ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd25b12
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1emb|AL606588.4|OSJN00023 Oryza sativa genomic DNA, chromosome 4,... 184 2e-43
2dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic D... 184 2e-43
3dbj|AK064543.1| Oryza sativa (japonica cultivar-group) cDNA clon... 184 2e-43
4emb|AL606653.3|OSJN00104 Oryza sativa genomic DNA, chromosome 4,... 184 2e-43
5ref|XM_472796.1| Oryza sativa (japonica cultivar-group), predic... 172 6e-40
6emb|AL356753.16| Human DNA sequence from clone RP11-481G8 on chr... 44 0.40
7dbj|AP002774.3| Homo sapiens genomic DNA, chromosome 11q clone:R... 42 1.6
8dbj|AP003125.2| Homo sapiens genomic DNA, chromosome 11q, clone:... 42 1.6
9emb|CR932322.1|CNS0KYLJ Paramecium tetraurelia macronuclear, put... 40 6.2
10emb|CR956391.5| Pig DNA sequence from clone PigE-133M12 on chrom... 40 6.2
11gb|AC164313.3| Mus musculus BAC clone RP23-24F12 from chromosome... 40 6.2
12gb|AF539893.1| Acrocera orbicula carbamoyl-phosphate synthase ge... 40 6.2
13emb|AL391065.6| Human DNA sequence from clone RP11-108M21 on chr... 40 6.2
14emb|AL359198.37| Human DNA sequence from clone RP11-402D21 on ch... 40 6.2
15emb|AL121582.19|HSBA280O9 Human DNA sequence from clone RP11-280... 40 6.2
16emb|AL645810.5| Zebrafish DNA sequence from clone BUSM1-37K09 Co... 40 6.2
17gb|AC141561.5| Mus musculus BAC clone RP23-457C15 from chromosom... 40 6.2
18gb|AC112251.5| Homo sapiens BAC clone RP11-734I18 from 4, comple... 40 6.2
19gb|AC104447.2| Homo sapiens chromosome 3 clone RP11-447D11, comp... 40 6.2
20gb|AC092598.2| Homo sapiens BAC clone RP11-114B11 from 2, comple... 40 6.2
21gb|AC110994.8| Homo sapiens 3 BAC RP11-144C15 (Roswell Park Canc... 40 6.2
22dbj|BS000099.1| Pan troglodytes chromosome 22 clone:PTB-047E13, ... 40 6.2
23emb|CR931650.1| Streptococcus pneumoniae strain 423/82 (serotype... 40 6.2
24dbj|AP003050.4| Homo sapiens genomic DNA, chromosome 11 clone:RP... 40 6.2
25gb|AC102211.23| Mus musculus chromosome 3, clone RP24-369F14, co... 40 6.2
26emb|CR937009.1| uncultured archaeon fos0644c1 40 6.2
27emb|AL844210.7| Mouse DNA sequence from clone RP23-235I13 on chr... 40 6.2

>emb|AL606588.4|OSJN00023 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0016O02,
            complete sequence
          Length = 167988

 Score =  184 bits (93), Expect = 2e-43
 Identities = 168/193 (87%)
 Strand = Plus / Plus

                                                                        
Query: 266  ctccagttagcttaacgtatgataccccataagtccttgaaaatcatctggatttgatgg 325
            ||||||||||||||| |||||||| ||||||| ||||  || ||||||||| |||| |||
Sbjct: 833  ctccagttagcttaatgtatgatatcccataactcctccaatatcatctgggtttgttgg 892

                                                                        
Query: 326  tttatttccagatttaggtaaccatggaaatagcttggtaaggccttctcttgcagaatc 385
            | ||||||||| |||||||||||||||||| |  || || |||||||  ||| |||||||
Sbjct: 893  tctatttccaggtttaggtaaccatggaaacaatttagtgaggccttgcctttcagaatc 952

                                                                        
Query: 386  aggacccttttgtctaccattgaccccatatttttccctctcaatggcatccattatatc 445
            || |  || |||||||||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 953  agcattctcttgtctaccattgaccccatatttctccctctcaattgcatccataatatc 1012

                         
Query: 446  ctcccgagccaca 458
            |||||||||||||
Sbjct: 1013 ctcccgagccaca 1025



to top

>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete
                sequence
          Length = 35498469

 Score =  184 bits (93), Expect = 2e-43
 Identities = 168/193 (87%)
 Strand = Plus / Plus

