ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
menu 
| Clone Name | rbasd24m11 |
|---|---|
| Clone Library Name | barley_pub |
>gb|AY525640.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;2 mRNA, complete cds Length = 853 Score = 870 bits (439), Expect = 0.0 Identities = 490/507 (96%) Strand = Plus / Minus Query: 168 ttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagac 227 |||||||||||||| |||||||| | |||||| |||||||||||||| |||||||||||| Sbjct: 801 ttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtacacgtaccggtagac 742 Query: 228 gatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 287 || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 741 gacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaa 682 Query: 288 gtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaa 347 ||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| Sbjct: 681 gtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggagaa 622 Query: 348 ggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggt 407 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 621 ggggccggcaacgaggatgttggcgccgacgatgaagccgatggcgatgggggcgatggt 562 Query: 408 gccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaa 467 ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 561 gccgagggaacccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaa 502 Query: 468 ggtgacgatgatctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgt 527 ||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||| Sbjct: 501 ggtgacgatgatctccatcacgacgccctcaaaggcgcccacgccggaaagcccgtgtgt 442 Query: 528 aggggtcgccacgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggag 587 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 441 aggggtcgccacgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggag 382 Query: 588 ctgcgcaacccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggcc 647 ||| |||||||| ||||||| ||||||||||||||||||||| |||||||| |||||||| Sbjct: 381 ctgggcaacccaatagaagatgccggtgaggatggtgatctggccgccgagggcgaggcc 322 Query: 648 gaaggtgacggcagggttcacgtggcc 674 ||||||||||||||||||||||||||| Sbjct: 321 gaaggtgacggcagggttcacgtggcc 295
>gb|U86763.1|TAU86763 Triticum aestivum delta-type tonoplast intrinsic protein mRNA, complete cds Length = 1067 Score = 870 bits (439), Expect = 0.0 Identities = 593/645 (91%), Gaps = 17/645 (2%) Strand = Plus / Minus Query: 37 gcttcgatctgaaccaaacaacatgacgttcttcacatcatcgagacattc-------tg 89 ||||||||||||||||||||||| || ||||||||||||||||| |||||| || Sbjct: 932 gcttcgatctgaaccaaacaacaggatgttcttcacatcatcgaaacattcgtgagactg 873 Query: 90 accaccacgcacgcacttttttatgttgccgaaggcatcatggaaaccaaacaccgaacg 149 |||||||| ||||||||||| |||||||||||||||| ||||| ||||||| Sbjct: 872 cccaccacgtacgcacttttt-atgttgccgaaggcattatgga---------ccgaacg 823 Query: 150 acccttcacatggatggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacat 209 || |||| ||||| |||||||||||||||||| |||||||||| |||||| ||| ||||| Sbjct: 822 actcttcccatggctggcttagtagtcgttgccggcgacggggctgtggtcgtcccacat 763 Query: 210 gtacaggtaccggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||| ||||| ||||| |||| ||||||||||||||||||||||||||||||||||||||| Sbjct: 762 gtataggtatcggtaaacgacgccggcgaggccaccgccgatgagcgggccggcccagta 703 Query: 270 gatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggtt 329 | ||| |||||||||||||||||||||||||||||||||||||| |||||||||||||| Sbjct: 702 aacccaaatgttggtgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggtt 643 Query: 330 catggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgat 389 |||||| |||||||| ||||||||||| |||||||||||||| ||||| ||||||||||| Sbjct: 642 catggacccgccggaaaaggggccggccacgaggatgttggcgccgacaatgaagccgat 583 Query: 390 ggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 449 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 582 ggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 523 Query: 450 ggtgtagacgagcccgaaggtgacgatgatctccatcaccacgccctcaaaagcgcccac 509 ||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||| Sbjct: 522 ggtgtagacgagcccgaaggtgacgatgatctccatcacgacgccctcaaaggcgcccac 463 Query: 510 gccggaaagcccgtgtgtaggggtcgccacgccggtgcagaactggacgaggaaggcgcc 569 |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| Sbjct: 462 gccggaaagcccgtgtgtaggggtggccacgccggtgcagaactggacgaggaaggcgcc 403 Query: 570 gacgatggcaccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgatctg 629 ||||||||| ||||||||||| |||||||||||||||| ||||||||||||||||||||| Sbjct: 402 gacgatggcgccgaggagctgggcaacccagtagaagatgccggtgaggatggtgatctg 343 Query: 630 accgccgagcgcgaggccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||||||||||||||||||||| ||||| Sbjct: 342 gccgccgagggcgaggccgaaggtgacggcagggttcacatggcc 298
>gb|AY525641.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;3 mRNA, complete cds Length = 829 Score = 850 bits (429), Expect = 0.0 Identities = 489/509 (96%) Strand = Plus / Minus Query: 166 gcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtag 225 |||||||||||||||| |||||||| |||||||| ||||||||||||||||||||||||| Sbjct: 800 gcttagtagtcgttgccggcgacggcggtgtggtcgtcgcacatgtacaggtaccggtag 741 Query: 226 acgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 285 |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 740 acgacgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtg 681 Query: 286 aagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggag 345 ||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||| Sbjct: 680 aagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccggag 621 Query: 346 aaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatg 405 ||||||||||| |||||||||||||| ||||||||||||||||||||||| || |||||| Sbjct: 620 aaggggccggcgacgaggatgttggcgccgacgatgaagccgatggcgattggagcgatg 561 Query: 406 gtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccg 465 ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 560 gtgccgagggaccccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccg 501 Query: 466 aaggtgacgatgatctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgt 525 ||||||||||||||||||||||| |||||||| || |||||||||||||||||||||||| Sbjct: 500 aaggtgacgatgatctccatcacgacgccctcgaaggcgcccacgccggaaagcccgtgt 441 Query: 526 gtaggggtcgccacgccggtgcagaactggacgaggaaggcgccgacgatggcaccgagg 585 ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| Sbjct: 440 gtaggggtcgccacgccggtgcagaactggacgaggaaggcgccgacgatggcgccgagg 381 Query: 586 agctgcgcaacccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgagg 645 ||||| |||||||||||||||| ||||||||||||||||||||| |||||||| |||||| Sbjct: 380 agctgggcaacccagtagaagatgccggtgaggatggtgatctggccgccgagggcgagg 321 Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 ||||||||||||||||||||||| ||||| Sbjct: 320 ccgaaggtgacggcagggttcacatggcc 292
>gb|AY525639.1| Triticum aestivum delta tonoplast intrinsic protein TIP2;1 mRNA, complete cds Length = 817 Score = 846 bits (427), Expect = 0.0 Identities = 490/511 (95%) Strand = Plus / Minus Query: 164 tggcttagtagtcgttgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggt 223 |||||||||||||||||| |||||||| | |||||| |||||||||||| ||||| |||| Sbjct: 806 tggcttagtagtcgttgccggcgacggagctgtggtcgtcgcacatgtataggtatcggt 747 Query: 224 agacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttgg 283 |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||| Sbjct: 746 agacgacgccggcgaggccaccgccgatgagcgggccggcccagtagacccagatgttgg 687 Query: 284 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccgg 343 ||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||| Sbjct: 686 tgaagtcgccgctggcaacggcggggccgaaggagcgtgcagggttcatggacccgccgg 627 Query: 344 agaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcga 403 ||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||| Sbjct: 626 agaaggggccggccacgaggatgttggcgccgacgatgaagccgatggcgatgggggcga 567 Query: 404 tggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcc 463 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 566 tggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcc 507 Query: 464 cgaaggtgacgatgatctccatcaccacgccctcaaaagcgcccacgccggaaagcccgt 523 ||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| Sbjct: 506 cgaaggtgacgatgatctccatcacgacgccctcaaaggcgcccacgccggaaagcccgt 447 Query: 524 gtgtaggggtcgccacgccggtgcagaactggacgaggaaggcgccgacgatggcaccga 583 |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||| Sbjct: 446 gtgtaggggtggccacgccggtgcagaactggacgaggaaggcgccgacgatggcgccga 387 Query: 584 ggagctgcgcaacccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcga 643 ||||||| |||||||||||||||| ||||||||||||||||||||| |||||||| |||| Sbjct: 386 ggagctgggcaacccagtagaagatgccggtgaggatggtgatctggccgccgagggcga 327 Query: 644 ggccgaaggtgacggcagggttcacgtggcc 674 ||||||||||||||||||||||||| ||||| Sbjct: 326 ggccgaaggtgacggcagggttcacatggcc 296
>dbj|AK104464.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-301-C06, full insert sequence Length = 1194 Score = 666 bits (336), Expect = 0.0 Identities = 456/496 (91%) Strand = Plus / Minus Query: 179 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 238 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 825 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 766 Query: 239 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 298 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 765 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 706 Query: 299 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 358 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 705 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 646 Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 645 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 586 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 478 ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| Sbjct: 585 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 526 Query: 479 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 538 ||||||||||||||||||| || |||||||||||||| |||||||| || || ||||||| Sbjct: 525 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 466 Query: 539 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 598 |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | || Sbjct: 465 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 406 Query: 599 agtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgacgg 658 ||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||| Sbjct: 405 agtagaagacgccggtgaggatggtgatctggccgccgagggcgaggccgaaggtgacgg 346 Query: 659 cagggttcacgtggcc 674 | ||||| |||||||| Sbjct: 345 ccgggttgacgtggcc 330
