>gb|AC111106.10| Mus musculus chromosome 3, clone RP23-193O12, complete sequence
          Length = 202749

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 118    tctccaagctgaccaatacaatct 141
              ||||||||||||||||| ||||||
Sbjct: 156179 tctccaagctgaccaattcaatct 156202

>emb|AL445205.14| Human DNA sequence from clone RP11-24J23 on chromosome 1 Contains a
             novel gene (FLJ38972), the 3' end of the ROR1 gene for
             receptor tyrosine kinase-like orphan receptor 1, the 5'
             end of gene MGC35130 and a CpG island, complete sequence
          Length = 115936

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 121   ccaagctgaccaatacaatc 140
             ||||||||||||||||||||
Sbjct: 90559 ccaagctgaccaatacaatc 90540

>gb|AC113370.2| Homo sapiens chromosome 5 clone RP11-124O5, complete sequence
          Length = 189590

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                     
Query: 97    acaaatgatgttggatcaaaatct 120
             |||||||||||||||| |||||||
Sbjct: 64749 acaaatgatgttggataaaaatct 64726

>dbj|AB225186.1| Aspergillus oryzae cDNA, contig sequence: AoEST2038
          Length = 976

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 105 tgttggatcaaaatctccaagctgacca 132
           ||||||||||| ||||||||||| ||||
Sbjct: 222 tgttggatcaacatctccaagctaacca 249

>gb|AC112174.2| Homo sapiens chromosome 5 clone CTD-2384D5, complete sequence
          Length = 19885

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                    
Query: 97   acaaatgatgttggatcaaaatct 120
            |||||||||||||||| |||||||
Sbjct: 3093 acaaatgatgttggataaaaatct 3116

>dbj|AP007151.1| Aspergillus oryzae RIB40 genomic DNA, SC005
          Length = 4429080

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                          
Query: 105    tgttggatcaaaatctccaagctgacca 132
              ||||||||||| ||||||||||| ||||
Sbjct: 969632 tgttggatcaacatctccaagctaacca 969659

>gb|AC154453.2| Mus musculus BAC clone RP24-173C8 from 9, complete sequence
          Length = 208235

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 96     gacaaatgatgttggatcaa 115
              ||||||||||||||||||||
Sbjct: 152696 gacaaatgatgttggatcaa 152715

>gb|AC153825.7| Mus musculus 10 BAC RP23-70B19 (Roswell Park Cancer Institute (C57BL/6J
             Female) Mouse BAC Library) complete sequence
          Length = 279677

 Score = 40.1 bits (20), Expect = 2.6
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 104   atgttggatcaaaatctccaagct 127
             |||||||||||| |||||||||||
Sbjct: 87627 atgttggatcaatatctccaagct 87650


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,484,494
Number of Sequences: 3902068
Number of extensions: 1484494
Number of successful extensions: 107270
Number of sequences better than 10.0: 8
Number of HSP's better than 10.0 without gapping: 8
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 107237
Number of HSP's gapped (non-prelim): 33
length of query: 207
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 185
effective length of database: 17,147,199,772
effective search space: 3172231957820
effective search space used: 3172231957820
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)