                                                                            
Query: 266      ctccagttagcttaacgtatgataccccataagtccttgaaaatcatctggatttgatgg 325
                ||||||||||||||| |||||||| ||||||| ||||  || ||||||||| |||| |||
Sbjct: 23282834 ctccagttagcttaatgtatgatatcccataactcctccaatatcatctgggtttgttgg 23282893

                                                                            
Query: 326      tttatttccagatttaggtaaccatggaaatagcttggtaaggccttctcttgcagaatc 385
                | ||||||||| |||||||||||||||||| |  || || |||||||  ||| |||||||
Sbjct: 23282894 tctatttccaggtttaggtaaccatggaaacaatttagtgaggccttgcctttcagaatc 23282953

                                                                            
Query: 386      aggacccttttgtctaccattgaccccatatttttccctctcaatggcatccattatatc 445
                || |  || |||||||||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 23282954 agcattctcttgtctaccattgaccccatatttctccctctcaattgcatccataatatc 23283013

                             
Query: 446      ctcccgagccaca 458
                |||||||||||||
Sbjct: 23283014 ctcccgagccaca 23283026



to top

>dbj|AK064543.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-112-A09, full
           insert sequence
          Length = 2112

 Score =  184 bits (93), Expect = 2e-43
 Identities = 168/193 (87%)
 Strand = Plus / Minus

                                                                       
Query: 266 ctccagttagcttaacgtatgataccccataagtccttgaaaatcatctggatttgatgg 325
           ||||||||||||||| |||||||| ||||||| ||||  || ||||||||| |||| |||
Sbjct: 533 ctccagttagcttaatgtatgatatcccataactcctccaatatcatctgggtttgttgg 474

                                                                       
Query: 326 tttatttccagatttaggtaaccatggaaatagcttggtaaggccttctcttgcagaatc 385
           | ||||||||| |||||||||||||||||| |  || || |||||||  ||| |||||||
Sbjct: 473 tctatttccaggtttaggtaaccatggaaacaatttagtgaggccttgcctttcagaatc 414

                                                                       
Query: 386 aggacccttttgtctaccattgaccccatatttttccctctcaatggcatccattatatc 445
           || |  || |||||||||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 413 agcattctcttgtctaccattgaccccatatttctccctctcaattgcatccataatatc 354

                        
Query: 446 ctcccgagccaca 458
           |||||||||||||
Sbjct: 353 ctcccgagccaca 341



to top

>emb|AL606653.3|OSJN00104 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0048E02,
              complete sequence
          Length = 121337

 Score =  184 bits (93), Expect = 2e-43
 Identities = 168/193 (87%)
 Strand = Plus / Plus

                                                                          
Query: 266    ctccagttagcttaacgtatgataccccataagtccttgaaaatcatctggatttgatgg 325
              ||||||||||||||| |||||||| ||||||| ||||  || ||||||||| |||| |||
Sbjct: 120987 ctccagttagcttaatgtatgatatcccataactcctccaatatcatctgggtttgttgg 121046

                                                                          
Query: 326    tttatttccagatttaggtaaccatggaaatagcttggtaaggccttctcttgcagaatc 385
              | ||||||||| |||||||||||||||||| |  || || |||||||  ||| |||||||
Sbjct: 121047 tctatttccaggtttaggtaaccatggaaacaatttagtgaggccttgcctttcagaatc 121106

                                                                          
Query: 386    aggacccttttgtctaccattgaccccatatttttccctctcaatggcatccattatatc 445
              || |  || |||||||||||||||||||||||| ||||||||||| |||||||| |||||
Sbjct: 121107 agcattctcttgtctaccattgaccccatatttctccctctcaattgcatccataatatc 121166

                           
Query: 446    ctcccgagccaca 458
              |||||||||||||
Sbjct: 121167 ctcccgagccaca 121179



to top

>ref|XM_472796.1| Oryza sativa (japonica cultivar-group),  predicted mRNA
          Length = 1755

 Score =  172 bits (87), Expect = 6e-40
 Identities = 162/187 (86%)
 Strand = Plus / Minus

                                                                        
Query: 272  ttagcttaacgtatgataccccataagtccttgaaaatcatctggatttgatggtttatt 331
            ||||||||| |||||||| ||||||| ||||  || ||||||||| |||| |||| ||||
Sbjct: 1755 ttagcttaatgtatgatatcccataactcctccaatatcatctgggtttgttggtctatt 1696