>dbj|AK104270.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-311-F03, full insert sequence Length = 1214 Score = 666 bits (336), Expect = 0.0 Identities = 456/496 (91%) Strand = Plus / Minus Query: 179 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 238 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768 Query: 239 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 298 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708 Query: 299 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 358 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 707 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648 Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 588 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 478 ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| Sbjct: 587 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 528 Query: 479 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 538 ||||||||||||||||||| || |||||||||||||| |||||||| || || ||||||| Sbjct: 527 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 468 Query: 539 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 598 |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | || Sbjct: 467 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 408 Query: 599 agtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgacgg 658 ||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||| Sbjct: 407 agtagaagacgccggtgaggatggtgatctggccgccgagggcgaggccgaaggtgacgg 348 Query: 659 cagggttcacgtggcc 674 | ||||| |||||||| Sbjct: 347 ccgggttgacgtggcc 332
>dbj|AK099616.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013050J20, full insert sequence Length = 1197 Score = 666 bits (336), Expect = 0.0 Identities = 456/496 (91%) Strand = Plus / Minus Query: 179 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 238 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769 Query: 239 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 298 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709 Query: 299 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 358 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649 Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 589 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 478 ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| Sbjct: 588 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 529 Query: 479 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 538 ||||||||||||||||||| || |||||||||||||| |||||||| || || ||||||| Sbjct: 528 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 469 Query: 539 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 598 |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | || Sbjct: 468 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 409 Query: 599 agtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgacgg 658 ||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||| Sbjct: 408 agtagaagacgccggtgaggatggtgatctggccgccgagggcgaggccgaaggtgacgg 349 Query: 659 cagggttcacgtggcc 674 | ||||| |||||||| Sbjct: 348 ccgggttgacgtggcc 333
>dbj|AK099141.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023055A02, full insert sequence Length = 1195 Score = 666 bits (336), Expect = 0.0 Identities = 456/496 (91%) Strand = Plus / Minus Query: 179 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 238 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767 Query: 239 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 298 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707 Query: 299 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 358 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647 Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 587 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 478 ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| Sbjct: 586 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 527 Query: 479 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 538 ||||||||||||||||||| || |||||||||||||| |||||||| || || ||||||| Sbjct: 526 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 467 Query: 539 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 598 |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | || Sbjct: 466 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 407 Query: 599 agtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgacgg 658 ||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||| Sbjct: 406 agtagaagacgccggtgaggatggtgatctggccgccgagggcgaggccgaaggtgacgg 347 Query: 659 cagggttcacgtggcc 674 | ||||| |||||||| Sbjct: 346 ccgggttgacgtggcc 331
>dbj|AK099015.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013116H02, full insert sequence Length = 1202 Score = 666 bits (336), Expect = 0.0 Identities = 456/496 (91%) Strand = Plus / Minus Query: 179 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 238 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 828 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 769 Query: 239 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 298 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 768 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 709 Query: 299 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 358 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 708 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 649 Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 648 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 589 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 478 ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| Sbjct: 588 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 529 Query: 479 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 538 ||||||||||||||||||| || |||||||||||||| |||||||| || || ||||||| Sbjct: 528 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 469 Query: 539 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 598 |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | || Sbjct: 468 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 409 Query: 599 agtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgacgg 658 ||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||| Sbjct: 408 agtagaagacgccggtgaggatggtgatctggccgccgagggcgaggccgaaggtgacgg 349 Query: 659 cagggttcacgtggcc 674 | ||||| |||||||| Sbjct: 348 ccgggttgacgtggcc 333
>dbj|AK073531.1| Oryza sativa (japonica cultivar-group) cDNA clone:J033044F19, full insert sequence Length = 1220 Score = 666 bits (336), Expect = 0.0 Identities = 456/496 (91%) Strand = Plus / Minus Query: 179 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 238 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 826 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 767 Query: 239 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 298 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 766 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 707 Query: 299 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 358 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 706 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 647 Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 646 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 587 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 478 ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| Sbjct: 586 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 527 Query: 479 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 538 ||||||||||||||||||| || |||||||||||||| |||||||| || || ||||||| Sbjct: 526 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 467 Query: 539 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 598 |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | || Sbjct: 466 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 407 Query: 599 agtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgacgg 658 ||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||| Sbjct: 406 agtagaagacgccggtgaggatggtgatctggccgccgagggcgaggccgaaggtgacgg 347 Query: 659 cagggttcacgtggcc 674 | ||||| |||||||| Sbjct: 346 ccgggttgacgtggcc 331
>dbj|AK104377.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-035-G09, full insert sequence Length = 1196 Score = 658 bits (332), Expect = 0.0 Identities = 455/496 (91%) Strand = Plus / Minus Query: 179 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 238 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 827 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 768 Query: 239 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 298 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 767 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 708 Query: 299 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 358 | |||||||| ||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 707 cgacggcgggaccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 648 Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 647 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 588 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 478 ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| Sbjct: 587 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 528 Query: 479 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 538 ||||||||||||||||||| || |||||||||||||| |||||||| || || ||||||| Sbjct: 527 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 468 Query: 539 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 598 |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | || Sbjct: 467 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 408 Query: 599 agtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgacgg 658 ||||||||| ||||||||||||||||||||| |||||||| ||||||||||||||||||| Sbjct: 407 agtagaagacgccggtgaggatggtgatctggccgccgagggcgaggccgaaggtgacgg 348 Query: 659 cagggttcacgtggcc 674 | ||||| |||||||| Sbjct: 347 ccgggttgacgtggcc 332
>dbj|AK100193.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023036J06, full insert sequence Length = 1074 Score = 601 bits (303), Expect = e-168 Identities = 414/451 (91%) Strand = Plus / Minus Query: 179 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 238 ||||||| ||||||| ||||| | |||||||||| | ||| |||||||||| |||||||| Sbjct: 705 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaacggtagacgaggccggcga 646 Query: 239 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 298 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 645 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 586 Query: 299 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 358 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 585 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 526 Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 525 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 466 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 478 ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| Sbjct: 465 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 406 Query: 479 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcca 538 ||||||||||||||||||| || |||||||||||||| |||||||| || || ||||||| Sbjct: 405 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcca 346 Query: 539 cgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaaccc 598 |||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | || Sbjct: 345 cgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcgatcc 286 Query: 599 agtagaagaggccggtgaggatggtgatctg 629 ||||||||| ||||||||||||||||||||| Sbjct: 285 agtagaagacgccggtgaggatggtgatctg 255
