcc 42

to top

>emb|CR730008.1|CNS0GQ7Y Tetraodon nigroviridis full-length cDNA
          Length = 1242

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 76 tcttggccttctttggtgcc 57

to top

>emb|CR729595.2|CNS0GPWH Tetraodon nigroviridis full-length cDNA
          Length = 1072

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 70 tcttggccttctttggtgcc 51

to top

>emb|CR729540.2|CNS0GPUY Tetraodon nigroviridis full-length cDNA
          Length = 1088

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR729523.2|CNS0GPUH Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR729479.2|CNS0GPT9 Tetraodon nigroviridis full-length cDNA
          Length = 1075

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 70 tcttggccttctttggtgcc 51

to top

>emb|CR729476.2|CNS0GPT6 Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR729461.2|CNS0GPSR Tetraodon nigroviridis full-length cDNA
          Length = 1073

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 69 tcttggccttctttggtgcc 50

to top

>emb|CR729392.2|CNS0GPQU Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR729384.2|CNS0GPQM Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR729353.2|CNS0GPPR Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR729321.2|CNS0GPOV Tetraodon nigroviridis full-length cDNA
          Length = 1044

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 45 tcttggccttctttggtgcc 26

to top

>emb|CR729208.2|CNS0GPLQ Tetraodon nigroviridis full-length cDNA
          Length = 1094

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR729126.2|CNS0GPJG Tetraodon nigroviridis full-length cDNA
          Length = 1182

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 20 tcttggccttctttggtgcc 1

to top

>emb|CR729048.2|CNS0GPHA Tetraodon nigroviridis full-length cDNA
          Length = 1239

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR728810.2|CNS0GPAO Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 77 tcttggccttctttggtgcc 58

to top

>emb|CR728802.2|CNS0GPAG Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR728751.2|CNS0GP91 Tetraodon nigroviridis full-length cDNA
          Length = 1250

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 77 tcttggccttctttggtgcc 58

to top

>emb|CR728744.2|CNS0GP8U Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR728704.2|CNS0GP7Q Tetraodon nigroviridis full-length cDNA
          Length = 1065

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR728853.1|CNS0GPBV Tetraodon nigroviridis full-length cDNA
          Length = 1219

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 68 tcttggccttctttggtgcc 49

to top

>emb|CR728729.1|CNS0GP8F Tetraodon nigroviridis full-length cDNA
          Length = 1063

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 70 tcttggccttctttggtgcc 51

to top

>emb|CR728599.2|CNS0GP4T Tetraodon nigroviridis full-length cDNA
          Length = 1381

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR728477.2|CNS0GP1F Tetraodon nigroviridis full-length cDNA
          Length = 1251

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR728401.2|CNS0GOZB Tetraodon nigroviridis full-length cDNA
          Length = 1261

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR728366.2|CNS0GOYC Tetraodon nigroviridis full-length cDNA
          Length = 1259

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 85 tcttggccttctttggtgcc 66

to top

>emb|CR728355.2|CNS0GOY1 Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 81 tcttggccttctttggtgcc 62

to top

>emb|CR728273.2|CNS0GOVR Tetraodon nigroviridis full-length cDNA
          Length = 1211

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 60 tcttggccttctttggtgcc 41

to top

>emb|CR728246.2|CNS0GOV0 Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR728233.2|CNS0GOUN Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR728363.1|CNS0GOY9 Tetraodon nigroviridis full-length cDNA
          Length = 1079

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR728131.2|CNS0GORT Tetraodon nigroviridis full-length cDNA
          Length = 1243

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 71 tcttggccttctttggtgcc 52

to top

>emb|CR728120.2|CNS0GORI Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR728090.2|CNS0GOQO Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR728077.2|CNS0GOQB Tetraodon nigroviridis full-length cDNA
          Length = 1071

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 66 tcttggccttctttggtgcc 47

to top

>emb|CR727845.2|CNS0GOJV Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR727809.2|CNS0GOIV Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR727774.2|CNS0GOHW Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR727770.2|CNS0GOHS Tetraodon nigroviridis full-length cDNA
          Length = 1089