                                                                        
Query: 332  tccagatttaggtaaccatggaaatagcttggtaaggccttctcttgcagaatcaggacc 391
            ||||| |||||||||||||||||| |  || || |||||||  ||| ||||||||| |  
Sbjct: 1695 tccaggtttaggtaaccatggaaacaatttagtgaggccttgcctttcagaatcagcatt 1636

                                                                        
Query: 392  cttttgtctaccattgaccccatatttttccctctcaatggcatccattatatcctcccg 451
            || |||||||||||||||||||||||| ||||||||||| |||||||| |||||||||||
Sbjct: 1635 ctcttgtctaccattgaccccatatttctccctctcaattgcatccataatatcctcccg 1576

                   
Query: 452  agccaca 458
            |||||||
Sbjct: 1575 agccaca 1569



to top

>emb|AL356753.16| Human DNA sequence from clone RP11-481G8 on chromosome 10 Contains the
              5'end of a novel gene containing FLJ40930, gene FLJ35875,
              the RAI17 gene for retinoic acid induced 17, a novel gene
              and two CpG islands, complete sequence
          Length = 183460

 Score = 44.1 bits (22), Expect = 0.40
 Identities = 25/26 (96%)
 Strand = Plus / Minus

                                        
Query: 350    tggaaatagcttggtaaggccttctc 375
              ||||||| ||||||||||||||||||
Sbjct: 151789 tggaaattgcttggtaaggccttctc 151764



to top

>dbj|AP002774.3| Homo sapiens genomic DNA, chromosome 11q clone:RP11-630P1, complete
              sequences
          Length = 143590

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 420    tccctctcaatggcatccatt 440
              |||||||||||||||||||||
Sbjct: 125316 tccctctcaatggcatccatt 125336



to top

>dbj|AP003125.2| Homo sapiens genomic DNA, chromosome 11q, clone:RP11-642E8, complete
             sequence
          Length = 180711

 Score = 42.1 bits (21), Expect = 1.6
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 420   tccctctcaatggcatccatt 440
             |||||||||||||||||||||
Sbjct: 13626 tccctctcaatggcatccatt 13646



to top

>emb|CR932322.1|CNS0KYLJ Paramecium tetraurelia macronuclear, putative gene for inositol
            1,4,5-triphosphate receptor n, isoform 2, complete gene
          Length = 9060

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 147  agatagacttgaattgtatatttt 170
            |||| |||||||||||||||||||
Sbjct: 1865 agatggacttgaattgtatatttt 1842



to top

>emb|CR956391.5| Pig DNA sequence from clone PigE-133M12 on chromosome 7, complete
             sequence
          Length = 168012

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 306   aaatcatctggatttgatgg 325
             ||||||||||||||||||||
Sbjct: 21974 aaatcatctggatttgatgg 21955



to top

>gb|AC164313.3| Mus musculus BAC clone RP23-24F12 from chromosome 3, complete sequence
          Length = 196368

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 231    agttgatgcttatctcttctgtgg 254
              ||||| ||||||||||||||||||
Sbjct: 191633 agttggtgcttatctcttctgtgg 191656



to top

>gb|AF539893.1| Acrocera orbicula carbamoyl-phosphate synthase gene, partial cds
          Length = 843

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 26/28 (92%)
 Strand = Plus / Plus

                                       
Query: 305 aaaatcatctggatttgatggtttattt 332
           |||||||| || ||||||||||||||||
Sbjct: 507 aaaatcatatgaatttgatggtttattt 534



to top

>emb|AL391065.6| Human DNA sequence from clone RP11-108M21 on chromosome 1 Contains part
              of a novel gene, complete sequence
          Length = 170639

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                  
Query: 290    ccccataagtccttgaaaat 309
              ||||||||||||||||||||
Sbjct: 149833 ccccataagtccttgaaaat 149814



to top

>emb|AL359198.37| Human DNA sequence from clone RP11-402D21 on chromosome 10 Contains a
              novel gene similar to brain-specific angiogenesis inhibitor
              3, the 5' end of the BTAF1 gene for BTAF1 RNA polymerase
              II, B-TFIID transcription factor-associated, 170kDa (Mot1
              homolog, S. cerevisiae) and a CpG island, complete sequence
          Length = 116342

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 82     tcaaaattcaccaaatggtgcacc 105
              ||||||||||||||||||| ||||
Sbjct: 110617 tcaaaattcaccaaatggtccacc 110594



to top

>emb|AL121582.19|HSBA280O9 Human DNA sequence from clone RP11-280O9 on chromosome 20 Contains part
             of the C20orf133 gene and the RNF11B gene for ring finger
             protein 11B pseudogene, complete sequence
          Length = 170908