>dbj|AP008212.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, complete sequence Length = 30731886 Score = 474 bits (239), Expect = e-130 Identities = 329/359 (91%) Strand = Plus / Minus Query: 179 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 238 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 13251125 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 13251066 Query: 239 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 298 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 13251065 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 13251006 Query: 299 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 358 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 13251005 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 13250946 Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 13250945 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 13250886 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 478 ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| Sbjct: 13250885 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 13250826 Query: 479 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcc 537 ||||||||||||||||||| || |||||||||||||| |||||||| || || |||||| Sbjct: 13250825 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcc 13250767 Score = 196 bits (99), Expect = 7e-47 Identities = 129/139 (92%) Strand = Plus / Minus Query: 536 ccacgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaa 595 ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | Sbjct: 13250666 ccacgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcga 13250607 Query: 596 cccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtga 655 ||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||| Sbjct: 13250606 tccagtagaagacgccggtgaggatggtgatctggccgccgagggcgaggccgaaggtga 13250547 Query: 656 cggcagggttcacgtggcc 674 |||| ||||| |||||||| Sbjct: 13250546 cggccgggttgacgtggcc 13250528
>dbj|AP005449.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, PAC clone:P0427E01 Length = 146395 Score = 474 bits (239), Expect = e-130 Identities = 329/359 (91%) Strand = Plus / Minus Query: 179 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 238 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 12935 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 12876 Query: 239 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 298 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 12875 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 12816 Query: 299 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 358 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 12815 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 12756 Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 12755 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 12696 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 478 ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| Sbjct: 12695 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 12636 Query: 479 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcc 537 ||||||||||||||||||| || |||||||||||||| |||||||| || || |||||| Sbjct: 12635 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcc 12577 Score = 196 bits (99), Expect = 7e-47 Identities = 129/139 (92%) Strand = Plus / Minus Query: 536 ccacgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaa 595 ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | Sbjct: 12476 ccacgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcga 12417 Query: 596 cccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtga 655 ||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||| Sbjct: 12416 tccagtagaagacgccggtgaggatggtgatctggccgccgagggcgaggccgaaggtga 12357 Query: 656 cggcagggttcacgtggcc 674 |||| ||||| |||||||| Sbjct: 12356 cggccgggttgacgtggcc 12338
>dbj|AP004784.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 6, BAC clone:OSJNBa0012F14 Length = 168629 Score = 474 bits (239), Expect = e-130 Identities = 329/359 (91%) Strand = Plus / Minus Query: 179 tgctggcgacgggggtgtggttgtcgcacatgtacaggtaccggtagacgatgccggcga 238 ||||||| ||||||| ||||| | |||||||||| | |||||||||||||| |||||||| Sbjct: 168313 tgctggcaacgggggcgtggtcgccgcacatgtagacgtaccggtagacgaggccggcga 168254 Query: 239 ggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctgg 298 |||| ||||||| ||| |||||| ||||||||||||||||||||||| |||||||||||| Sbjct: 168253 ggccgccgccgacgagggggccgacccagtagatccagatgttggtgtagtcgccgctgg 168194 Query: 299 caacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaa 358 | |||||||||||||| ||||| || ||||||||||| |||||||||||||||||||| | Sbjct: 168193 cgacggcggggccgaaggagcgcgccgggttcatggagccgccggagaaggggccggcga 168134 Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| |||||||||||||||||||||||||| |||||||||||||| || | Sbjct: 168133 cgaggatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgccgagcgacc 168074 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 478 ||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||| Sbjct: 168073 ccttcttggggtcggcggcggtggcgtacacggtgtacaccagcccgaaggtgacgatga 168014 Query: 479 tctccatcaccacgccctcaaaagcgcccacgccggaaagcccgtgtgtaggggtcgcc 537 ||||||||||||||||||| || |||||||||||||| |||||||| || || |||||| Sbjct: 168013 tctccatcaccacgccctcgaacgcgcccacgccggacagcccgtgcgtcggtgtcgcc 167955 Score = 196 bits (99), Expect = 7e-47 Identities = 129/139 (92%) Strand = Plus / Minus Query: 536 ccacgccggtgcagaactggacgaggaaggcgccgacgatggcaccgaggagctgcgcaa 595 ||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| || | Sbjct: 167854 ccacgccggtgcagaactggacgaggacggcgccgacgatggcgccgaggagctgggcga 167795 Query: 596 cccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtga 655 ||||||||||| ||||||||||||||||||||| |||||||| |||||||||||||||| Sbjct: 167794 tccagtagaagacgccggtgaggatggtgatctggccgccgagggcgaggccgaaggtga 167735 Query: 656 cggcagggttcacgtggcc 674 |||| ||||| |||||||| Sbjct: 167734 cggccgggttgacgtggcc 167716
>gb|AF326502.1|AF326502 Zea mays tonoplast membrane integral protein ZmTIP2-2 mRNA, complete cds Length = 1073 Score = 280 bits (141), Expect = 6e-72 Identities = 245/277 (88%), Gaps = 2/277 (0%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 281 |||||||| ||| ||||| || |||||||||||||||||| ||||||||| |||| || Sbjct: 763 gtagacgaggccagcgagtccgccgccgatgagcgggccgacccagtagacccagttgcc 704 Query: 282 ggtgaagtcg-ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgc 340 || ||||||| |||| ||| |||||||||||||| ||||| || ||||||||||| |||| Sbjct: 703 ggcgaagtcggccgc-ggcgacggcggggccgaaggagcgggcggggttcatggagccgc 645 Query: 341 cggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatggggg 400 || |||||| || || ||||||||||||| |||||||||||||||||||||||||| | Sbjct: 644 cgctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcg 585 Query: 401 cgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacga 460 |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| Sbjct: 584 cgatggtgccgagggagcccttcttggggtcggcggcggtggcgtacacggtgtagacga 525 Query: 461 gcccgaaggtgacgatgatctccatcaccacgccctc 497 || ||||||||| || |||||| | ||| |||||||| Sbjct: 524 gcgcgaaggtgatgacgatctcgaacacgacgccctc 488 Score = 73.8 bits (37), Expect = 7e-10 Identities = 76/89 (85%) Strand = Plus / Minus Query: 586 agctgcgcaacccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgagg 645 ||||| || ||||||||||||||||||||||||| |||||| || ||||| | || ||| Sbjct: 393 agctgggccacccagtagaagaggccggtgaggacggtgatgtggccgcccacggccagg 334 Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 ||||| || ||||| ||||||| |||||| Sbjct: 333 ccgaacgtcacggcggggttcaggtggcc 305
>gb|AF326501.1|AF326501 Zea mays tonoplast membrane integral protein ZmTIP2-1 mRNA, complete cds Length = 1110 Score = 260 bits (131), Expect = 5e-66 Identities = 221/251 (88%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 281 |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| | Sbjct: 920 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 861 Query: 282 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 341 || ||||||||| ||| |||||||||||||| ||||| || ||||||||||| ||||| Sbjct: 860 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 801 Query: 342 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 401 | |||||| || || ||||||||||||| |||||||||||||||||||||||||| || Sbjct: 800 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 741 Query: 402 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgag 461 |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 740 gatggtgccgagcgagcccttcttggggtcggcggcggtggcgtacacggtgtagacgag 681 Query: 462 cccgaaggtga 472 | ||||||||| Sbjct: 680 cgcgaaggtga 670 Score = 50.1 bits (25), Expect = 0.010 Identities = 73/89 (82%) Strand = Plus / Minus Query: 586 agctgcgcaacccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgagg 645 ||||| || ||||||||||||| ||| || ||||||||||| || ||||| | || || Sbjct: 553 agctgggccacccagtagaagacgcccgtcaggatggtgatgtggccgcccacggccagc 494 Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 ||||| || ||||| ||||||| |||||| Sbjct: 493 ccgaacgtcacggccgggttcaggtggcc 465
>gb|AY105015.1| Zea mays PCO137646 mRNA sequence Length = 1238 Score = 260 bits (131), Expect = 5e-66 Identities = 221/251 (88%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 281 |||||||| ||| |||||||| ||||||| |||||||||| ||||||||| |||| | Sbjct: 919 gtagacgaggccagcgaggccgccgccgacgagcgggccgacccagtagacccagtttcc 860 Query: 282 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 341 || ||||||||| ||| |||||||||||||| ||||| || ||||||||||| ||||| Sbjct: 859 ggcgaagtcgcccgcggcgacggcggggccgaaggagcgggcggggttcatggagccgcc 800 Query: 342 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 401 | |||||| || || ||||||||||||| |||||||||||||||||||||||||| || Sbjct: 799 gctgaagggccccgcggcgaggatgttggcgccgacgatgaagccgatggcgatgggcgc 740 Query: 402 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgag 461 |||||||||||| || |||||||||||||||||||||||||||||||||||||||||||| Sbjct: 739 gatggtgccgagcgagcccttcttggggtcggcggcggtggcgtacacggtgtagacgag 680 Query: 462 cccgaaggtga 472 | ||||||||| Sbjct: 679 cgcgaaggtga 669 Score = 50.1 bits (25), Expect = 0.010 Identities = 73/89 (82%) Strand = Plus / Minus Query: 586 agctgcgcaacccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgagg 645 ||||| || ||||||||||||| ||| || ||||||||||| || ||||| | || || Sbjct: 552 agctgggccacccagtagaagacgcccgtcaggatggtgatgtggccgcccacggccagc 493 Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 ||||| || ||||| ||||||| |||||| Sbjct: 492 ccgaacgtcacggccgggttcaggtggcc 464