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR727768.2|CNS0GOHQ Tetraodon nigroviridis full-length cDNA
          Length = 1243

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR727700.2|CNS0GOFU Tetraodon nigroviridis full-length cDNA
          Length = 1080

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR727698.2|CNS0GOFS Tetraodon nigroviridis full-length cDNA
          Length = 1089

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR727855.1|CNS0GOK5 Tetraodon nigroviridis full-length cDNA
          Length = 1071

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 68 tcttggccttctttggtgcc 49

to top

>emb|CR727511.2|CNS0GOAL Tetraodon nigroviridis full-length cDNA
          Length = 1203

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 60 tcttggccttctttggtgcc 41

to top

>emb|CR727452.2|CNS0GO8Y Tetraodon nigroviridis full-length cDNA
          Length = 1244

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR727328.2|CNS0GO5I Tetraodon nigroviridis full-length cDNA
          Length = 1072

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 67 tcttggccttctttggtgcc 48

to top

>emb|CR727264.2|CNS0GO3Q Tetraodon nigroviridis full-length cDNA
          Length = 1074

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR727230.2|CNS0GO2S Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR727197.2|CNS0GO1V Tetraodon nigroviridis full-length cDNA
          Length = 1231

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 20 tcttggccttctttggtgcc 1

to top

>emb|CR727468.1|CNS0GO9E Tetraodon nigroviridis full-length cDNA
          Length = 1079

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR727082.2|CNS0GNYO Tetraodon nigroviridis full-length cDNA
          Length = 1258

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 84 tcttggccttctttggtgcc 65

to top

>emb|CR727060.2|CNS0GNY2 Tetraodon nigroviridis full-length cDNA
          Length = 1080

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR726968.2|CNS0GNVI Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR726930.2|CNS0GNUG Tetraodon nigroviridis full-length cDNA
          Length = 1090

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR726905.2|CNS0GNTR Tetraodon nigroviridis full-length cDNA
          Length = 1072

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR726785.2|CNS0GNQF Tetraodon nigroviridis full-length cDNA
          Length = 1079

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR726748.2|CNS0GNPE Tetraodon nigroviridis full-length cDNA
          Length = 1069

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 68 tcttggccttctttggtgcc 49

to top

>emb|CR726769.1|CNS0GNPZ Tetraodon nigroviridis full-length cDNA
          Length = 1210

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 60 tcttggccttctttggtgcc 41

to top

>emb|CR726597.2|CNS0GNL7 Tetraodon nigroviridis full-length cDNA
          Length = 1052

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 49 tcttggccttctttggtgcc 30

to top

>emb|CR726514.2|CNS0GNIW Tetraodon nigroviridis full-length cDNA
          Length = 1197

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 20 tcttggccttctttggtgcc 1

to top

>emb|CR726461.2|CNS0GNHF Tetraodon nigroviridis full-length cDNA
          Length = 1088

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR726437.2|CNS0GNGR Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR726399.2|CNS0GNFP Tetraodon nigroviridis full-length cDNA
          Length = 1383

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR726381.2|CNS0GNF7 Tetraodon nigroviridis full-length cDNA
          Length = 1387

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR726309.2|CNS0GND7 Tetraodon nigroviridis full-length cDNA
          Length = 1140

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 68 tcttggccttctttggtgcc 49

to top

>emb|CR726206.2|CNS0GNAC Tetraodon nigroviridis full-length cDNA
          Length = 717

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR726196.2|CNS0GNA2 Tetraodon nigroviridis full-length cDNA
          Length = 1082

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 77 tcttggccttctttggtgcc 58

to top

>emb|CR726132.2|CNS0GN8A Tetraodon nigroviridis full-length cDNA
          Length = 1246

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR726077.2|CNS0GN6R Tetraodon nigroviridis full-length cDNA
          Length = 1088

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 85 tcttggccttctttggtgcc 66

to top

>emb|CR725958.2|CNS0GN3G Tetraodon nigroviridis full-length cDNA
          Length = 1137