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 416   tttttccctctcaatggcat 435
             ||||||||||||||||||||
Sbjct: 97710 tttttccctctcaatggcat 97729



to top

>emb|AL645810.5| Zebrafish DNA sequence from clone BUSM1-37K09 Contains the cntn2 gene
             (contactin 2), a transposase pseudogene and four CpG
             islands, complete sequence
          Length = 86708

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 412   catatttttccctctcaatg 431
             ||||||||||||||||||||
Sbjct: 36134 catatttttccctctcaatg 36115



to top

>gb|AC141561.5| Mus musculus BAC clone RP23-457C15 from chromosome 3, complete sequence
          Length = 169547

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                      
Query: 231    agttgatgcttatctcttctgtgg 254
              ||||| ||||||||||||||||||
Sbjct: 147239 agttggtgcttatctcttctgtgg 147262



to top

>gb|AC112251.5| Homo sapiens BAC clone RP11-734I18 from 4, complete sequence
          Length = 112537

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 304   gaaaatcatctggatttgat 323
             ||||||||||||||||||||
Sbjct: 39099 gaaaatcatctggatttgat 39080



to top

>gb|AC104447.2| Homo sapiens chromosome 3 clone RP11-447D11, complete sequence
          Length = 202544

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 103   accagtccactgccccactg 122
             ||||||||||||||||||||
Sbjct: 97886 accagtccactgccccactg 97905



to top

>gb|AC092598.2| Homo sapiens BAC clone RP11-114B11 from 2, complete sequence
          Length = 164798

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 368   gccttctcttgcagaatcag 387
             ||||||||||||||||||||
Sbjct: 60718 gccttctcttgcagaatcag 60737



to top

>gb|AC110994.8| Homo sapiens 3 BAC RP11-144C15 (Roswell Park Cancer Institute Human
            BAC Library) complete sequence
          Length = 65203

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                
Query: 422  cctctcaatggcatccatta 441
            ||||||||||||||||||||
Sbjct: 3689 cctctcaatggcatccatta 3670



to top

>dbj|BS000099.1| Pan troglodytes chromosome 22 clone:PTB-047E13, map 22, complete
              sequences
          Length = 231583

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 323    tggtttatttccagatttag 342
              ||||||||||||||||||||
Sbjct: 221943 tggtttatttccagatttag 221962



to top

>emb|CR931650.1| Streptococcus pneumoniae strain 423/82 (serotype 10b)
          Length = 16991

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 299   tccttgaaaatcatctggat 318
             ||||||||||||||||||||
Sbjct: 12590 tccttgaaaatcatctggat 12571



to top

>dbj|AP003050.4| Homo sapiens genomic DNA, chromosome 11 clone:RP11-410I24, complete
             sequence
          Length = 152715

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 414   tatttttccctctcaatggc 433
             ||||||||||||||||||||
Sbjct: 71256 tatttttccctctcaatggc 71237



to top

>gb|AC102211.23| Mus musculus chromosome 3, clone RP24-369F14, complete sequence
          Length = 142790

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                      
Query: 231    agttgatgcttatctcttctgtgg 254
              ||||| ||||||||||||||||||
Sbjct: 105588 agttggtgcttatctcttctgtgg 105565



to top

>emb|CR937009.1| uncultured archaeon fos0644c1
          Length = 39253

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 129   cagtgcagtctccttcacagatag 152
             |||||||||||| |||||||||||
Sbjct: 38970 cagtgcagtctcgttcacagatag 38993



to top

>emb|AL844210.7| Mouse DNA sequence from clone RP23-235I13 on chromosome X, complete
            sequence
          Length = 140246

 Score = 40.1 bits (20), Expect = 6.2
 Identities = 23/24 (95%)
 Strand = Plus / Minus

                                    
Query: 305  aaaatcatctggatttgatggttt 328
            ||||| ||||||||||||||||||
Sbjct: 4639 aaaattatctggatttgatggttt 4616


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 4,121,118
Number of Sequences: 3902068
Number of extensions: 4121118
Number of successful extensions: 75931
Number of sequences better than 10.0: 27
Number of HSP's better than 10.0 without gapping: 27
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 75870
Number of HSP's gapped (non-prelim): 61
length of query: 462
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 440
effective length of database: 17,147,199,772
effective search space: 7544767899680
effective search space used: 7544767899680
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top