>gb|AF057183.1|AF057183 Zea mays putative tonoplast aquaporin mRNA, complete cds Length = 1060 Score = 230 bits (116), Expect = 5e-57 Identities = 224/260 (86%) Strand = Plus / Minus Query: 238 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 297 ||||||||||||| ||| |||||| ||||||| | |||| || || ||||| |||| Sbjct: 739 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 680 Query: 298 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 357 || |||||||||||||| ||||| || ||||||||||| |||||| |||||||||||| Sbjct: 679 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 620 Query: 358 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 417 | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| Sbjct: 619 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 560 Query: 418 cccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatg 477 |||||||| |||||||| |||||||||||||||||||| || ||| ||||||||| | | Sbjct: 559 cccttcttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacg 500 Query: 478 atctccatcaccacgccctc 497 |||||||||||||||||||| Sbjct: 499 atctccatcaccacgccctc 480 Score = 109 bits (55), Expect = 1e-20 Identities = 85/95 (89%) Strand = Plus / Minus Query: 580 ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgatctgaccgccgagc 639 ||||| ||||| ||||||||||||| || |||||||||||||||||| || ||||||| Sbjct: 394 ccgagaagctgggcaacccagtagaggatgccggtgaggatggtgatgtggccgccgacg 335 Query: 640 gcgaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||||| ||||||| |||||| Sbjct: 334 gcgaggccgaaggtgacggcggggttcaggtggcc 300
>ref|XM_467137.1| Oryza sativa (japonica cultivar-group), mRNA Length = 747 Score = 226 bits (114), Expect = 7e-56 Identities = 228/266 (85%) Strand = Plus / Minus Query: 232 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 291 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 683 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 624 Query: 292 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 351 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 623 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 564 Query: 352 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 411 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 563 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 504 Query: 412 agggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtg 471 || ||||||||||| ||||| || || ||||||||||| ||||| || ||| |||| ||| Sbjct: 503 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtg 444 Query: 472 acgatgatctccatcaccacgccctc 497 | || |||||||||||| |||||||| Sbjct: 443 atgacgatctccatcacgacgccctc 418 Score = 75.8 bits (38), Expect = 2e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 597 ccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgac 656 |||||||||||| ||||||||||||||||| || ||||||| ||||||||||| || || Sbjct: 315 ccagtagaagagtccggtgaggatggtgatgtggccgccgacggcgaggccgaacgtcac 256 Query: 657 ggcagggttcacgtggcc 674 ||| ||||| | |||||| Sbjct: 255 ggccgggttaaggtggcc 238
>dbj|AP008208.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, complete sequence Length = 35954743 Score = 226 bits (114), Expect = 7e-56 Identities = 228/266 (85%) Strand = Plus / Plus Query: 232 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 291 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 26627183 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 26627242 Query: 292 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 351 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 26627243 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 26627302 Query: 352 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 411 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 26627303 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 26627362 Query: 412 agggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtg 471 || ||||||||||| ||||| || || ||||||||||| ||||| || ||| |||| ||| Sbjct: 26627363 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtg 26627422 Query: 472 acgatgatctccatcaccacgccctc 497 | || |||||||||||| |||||||| Sbjct: 26627423 atgacgatctccatcacgacgccctc 26627448 Score = 75.8 bits (38), Expect = 2e-10 Identities = 68/78 (87%) Strand = Plus / Plus Query: 597 ccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgac 656 |||||||||||| ||||||||||||||||| || ||||||| ||||||||||| || || Sbjct: 26627669 ccagtagaagagtccggtgaggatggtgatgtggccgccgacggcgaggccgaacgtcac 26627728 Query: 657 ggcagggttcacgtggcc 674 ||| ||||| | |||||| Sbjct: 26627729 ggccgggttaaggtggcc 26627746 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctcc 483 ||||||||||||||| |||||||| ||||||||||| Sbjct: 25182111 acggtgtagacgagcacgaaggtgccgatgatctcc 25182076
>dbj|AP005006.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, PAC clone:P0519E06 Length = 170634 Score = 226 bits (114), Expect = 7e-56 Identities = 228/266 (85%) Strand = Plus / Plus Query: 232 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 291 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 169564 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 169623 Query: 292 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 351 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 169624 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 169683 Query: 352 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 411 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 169684 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 169743 Query: 412 agggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtg 471 || ||||||||||| ||||| || || ||||||||||| ||||| || ||| |||| ||| Sbjct: 169744 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtg 169803 Query: 472 acgatgatctccatcaccacgccctc 497 | || |||||||||||| |||||||| Sbjct: 169804 atgacgatctccatcacgacgccctc 169829 Score = 75.8 bits (38), Expect = 2e-10 Identities = 68/78 (87%) Strand = Plus / Plus Query: 597 ccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgac 656 |||||||||||| ||||||||||||||||| || ||||||| ||||||||||| || || Sbjct: 170050 ccagtagaagagtccggtgaggatggtgatgtggccgccgacggcgaggccgaacgtcac 170109 Query: 657 ggcagggttcacgtggcc 674 ||| ||||| | |||||| Sbjct: 170110 ggccgggttaaggtggcc 170127
>dbj|AP005289.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:OJ1112_F09 Length = 139371 Score = 226 bits (114), Expect = 7e-56 Identities = 228/266 (85%) Strand = Plus / Plus Query: 232 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 291 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 61344 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 61403 Query: 292 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 351 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 61404 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 61463 Query: 352 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 411 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 61464 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 61523 Query: 412 agggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtg 471 || ||||||||||| ||||| || || ||||||||||| ||||| || ||| |||| ||| Sbjct: 61524 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtg 61583 Query: 472 acgatgatctccatcaccacgccctc 497 | || |||||||||||| |||||||| Sbjct: 61584 atgacgatctccatcacgacgccctc 61609 Score = 75.8 bits (38), Expect = 2e-10 Identities = 68/78 (87%) Strand = Plus / Plus Query: 597 ccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgac 656 |||||||||||| ||||||||||||||||| || ||||||| ||||||||||| || || Sbjct: 61830 ccagtagaagagtccggtgaggatggtgatgtggccgccgacggcgaggccgaacgtcac 61889 Query: 657 ggcagggttcacgtggcc 674 ||| ||||| | |||||| Sbjct: 61890 ggccgggttaaggtggcc 61907
>dbj|AB114830.1| Oryza sativa (japonica cultivar-group) OsTIP2 mRNA for tonoplast intrinsic protein, complete cds Length = 1013 Score = 226 bits (114), Expect = 7e-56 Identities = 228/266 (85%) Strand = Plus / Minus Query: 232 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 291 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 756 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 697 Query: 292 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 351 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 696 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 637 Query: 352 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 411 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 636 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 577 Query: 412 agggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtg 471 || ||||||||||| ||||| || || ||||||||||| ||||| || ||| |||| ||| Sbjct: 576 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtg 517 Query: 472 acgatgatctccatcaccacgccctc 497 | || |||||||||||| |||||||| Sbjct: 516 atgacgatctccatcacgacgccctc 491 Score = 75.8 bits (38), Expect = 2e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 597 ccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgac 656 |||||||||||| ||||||||||||||||| || ||||||| ||||||||||| || || Sbjct: 388 ccagtagaagagtccggtgaggatggtgatgtggccgccgacggcgaggccgaacgtcac 329 Query: 657 ggcagggttcacgtggcc 674 ||| ||||| | |||||| Sbjct: 328 ggccgggttaaggtggcc 311
>dbj|AK064728.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-120-A10, full insert sequence Length = 873 Score = 226 bits (114), Expect = 7e-56 Identities = 228/266 (85%) Strand = Plus / Minus Query: 232 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 291 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 558 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 499 Query: 292 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 351 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 498 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 439 Query: 352 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 411 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 438 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 379 Query: 412 agggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtg 471 || ||||||||||| ||||| || || ||||||||||| ||||| || ||| |||| ||| Sbjct: 378 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtg 319 Query: 472 acgatgatctccatcaccacgccctc 497 | || |||||||||||| |||||||| Sbjct: 318 atgacgatctccatcacgacgccctc 293 Score = 75.8 bits (38), Expect = 2e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 597 ccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgac 656 |||||||||||| ||||||||||||||||| || ||||||| ||||||||||| || || Sbjct: 190 ccagtagaagagtccggtgaggatggtgatgtggccgccgacggcgaggccgaacgtcac 131 Query: 657 ggcagggttcacgtggcc 674 ||| ||||| | |||||| Sbjct: 130 ggccgggttaaggtggcc 113