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                               
Query: 60  tcttggccttctttggtgcc 79
           ||||||||||||||||||||
Sbjct: 129 tcttggccttctttggtgcc 110

to top

>emb|CR725938.2|CNS0GN2W Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR725897.2|CNS0GN1R Tetraodon nigroviridis full-length cDNA
          Length = 1231

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 76 tcttggccttctttggtgcc 57

to top

>emb|CR725343.2|CNS0GMMD Tetraodon nigroviridis full-length cDNA
          Length = 1254

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR725771.2|CNS0GMY9 Tetraodon nigroviridis full-length cDNA
          Length = 1025

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 20 tcttggccttctttggtgcc 1

to top

>emb|CR725738.2|CNS0GMXC Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR725654.2|CNS0GMV0 Tetraodon nigroviridis full-length cDNA
          Length = 1239

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 68 tcttggccttctttggtgcc 49

to top

>emb|CR725159.2|CNS0GMH9 Tetraodon nigroviridis full-length cDNA
          Length = 1070

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR725155.2|CNS0GMH5 Tetraodon nigroviridis full-length cDNA
          Length = 1090

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR725112.2|CNS0GMFY Tetraodon nigroviridis full-length cDNA
          Length = 1080

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR725078.2|CNS0GMF0 Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR725138.1|CNS0GMGO Tetraodon nigroviridis full-length cDNA
          Length = 1080

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR725006.2|CNS0GMD0 Tetraodon nigroviridis full-length cDNA
          Length = 1251

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR724070.2|CNS0GLN0 Tetraodon nigroviridis full-length cDNA
          Length = 1260

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 76 tcttggccttctttggtgcc 57

to top

>emb|CR724338.1|CNS0GLUG Tetraodon nigroviridis full-length cDNA
          Length = 1056

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 60 tcttggccttctttggtgcc 41

to top

>emb|CR724015.2|CNS0GLLH Tetraodon nigroviridis full-length cDNA
          Length = 1091

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 71 tcttggccttctttggtgcc 52

to top

>emb|CR724596.2|CNS0GM1M Tetraodon nigroviridis full-length cDNA
          Length = 1052

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 71 tcttggccttctttggtgcc 52

to top

>emb|CR724667.1|CNS0GM3L Tetraodon nigroviridis full-length cDNA
          Length = 1066

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR724565.1|CNS0GM0R Tetraodon nigroviridis full-length cDNA
          Length = 1247

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 76 tcttggccttctttggtgcc 57

to top

>emb|CR724528.2|CNS0GLZQ Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR724360.2|CNS0GLV2 Tetraodon nigroviridis full-length cDNA
          Length = 723

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 84 tcttggccttctttggtgcc 65

to top

>emb|CR724300.2|CNS0GLTE Tetraodon nigroviridis full-length cDNA
          Length = 1257

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR724282.2|CNS0GLSW Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR724280.2|CNS0GLSU Tetraodon nigroviridis full-length cDNA
          Length = 1078

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR724253.2|CNS0GLS3 Tetraodon nigroviridis full-length cDNA
          Length = 1225

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR724251.2|CNS0GLS1 Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR724205.2|CNS0GLQR Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR724188.2|CNS0GLQA Tetraodon nigroviridis full-length cDNA
          Length = 1261

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR724181.2|CNS0GLQ3 Tetraodon nigroviridis full-length cDNA
          Length = 1077

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR724168.2|CNS0GLPQ Tetraodon nigroviridis full-length cDNA
          Length = 1085

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR723912.2|CNS0GLIM Tetraodon nigroviridis full-length cDNA
          Length = 1266

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR723911.2|CNS0GLIL Tetraodon nigroviridis full-length cDNA
          Length = 1249

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR723764.2|CNS0GLEI Tetraodon nigroviridis full-length cDNA
          Length = 1084

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 78 tcttggccttctttggtgcc 59

to top

>emb|CR723745.2|CNS0GLDZ Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR723671.2|CNS0GLBX Tetraodon nigroviridis full-length cDNA
          Length = 1266

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR723564.2|CNS0GL8Y Tetraodon nigroviridis full-length cDNA
          Length = 1089