>emb|AJ307662.1|OSA307662 Oryza sativa genomic DNA fragment, chromosome 2 Length = 339972 Score = 226 bits (114), Expect = 7e-56 Identities = 228/266 (85%) Strand = Plus / Minus Query: 232 ccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcg 291 ||||||||||| |||||||| ||||||||| ||||||||| |||| || | ||||| | Sbjct: 250651 ccggcgaggccgccgccgatcagcgggccgacccagtagacccagttgccagcgaagttg 250592 Query: 292 ccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaagggg 351 ||| ||| |||||||||||||| ||||| || ||||||||||| |||||| ||| ||| Sbjct: 250591 ccggcggcgacggcggggccgaaggagcgcgctgggttcatggagccgccgctgaacggg 250532 Query: 352 ccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccg 411 ||||| ||||||||||||| ||||||||||||||||| |||||||| |||||||||||| Sbjct: 250531 ccggcggcgaggatgttggcgccgacgatgaagccgatcgcgatgggcgcgatggtgccg 250472 Query: 412 agggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtg 471 || ||||||||||| ||||| || || ||||||||||| ||||| || ||| |||| ||| Sbjct: 250471 agcgatcccttcttcgggtccgccgccgtggcgtacaccgtgtacaccagcgcgaacgtg 250412 Query: 472 acgatgatctccatcaccacgccctc 497 | || |||||||||||| |||||||| Sbjct: 250411 atgacgatctccatcacgacgccctc 250386 Score = 159 bits (80), Expect = 1e-35 Identities = 146/168 (86%) Strand = Plus / Plus Query: 330 catggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgat 389 |||||| |||||| ||| |||||||| ||||||||||||| ||||||||||||||||| Sbjct: 332095 catggagccgccgctgaacgggccggcggcgaggatgttggcgccgacgatgaagccgat 332154 Query: 390 ggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacac 449 |||||||| |||||||||||||| ||||||||||| ||||| || || ||||||||||| Sbjct: 332155 cgcgatgggcgcgatggtgccgagcgatcccttcttcgggtccgccgccgtggcgtacac 332214 Query: 450 ggtgtagacgagcccgaaggtgacgatgatctccatcaccacgccctc 497 ||||| || ||| |||| |||| || |||||||||||| |||||||| Sbjct: 332215 cgtgtacaccagcgcgaacgtgatgacgatctccatcacgacgccctc 332262 Score = 75.8 bits (38), Expect = 2e-10 Identities = 68/78 (87%) Strand = Plus / Plus Query: 597 ccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgac 656 |||||||||||| ||||||||||||||||| || ||||||| ||||||||||| || || Sbjct: 332483 ccagtagaagagtccggtgaggatggtgatgtggccgccgacggcgaggccgaacgtcac 332542 Query: 657 ggcagggttcacgtggcc 674 ||| ||||| | |||||| Sbjct: 332543 ggccgggttaaggtggcc 332560 Score = 75.8 bits (38), Expect = 2e-10 Identities = 68/78 (87%) Strand = Plus / Minus Query: 597 ccagtagaagaggccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgac 656 |||||||||||| ||||||||||||||||| || ||||||| ||||||||||| || || Sbjct: 250165 ccagtagaagagtccggtgaggatggtgatgtggccgccgacggcgaggccgaacgtcac 250106 Query: 657 ggcagggttcacgtggcc 674 ||| ||||| | |||||| Sbjct: 250105 ggccgggttaaggtggcc 250088
>gb|AY243804.1| Zea mays tonoplast water channel mRNA, complete cds Length = 968 Score = 222 bits (112), Expect = 1e-54 Identities = 223/260 (85%) Strand = Plus / Minus Query: 238 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 297 ||||||||||||| ||| |||||| ||||||| | |||| || || ||||| ||| Sbjct: 680 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 621 Query: 298 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 357 || |||||||||||||| ||||| || ||||||||||| |||||| |||||||||||| Sbjct: 620 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 561 Query: 358 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 417 | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| Sbjct: 560 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 501 Query: 418 cccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatg 477 |||||||| |||||||| |||||||||||||||||||| || ||| ||||||||| | | Sbjct: 500 cccttcttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacg 441 Query: 478 atctccatcaccacgccctc 497 |||||||||||||||||||| Sbjct: 440 atctccatcaccacgccctc 421 Score = 109 bits (55), Expect = 1e-20 Identities = 85/95 (89%) Strand = Plus / Minus Query: 580 ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgatctgaccgccgagc 639 ||||| ||||| ||||||||||||| || |||||||||||||||||| || ||||||| Sbjct: 335 ccgagaagctgggcaacccagtagaggatgccggtgaggatggtgatgtggccgccgacg 276 Query: 640 gcgaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||||| ||||||| |||||| Sbjct: 275 gcgaggccgaaggtgacggcggggttcaggtggcc 241
>gb|AF326503.1|AF326503 Zea mays tonoplast membrane integral protein ZmTIP2-3 mRNA, complete cds Length = 1042 Score = 222 bits (112), Expect = 1e-54 Identities = 223/260 (85%) Strand = Plus / Minus Query: 238 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 297 ||||||||||||| ||| |||||| ||||||| | |||| || || ||||| ||| Sbjct: 748 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttaccggcc 689 Query: 298 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 357 || |||||||||||||| ||||| || ||||||||||| |||||| |||||||||||| Sbjct: 688 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 629 Query: 358 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 417 | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| Sbjct: 628 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 569 Query: 418 cccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatg 477 |||||||| |||||||| |||||||||||||||||||| || ||| ||||||||| | | Sbjct: 568 cccttcttcgggtcggccgcggtggcgtacacggtgtacaccagcgcgaaggtgatcacg 509 Query: 478 atctccatcaccacgccctc 497 |||||||||||||||||||| Sbjct: 508 atctccatcaccacgccctc 489 Score = 109 bits (55), Expect = 1e-20 Identities = 85/95 (89%) Strand = Plus / Minus Query: 580 ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgatctgaccgccgagc 639 ||||| ||||| ||||||||||||| || |||||||||||||||||| || ||||||| Sbjct: 403 ccgagaagctgggcaacccagtagaggatgccggtgaggatggtgatgtggccgccgacg 344 Query: 640 gcgaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||||| ||||||| |||||| Sbjct: 343 gcgaggccgaaggtgacggcggggttcaggtggcc 309
>gb|AY106931.1| Zea mays PCO140073 mRNA sequence Length = 1069 Score = 222 bits (112), Expect = 1e-54 Identities = 223/260 (85%) Strand = Plus / Minus Query: 238 aggccaccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctg 297 ||||||||||||| ||| |||||| ||||||| | |||| || || ||||| |||| Sbjct: 757 aggccaccgccgacgagggggccgacccagtacacccagttgccggcgaagttgccggcc 698 Query: 298 gcaacggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggca 357 || |||||||||||||| ||||| || ||||||||||| |||||| |||||||||||| Sbjct: 697 gccacggcggggccgaaggagcgggccgggttcatggagccgccgctgaaggggccggcg 638 Query: 358 acgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggat 417 | ||||||||||| |||||||||||||||||||| ||||| ||||||||||| ||||| Sbjct: 637 gccaggatgttggcgccgacgatgaagccgatggccatgggcgcgatggtgcccagggac 578 Query: 418 cccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatg 477 |||||||| |||||||| |||||||||||||||||||| || || ||||||||| | | Sbjct: 577 cccttcttcgggtcggccgcggtggcgtacacggtgtacaccagagcgaaggtgatcacg 518 Query: 478 atctccatcaccacgccctc 497 |||||||||||||||||||| Sbjct: 517 atctccatcaccacgccctc 498 Score = 109 bits (55), Expect = 1e-20 Identities = 85/95 (89%) Strand = Plus / Minus Query: 580 ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgatctgaccgccgagc 639 ||||| ||||| ||||||||||||| || |||||||||||||||||| || ||||||| Sbjct: 412 ccgagaagctgggcaacccagtagaggatgccggtgaggatggtgatgtggccgccgacg 353 Query: 640 gcgaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||||| ||||||| |||||| Sbjct: 352 gcgaggccgaaggtgacggcggggttcaggtggcc 318
>emb|AJ005078.2|PAAJ5078 Picea abies mRNA for aquaporin-like protein Length = 1007 Score = 194 bits (98), Expect = 3e-46 Identities = 233/278 (83%) Strand = Plus / Minus Query: 220 cggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatg 279 ||||||||||| ||||| ||||| || |||||||| |||||| ||||||| | |||| || Sbjct: 775 cggtagacgataccggcaaggccgcctccgatgagggggccgacccagtacacccagttg 716 Query: 280 ttggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccg 339 | ||||||||| ||||| |||| || ||| |||| ||||| || ||||||||||| ||| Sbjct: 715 tcggtgaagtctccgctcacaacagcagggtcgaaggagcgggcggggttcatggagccg 656 Query: 340 ccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggg 399 || ||||||||||| || | | ||||||||| || ||||||||||| || || ||||| Sbjct: 655 ccagagaaggggcccgcggccaagatgttggcgcccacgatgaagccaatagcaatggga 596 Query: 400 gcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacg 459 ||||||||||| ||| |||||||| |||||||| ||||||||||| |||||||||| | Sbjct: 595 gcgatggtgcccaggtcgcccttcttcgggtcggctgcggtggcgtagacggtgtagatg 536 Query: 460 agcccgaaggtgacgatgatctccatcaccacgccctc 497 ||| |||| |||| | ||||||||||||||||||||| Sbjct: 535 agcgcgaatgtgataacgatctccatcaccacgccctc 498
>gb|AF254799.1|AF254799 Hordeum vulgare tonoplast intrinsic protein 1 (TIP1), tonoplast intrinsic protein 2 (TIP2), and Rar1 (Rar1) genes, complete cds Length = 65979 Score = 184 bits (93), Expect = 3e-43 Identities = 171/197 (86%) Strand = Plus / Minus Query: 301 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 360 ||||| || ||||| ||||| || ||||||||||| |||||| |||||| ||||| || Sbjct: 44843 acggccggcccgaaggagcgcgccgggttcatggagccgccgctgaagggcccggcggcg 44784 Query: 361 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 420 ||||||||||| ||||||||||||||||| || ||||| ||||||||||||||||| ||| Sbjct: 44783 aggatgttggcgccgacgatgaagccgatcgccatgggcgcgatggtgccgagggagccc 44724 Query: 421 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 480 |||||||||||||| || || |||||||| ||||| || ||| ||||||||| | |||| Sbjct: 44723 ttcttggggtcggccgccgtcgcgtacaccgtgtacaccagcgcgaaggtgatcacgatc 44664 Query: 481 tccatcaccacgccctc 497 ||||||||||||||||| Sbjct: 44663 tccatcaccacgccctc 44647 Score = 93.7 bits (47), Expect = 7e-16 Identities = 83/95 (87%) Strand = Plus / Minus Query: 580 ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgatctgaccgccgagc 639 ||||| ||||| || |||||||||||||| |||||||||||||||| || ||||||| Sbjct: 44437 ccgagcagctgggcgacccagtagaagagcccggtgaggatggtgacgtggccgccgacg 44378 Query: 640 gcgaggccgaaggtgacggcagggttcacgtggcc 674 ||||||||||| |||||||| ||||||| |||||| Sbjct: 44377 gcgaggccgaacgtgacggcggggttcaggtggcc 44343 Score = 40.1 bits (20), Expect = 9.2 Identities = 44/52 (84%) Strand = Plus / Minus Query: 284 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 335 |||||||||||||| |||| || || ||||| || || || ||||||||||| Sbjct: 46205 tgaagtcgccgctgacaaccgccggcccgaacgaccgcgcggggttcatgga 46154
>emb|X80266.1|HVGTIPP H.vulgare mRNA for gamma-TIP-like protein Length = 1020 Score = 178 bits (90), Expect = 2e-41 Identities = 159/182 (87%) Strand = Plus / Minus Query: 303 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgag 362 |||||||||||| ||| || ||||||||||| |||||||||||| |||| | ||||| Sbjct: 681 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgccgacgag 622 Query: 363 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 422 ||||||||| |||||||||||||||||||||||||| ||||||||||| ||| ||||| Sbjct: 621 gatgttggcgccgacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 562 Query: 423 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 482 |||||||||| |||||||||||||||| ||||| || ||||||||||| | || |||||| Sbjct: 561 cttggggtcgacggcggtggcgtacaccgtgtacaccagcccgaaggtcatgacgatctc 502 Query: 483 ca 484 || Sbjct: 501 ca 500 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 762 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 715
>ref|XM_470213.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 753 Score = 170 bits (86), Expect = 4e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 596 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 537 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 536 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 477 Query: 445 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 490 ||||||||||||||||| |||||||| | || |||||||| ||||| Sbjct: 476 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 431 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 699 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 652 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Minus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 ||||||||| ||||| |||||||||||||| Sbjct: 273 gccgaaggtcacggccgggttcacgtggcc 244
>gb|DP000009.1| Oryza sativa (japonica cultivar-group) chromosome 3 Length = 36102668 Score = 170 bits (86), Expect = 4e-39 Identities = 146/166 (87%) Strand = Plus / Plus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 2544886 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 2544945 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 2544946 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 2545005 Query: 445 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 490 ||||||||||||||||| |||||||| | || |||||||| ||||| Sbjct: 2545006 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 2545051 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 2544783 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544830 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 275 agatgttggtgaagtcgccgctg 297 ||||||||||||||||||||||| Sbjct: 15990586 agatgttggtgaagtcgccgctg 15990564 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Plus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 ||||||||| ||||| |||||||||||||| Sbjct: 2545209 gccgaaggtcacggccgggttcacgtggcc 2545238
>gb|AC090485.3|AC090485 Genomic Sequence for Oryza sativa, Nipponbare strain, clone OSJNBa0067N01, from chromosome 3, complete sequence Length = 159636 Score = 170 bits (86), Expect = 4e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 125208 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 125149 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 125148 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 125089 Query: 445 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 490 ||||||||||||||||| |||||||| | || |||||||| ||||| Sbjct: 125088 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 125043 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 125311 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 125264 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Minus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 ||||||||| ||||| |||||||||||||| Sbjct: 124885 gccgaaggtcacggccgggttcacgtggcc 124856
>dbj|AP008209.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 3, complete sequence Length = 36192742 Score = 170 bits (86), Expect = 4e-39 Identities = 146/166 (87%) Strand = Plus / Plus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 2544996 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 2545055 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 2545056 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 2545115 Query: 445 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 490 ||||||||||||||||| |||||||| | || |||||||| ||||| Sbjct: 2545116 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 2545161 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Plus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 2544893 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 2544940 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 275 agatgttggtgaagtcgccgctg 297 ||||||||||||||||||||||| Sbjct: 15985120 agatgttggtgaagtcgccgctg 15985098 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Plus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 ||||||||| ||||| |||||||||||||| Sbjct: 2545319 gccgaaggtcacggccgggttcacgtggcc 2545348
>dbj|D25534.1|RICYK333 Oryza sativa yk333 mRNA for gamma-Tip, complete cds Length = 1080 Score = 170 bits (86), Expect = 4e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 674 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 615 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 614 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 555 Query: 445 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 490 ||||||||||||||||| |||||||| | || |||||||| ||||| Sbjct: 554 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 509 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 777 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 730 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Minus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 ||||||||| ||||| |||||||||||||| Sbjct: 351 gccgaaggtcacggccgggttcacgtggcc 322
>dbj|AK110727.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-170-E06, full insert sequence Length = 1024 Score = 170 bits (86), Expect = 4e-39 Identities = 146/166 (87%) Strand = Plus / Plus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 295 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 354 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 355 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 414 Query: 445 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 490 ||||||||||||||||| |||||||| | || |||||||| ||||| Sbjct: 415 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 460 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Plus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 ||||||||| ||||| |||||||||||||| Sbjct: 618 gccgaaggtcacggccgggttcacgtggcc 647
>dbj|AK104123.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-C12, full insert sequence Length = 1034 Score = 170 bits (86), Expect = 4e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 683 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 624 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 623 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 564 Query: 445 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 490 ||||||||||||||||| |||||||| | || |||||||| ||||| Sbjct: 563 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 518 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 786 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 739 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Minus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 ||||||||| ||||| |||||||||||||| Sbjct: 360 gccgaaggtcacggccgggttcacgtggcc 331
>dbj|AK068986.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023003E16, full insert sequence Length = 1082 Score = 170 bits (86), Expect = 4e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 685 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 626 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 625 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 566 Query: 445 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 490 ||||||||||||||||| |||||||| | || |||||||| ||||| Sbjct: 565 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 520 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 788 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 741 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Minus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 ||||||||| ||||| |||||||||||||| Sbjct: 362 gccgaaggtcacggccgggttcacgtggcc 333
>dbj|AK059438.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-027-G11, full insert sequence Length = 551 Score = 170 bits (86), Expect = 4e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 209 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 150 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 149 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 90 Query: 445 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 490 ||||||||||||||||| |||||||| | || |||||||| ||||| Sbjct: 89 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 44 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 312 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 265
>dbj|AK058322.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B06, full insert sequence Length = 1055 Score = 170 bits (86), Expect = 4e-39 Identities = 146/166 (87%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||| | |||| | ||||||||||| || |||||||||||| Sbjct: 681 gggttcatggaggcgccgtcgaacgcgccgccgacgaggatgttcgcgccgacgatgaag 622 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||||||||||||||||||||||||| |||||||||||||| ||||||||||| Sbjct: 621 ccgatggcgatgggggcgatggtgccgaggctgcccttcttggggtcaacggcggtggcg 562 Query: 445 tacacggtgtagacgagcccgaaggtgacgatgatctccatcacca 490 ||||||||||||||||| |||||||| | || |||||||| ||||| Sbjct: 561 tacacggtgtagacgaggccgaaggtcatgacgatctccagcacca 516 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||||||||||||||| ||||| ||||||| Sbjct: 784 gtagatgacgccggcgaggccaccgccgatgagtgggccaacccagta 737 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Minus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 ||||||||| ||||| |||||||||||||| Sbjct: 358 gccgaaggtcacggccgggttcacgtggcc 329
>ref|XM_473424.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 2307 Score = 167 bits (84), Expect = 6e-38 Identities = 228/276 (82%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 281 |||||||| ||||| |||||||| ||||| || |||||| ||||||| | |||| || Sbjct: 696 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 637 Query: 282 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 341 || ||||| |||| || ||||| |||||||| ||||| |||||||||||||||| ||| Sbjct: 636 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 577 Query: 342 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 401 | ||||| || || | ||||||||||| |||||||||||||||||||| ||||| || Sbjct: 576 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 517 Query: 402 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgag 461 || |||||||||||| |||||||| |||||||| || ||||||||||| ||||| || || Sbjct: 516 gacggtgccgagggaacccttcttcgggtcggccgccgtggcgtacaccgtgtacaccag 457 Query: 462 cccgaaggtgacgatgatctccatcaccacgccctc 497 | |||| |||| | ||||||||||||| |||||| Sbjct: 456 cgcgaacgtgatcacaatctccatcaccatgccctc 421 Score = 85.7 bits (43), Expect = 2e-13 Identities = 82/95 (86%) Strand = Plus / Minus Query: 580 ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgatctgaccgccgagc 639 ||||| ||||| || ||||||||||||| |||||||||||||||||| || || |||| Sbjct: 332 ccgagcagctgagcgacccagtagaagatgccggtgaggatggtgatgtggccaccgacg 273 Query: 640 gcgaggccgaaggtgacggcagggttcacgtggcc 674 ||||||||||||||||| | ||||||| |||||| Sbjct: 272 gcgaggccgaaggtgacaacggggttcaagtggcc 238
>emb|AL663000.4|OSJN00201 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBb0034G17, complete sequence Length = 127259 Score = 167 bits (84), Expect = 6e-38 Identities = 228/276 (82%) Strand = Plus / Plus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 281 |||||||| ||||| |||||||| ||||| || |||||| ||||||| | |||| || Sbjct: 92483 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 92542 Query: 282 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 341 || ||||| |||| || ||||| |||||||| ||||| |||||||||||||||| ||| Sbjct: 92543 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 92602 Query: 342 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 401 | ||||| || || | ||||||||||| |||||||||||||||||||| ||||| || Sbjct: 92603 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 92662 Query: 402 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgag 461 || |||||||||||| |||||||| |||||||| || ||||||||||| ||||| || || Sbjct: 92663 gacggtgccgagggaacccttcttcgggtcggccgccgtggcgtacaccgtgtacaccag 92722 Query: 462 cccgaaggtgacgatgatctccatcaccacgccctc 497 | |||| |||| | ||||||||||||| |||||| Sbjct: 92723 cgcgaacgtgatcacaatctccatcaccatgccctc 92758 Score = 85.7 bits (43), Expect = 2e-13 Identities = 82/95 (86%) Strand = Plus / Plus Query: 580 ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgatctgaccgccgagc 639 ||||| ||||| || ||||||||||||| |||||||||||||||||| || || |||| Sbjct: 92924 ccgagcagctgagcgacccagtagaagatgccggtgaggatggtgatgtggccaccgacg 92983 Query: 640 gcgaggccgaaggtgacggcagggttcacgtggcc 674 ||||||||||||||||| | ||||||| |||||| Sbjct: 92984 gcgaggccgaaggtgacaacggggttcaagtggcc 93018