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR723560.2|CNS0GL8U Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR723534.2|CNS0GL84 Tetraodon nigroviridis full-length cDNA
          Length = 1257

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR723422.2|CNS0GL50 Tetraodon nigroviridis full-length cDNA
          Length = 1076

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR723376.2|CNS0GL3Q Tetraodon nigroviridis full-length cDNA
          Length = 1086

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR723358.2|CNS0GL38 Tetraodon nigroviridis full-length cDNA
          Length = 1260

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR723250.2|CNS0GL08 Tetraodon nigroviridis full-length cDNA
          Length = 1252

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR723440.1|CNS0GL5I Tetraodon nigroviridis full-length cDNA
          Length = 1071

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 77 tcttggccttctttggtgcc 58

to top

>emb|CR704785.2|CNS0G6RH Tetraodon nigroviridis full-length cDNA
          Length = 1065

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 77 tcttggccttctttggtgcc 58

to top

>emb|CR704638.2|CNS0G6NE Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR704437.2|CNS0G6HT Tetraodon nigroviridis full-length cDNA
          Length = 723

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 72 tcttggccttctttggtgcc 53

to top

>emb|CR704152.2|CNS0G69W Tetraodon nigroviridis full-length cDNA
          Length = 722

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR704013.2|CNS0G661 Tetraodon nigroviridis full-length cDNA
          Length = 716

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR703966.2|CNS0G64Q Tetraodon nigroviridis full-length cDNA
          Length = 1042

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 61 tcttggccttctttggtgcc 42

to top

>emb|CR703408.2|CNS0G5P8 Tetraodon nigroviridis full-length cDNA
          Length = 733

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63

to top

>emb|CR702969.2|CNS0G5D1 Tetraodon nigroviridis full-length cDNA
          Length = 1055

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 66 tcttggccttctttggtgcc 47

to top

>emb|CR702718.2|CNS0G562 Tetraodon nigroviridis full-length cDNA
          Length = 718

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR701374.2|CNS0G44Q Tetraodon nigroviridis full-length cDNA
          Length = 718

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR699783.2|CNS0G2WJ Tetraodon nigroviridis full-length cDNA
          Length = 1070

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 75 tcttggccttctttggtgcc 56

to top

>emb|CR700355.1|CNS0G3CF Tetraodon nigroviridis full-length cDNA
          Length = 1083

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 76 tcttggccttctttggtgcc 57

to top

>emb|CR699574.2|CNS0G2QQ Tetraodon nigroviridis full-length cDNA
          Length = 1255

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 74 tcttggccttctttggtgcc 55

to top

>emb|CR699486.2|CNS0G2OA Tetraodon nigroviridis full-length cDNA
          Length = 722

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 79 tcttggccttctttggtgcc 60

to top

>emb|CR699308.2|CNS0G2JC Tetraodon nigroviridis full-length cDNA
          Length = 719

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR699110.2|CNS0G2DU Tetraodon nigroviridis full-length cDNA
          Length = 717

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 81 tcttggccttctttggtgcc 62

to top

>emb|CR699082.2|CNS0G2D2 Tetraodon nigroviridis full-length cDNA
          Length = 1257

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR698802.2|CNS0G25A Tetraodon nigroviridis full-length cDNA
          Length = 719

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 80 tcttggccttctttggtgcc 61

to top

>emb|CR698139.2|CNS0G1MV Tetraodon nigroviridis full-length cDNA
          Length = 725

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                              
Query: 60 tcttggccttctttggtgcc 79
          ||||||||||||||||||||
Sbjct: 82 tcttggccttctttggtgcc 63


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,970,841
Number of Sequences: 3902068
Number of extensions: 1970841
Number of successful extensions: 177528
Number of sequences better than 10.0: 2277
Number of HSP's better than 10.0 without gapping: 2279
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 174651
Number of HSP's gapped (non-prelim): 2874
length of query: 209
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 187
effective length of database: 17,147,199,772
effective search space: 3206526357364
effective search space used: 3206526357364
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)

to top

full-length cDNA and EST

Clone Information

BLAST Search Result