>dbj|AP008210.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 4, complete sequence Length = 35498469 Score = 167 bits (84), Expect = 6e-38 Identities = 228/276 (82%) Strand = Plus / Plus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccagatgtt 281 |||||||| ||||| |||||||| ||||| || |||||| ||||||| | |||| || Sbjct: 27568507 gtagacgagcccggccaggccaccaccgatcagtgggccgacccagtacacccagttgcc 27568566 Query: 282 ggtgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatggaaccgcc 341 || ||||| |||| || ||||| |||||||| ||||| |||||||||||||||| ||| Sbjct: 27568567 ggcgaagttgccggccgcgacggccgggccgaaggagcgggcagggttcatggaactgcc 27568626 Query: 342 ggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggggc 401 | ||||| || || | ||||||||||| |||||||||||||||||||| ||||| || Sbjct: 27568627 gctaaagggccccgccgccaggatgttggcaccgacgatgaagccgatggccatgggcgc 27568686 Query: 402 gatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacgag 461 || |||||||||||| |||||||| |||||||| || ||||||||||| ||||| || || Sbjct: 27568687 gacggtgccgagggaacccttcttcgggtcggccgccgtggcgtacaccgtgtacaccag 27568746 Query: 462 cccgaaggtgacgatgatctccatcaccacgccctc 497 | |||| |||| | ||||||||||||| |||||| Sbjct: 27568747 cgcgaacgtgatcacaatctccatcaccatgccctc 27568782 Score = 85.7 bits (43), Expect = 2e-13 Identities = 82/95 (86%) Strand = Plus / Plus Query: 580 ccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgatctgaccgccgagc 639 ||||| ||||| || ||||||||||||| |||||||||||||||||| || || |||| Sbjct: 27568948 ccgagcagctgagcgacccagtagaagatgccggtgaggatggtgatgtggccaccgacg 27569007 Query: 640 gcgaggccgaaggtgacggcagggttcacgtggcc 674 ||||||||||||||||| | ||||||| |||||| Sbjct: 27569008 gcgaggccgaaggtgacaacggggttcaagtggcc 27569042 Score = 63.9 bits (32), Expect = 6e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 428 ggtcggcggcggtggcgtacacggtgtagacgagcccgaa 467 ||||| |||||||||||||||||||||| ||||||||||| Sbjct: 26354650 ggtcgacggcggtggcgtacacggtgtacacgagcccgaa 26354611 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 26073342 acggtgtagacgagcacgaaggtgccgatgatctc 26073308 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Plus Query: 275 agatgttggtgaagtcgccgctg 297 ||||||||||||||||||||||| Sbjct: 25620210 agatgttggtgaagtcgccgctg 25620232 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggtt 665 |||||||||||||||||| ||||| Sbjct: 28020292 gaggccgaaggtgacggccgggtt 28020269 Score = 40.1 bits (20), Expect = 9.2 Identities = 29/32 (90%) Strand = Plus / Plus Query: 448 acggtgtagacgagcccgaaggtgacgatgat 479 |||||||||||||| |||||||| ||||||| Sbjct: 8907189 acggtgtagacgaggacgaaggtgccgatgat 8907220
>gb|U86762.1|TAU86762 Triticum aestivum gamma-type tonoplast intrinsic protein mRNA, complete cds Length = 1133 Score = 145 bits (73), Expect = 2e-31 Identities = 160/189 (84%) Strand = Plus / Minus Query: 303 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgag 362 |||||||||||| ||| || ||||||||||| |||||||||||| |||| | || || Sbjct: 712 ggcggggccgaaggagacggcggggttcatggacgcgccggagaaggcgccgcccaccag 653 Query: 363 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 422 ||||||||| || ||||||||||||||||||||||| ||||||||||| ||| ||||| Sbjct: 652 gatgttggcgcccacgatgaagccgatggcgatgggcgcgatggtgcccaggctgccctt 593 Query: 423 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||| |||| ||||||||||| ||||| || ||||||||||| | | |||||| Sbjct: 592 cttggggtccacggccgtggcgtacaccgtgtacaccagcccgaaggtcatcacgatctc 533 Query: 483 catcaccac 491 || |||||| Sbjct: 532 cagcaccac 524 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 793 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 746
>ref|NM_189497.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 759 Score = 141 bits (71), Expect = 3e-30 Identities = 161/191 (84%) Strand = Plus / Minus Query: 301 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 360 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 623 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 564 Query: 361 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 420 ||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||| Sbjct: 563 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 504 Query: 421 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 480 |||||||| || | |||||||||||||||||||||||||| |||||||| | || |||| Sbjct: 503 ttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatc 444 Query: 481 tccatcaccac 491 || | |||||| Sbjct: 443 tcgaacaccac 433
>dbj|AP008207.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, complete sequence Length = 43261740 Score = 141 bits (71), Expect = 3e-30 Identities = 161/191 (84%) Strand = Plus / Plus Query: 301 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 360 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 43108804 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 43108863 Query: 361 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 420 ||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||| Sbjct: 43108864 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 43108923 Query: 421 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 480 |||||||| || | |||||||||||||||||||||||||| |||||||| | || |||| Sbjct: 43108924 ttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatc 43108983 Query: 481 tccatcaccac 491 || | |||||| Sbjct: 43108984 tcgaacaccac 43108994 Score = 60.0 bits (30), Expect = 1e-05 Identities = 69/82 (84%) Strand = Plus / Minus Query: 307 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 366 |||||||| ||||| || ||||||||||| |||||||| |||| ||| | |||||||| Sbjct: 7297471 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 7297412 Query: 367 ttggccccgacgatgaagccga 388 ||||| ||||||| || ||||| Sbjct: 7297411 ttggcgccgacgacgaggccga 7297390 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 429 gtcggcggcggtggcgtacacggtg 453 ||||||||||| ||||||||||||| Sbjct: 8192882 gtcggcggcggcggcgtacacggtg 8192858
>dbj|AP003627.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0459B04 Length = 142475 Score = 141 bits (71), Expect = 3e-30 Identities = 161/191 (84%) Strand = Plus / Plus Query: 301 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 360 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 105833 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 105892 Query: 361 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 420 ||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||| Sbjct: 105893 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 105952 Query: 421 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 480 |||||||| || | |||||||||||||||||||||||||| |||||||| | || |||| Sbjct: 105953 ttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatc 106012 Query: 481 tccatcaccac 491 || | |||||| Sbjct: 106013 tcgaacaccac 106023
>dbj|AK111768.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023066H10, full insert sequence Length = 1346 Score = 141 bits (71), Expect = 3e-30 Identities = 161/191 (84%) Strand = Plus / Minus Query: 301 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 360 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 647 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 588 Query: 361 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 420 ||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||| Sbjct: 587 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 528 Query: 421 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 480 |||||||| || | |||||||||||||||||||||||||| |||||||| | || |||| Sbjct: 527 ttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatc 468 Query: 481 tccatcaccac 491 || | |||||| Sbjct: 467 tcgaacaccac 457
>dbj|AK111747.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023050B20, full insert sequence Length = 1149 Score = 141 bits (71), Expect = 3e-30 Identities = 161/191 (84%) Strand = Plus / Minus Query: 301 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 360 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 696 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 637 Query: 361 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 420 ||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||| Sbjct: 636 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 577 Query: 421 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 480 |||||||| || | |||||||||||||||||||||||||| |||||||| | || |||| Sbjct: 576 ttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatc 517 Query: 481 tccatcaccac 491 || | |||||| Sbjct: 516 tcgaacaccac 506
>dbj|AB114829.1| Oryza sativa (japonica cultivar-group) OsTIP1 mRNA for tonoplast intrinsic protein, complete cds Length = 970 Score = 141 bits (71), Expect = 3e-30 Identities = 161/191 (84%) Strand = Plus / Minus Query: 301 acggcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacg 360 |||||||||||||| ||| || ||||||||||| ||||| ||||| |||| | || Sbjct: 633 acggcggggccgaaggagacggcggggttcatggaggcgccgtcgaaggcgccgccggcg 574 Query: 361 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 420 ||||||||||| ||||||||||||||||||||||||||||||||| |||||| ||| Sbjct: 573 aggatgttggcgccgacgatgaagccgatggcgatgggggcgatgacaccgaggtcgccc 514 Query: 421 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 480 |||||||| || | |||||||||||||||||||||||||| |||||||| | || |||| Sbjct: 513 ttcttgggatccaccgcggtggcgtacacggtgtagacgaggccgaaggtcatgacgatc 454 Query: 481 tccatcaccac 491 || | |||||| Sbjct: 453 tcgaacaccac 443
>emb|AJ242805.1|SST242805 Sporobolus stapfianus mRNA for putative gamma tonoplast intrinsic protein (TIP) Length = 1146 Score = 139 bits (70), Expect = 1e-29 Identities = 127/146 (86%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||||| |||| | |||||||||||||| || ||||||||| Sbjct: 675 gggttcatggacgcgccgtcgaaggcgccgccgacgaggatgttggcgcccacgatgaag 616 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||||||||||||||||||||| ||| ||||||||||||||| | ||||||||| Sbjct: 615 ccgatggcgatgggggcgatggtgcccaggctgcccttcttggggtcgaccgcggtggcg 556 Query: 445 tacacggtgtagacgagcccgaaggt 470 ||||| ||||| || || |||||||| Sbjct: 555 tacacagtgtacaccagaccgaaggt 530
>gb|AY243803.1| Zea mays tonoplast water channel (TIP1-1) mRNA, complete cds Length = 1039 Score = 123 bits (62), Expect = 8e-25 Identities = 125/146 (85%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||||| |||| | || |||||||||||||| ||||||||| Sbjct: 597 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 538 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||||||||||||||||||||| ||| |||||||| ||||| | || |||||| Sbjct: 537 ccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtccaccgccgtggcg 478 Query: 445 tacacggtgtagacgagcccgaaggt 470 ||||| ||||| || ||||||||||| Sbjct: 477 tacaccgtgtacaccagcccgaaggt 452 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 700 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 653
>gb|AF326500.1|AF326500 Zea mays tonoplast membrane integral protein ZmTIP1-2 mRNA, complete cds Length = 1021 Score = 119 bits (60), Expect = 1e-23 Identities = 114/132 (86%) Strand = Plus / Minus Query: 361 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 420 ||||||||||| |||||||||||||||||||||||||| |||||| ||||||| ||| Sbjct: 577 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgccc 518 Query: 421 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 480 ||||||||||| |||| ||||||||||| ||||| ||||| |||||||| | || ||| Sbjct: 517 ttcttggggtccacggccgtggcgtacaccgtgtacacgaggccgaaggtcatgaccatc 458 Query: 481 tccatcaccacg 492 |||| ||||||| Sbjct: 457 tccagcaccacg 446 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 ||||||||| |||||||||||||||||||| Sbjct: 287 gccgaaggtcacggcagggttcacgtggcc 258
>gb|AY112388.1| Zea mays CL24208_1 mRNA sequence Length = 833 Score = 119 bits (60), Expect = 1e-23 Identities = 114/132 (86%) Strand = Plus / Plus Query: 361 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 420 ||||||||||| |||||||||||||||||||||||||| |||||| ||||||| ||| Sbjct: 434 aggatgttggcgccgacgatgaagccgatggcgatgggcgcgatgacgccgaggtcgccc 493 Query: 421 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatc 480 ||||||||||| |||| ||||||||||| ||||| ||||| |||||||| | || ||| Sbjct: 494 ttcttggggtccacggccgtggcgtacaccgtgtacacgaggccgaaggtcatgaccatc 553 Query: 481 tccatcaccacg 492 |||| ||||||| Sbjct: 554 tccagcaccacg 565 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Plus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 ||||||||| |||||||||||||||||||| Sbjct: 723 gccgaaggtcacggcagggttcacgtggcc 752
>ref|NM_112495.2| Arabidopsis thaliana DELTA-TIP; water channel AT3G16240 (DELTA-TIP) mRNA, complete cds Length = 1125 Score = 115 bits (58), Expect = 2e-22 Identities = 142/170 (83%) Strand = Plus / Minus Query: 319 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 378 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 709 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 650 Query: 379 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 438 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 649 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 590 Query: 439 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 488 |||||||| || |||||||| | ||||||||| ||||||||||||||| Sbjct: 589 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 540
>ref|NM_112496.2| Arabidopsis thaliana electron carrier/ electron transporter/ iron ion binding AT3G16250 mRNA, complete cds Length = 1538 Score = 115 bits (58), Expect = 2e-22 Identities = 142/170 (83%) Strand = Plus / Plus Query: 319 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 378 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 1166 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 1225 Query: 379 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 438 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 1226 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 1285 Query: 439 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 488 |||||||| || |||||||| | ||||||||| ||||||||||||||| Sbjct: 1286 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 1335
>gb|AY389618.1| Hyacinthus orientalis mitochondrial tonoplast intrinsic protein (TIP1) mRNA, partial cds Length = 662 Score = 115 bits (58), Expect = 2e-22 Identities = 97/110 (88%) Strand = Plus / Minus Query: 361 aggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccc 420 |||||||||||||| |||||||||||||| |||||||| ||||| || || ||| ||| Sbjct: 556 aggatgttggcccccacgatgaagccgatcgcgatgggcgcgatcgtccccaggctcccc 497 Query: 421 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 ||||| ||||| |||||||||||||||||||||||||||||||||||| Sbjct: 496 ttcttcgggtcaatggcggtggcgtacacggtgtagacgagcccgaaggt 447 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Minus Query: 583 aggagctgcgcaacccagtagaagaggccg 612 ||||||||||| |||||||||| ||||||| Sbjct: 334 aggagctgcgccacccagtagaggaggccg 305
>gb|AY081622.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230) mRNA, complete cds Length = 853 Score = 115 bits (58), Expect = 2e-22 Identities = 142/170 (83%) Strand = Plus / Minus Query: 319 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 378 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 599 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 540 Query: 379 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 438 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 539 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 480 Query: 439 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 488 |||||||| || |||||||| | ||||||||| ||||||||||||||| Sbjct: 479 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 430
>gb|AY065181.1| Arabidopsis thaliana delta tonoplast intrinsic protein (At3g16230; MYA6.5) mRNA, complete cds Length = 929 Score = 115 bits (58), Expect = 2e-22 Identities = 142/170 (83%) Strand = Plus / Minus Query: 319 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 378 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 670 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 611 Query: 379 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 438 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 610 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 551 Query: 439 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 488 |||||||| || |||||||| | ||||||||| ||||||||||||||| Sbjct: 550 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 501
>emb|BX823177.1|CNS0A5ZD Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB95ZE06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 903 Score = 115 bits (58), Expect = 2e-22 Identities = 142/170 (83%) Strand = Plus / Minus Query: 319 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 378 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 647 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 588 Query: 379 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 438 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 587 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 528 Query: 439 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 488 |||||||| || |||||||| | ||||||||| ||||||||||||||| Sbjct: 527 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 478
>emb|BX823081.1|CNS0A5VY Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB88ZH07 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 957 Score = 115 bits (58), Expect = 2e-22 Identities = 142/170 (83%) Strand = Plus / Minus Query: 319 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 378 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 652 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 593 Query: 379 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 438 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 592 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 533 Query: 439 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 488 |||||||| || |||||||| | ||||||||| ||||||||||||||| Sbjct: 532 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 483
>emb|BX823757.1|CNS0A5CX Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS72ZD10 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 115 bits (58), Expect = 2e-22 Identities = 142/170 (83%) Strand = Plus / Minus Query: 319 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 378 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 649 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 590 Query: 379 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 438 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 589 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 530 Query: 439 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 488 |||||||| || |||||||| | ||||||||| ||||||||||||||| Sbjct: 529 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 480
>gb|AY085921.1| Arabidopsis thaliana clone 19689 mRNA, complete sequence Length = 978 Score = 115 bits (58), Expect = 2e-22 Identities = 142/170 (83%) Strand = Plus / Minus Query: 319 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 378 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 671 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 612 Query: 379 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 438 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 611 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 552 Query: 439 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 488 |||||||| || |||||||| | ||||||||| ||||||||||||||| Sbjct: 551 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 502
>dbj|AB023046.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone: MYA6 Length = 75289 Score = 115 bits (58), Expect = 2e-22 Identities = 142/170 (83%) Strand = Plus / Minus Query: 319 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 378 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 19498 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 19439 Query: 379 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 438 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 19438 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 19379 Query: 439 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 488 |||||||| || |||||||| | ||||||||| ||||||||||||||| Sbjct: 19378 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 19329
>gb|AF037061.1|AF037061 Zea mays tonoplast intrinsic protein (ZmTIP1) mRNA, complete cds Length = 1097 Score = 115 bits (58), Expect = 2e-22 Identities = 124/146 (84%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||||| |||| | || |||||||||||||| ||||||||| Sbjct: 689 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 630 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||| ||||||||||||||||| ||| |||||||| ||||| | || |||||| Sbjct: 629 ccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtccaccgccgtggcg 570 Query: 445 tacacggtgtagacgagcccgaaggt 470 ||||| ||||| || ||||||||||| Sbjct: 569 tacaccgtgtacaccagcccgaaggt 544 Score = 48.1 bits (24), Expect = 0.038 Identities = 42/48 (87%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||| ||||||||||| || ||| ||||||| Sbjct: 792 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 745 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 645 gccgaaggtgacggcagggttcacgtg 671 ||||||||| ||||||||||||||||| Sbjct: 366 gccgaaggtcacggcagggttcacgtg 340
>gb|U39485.1|ATU39485 Arabidopsis thaliana delta tonoplast integral protein mRNA, complete cds Length = 939 Score = 115 bits (58), Expect = 2e-22 Identities = 142/170 (83%) Strand = Plus / Minus Query: 319 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 378 ||||| ||||||||||| || |||||||| || ||||| ||||||||||||| || ||| Sbjct: 616 cgtgctgggttcatggatccaccggagaatggaccggcggcgaggatgttggcaccaacg 557 Query: 379 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 438 || | || ||||||| || |||||||| ||||| || ||||||||||| || |||||| Sbjct: 556 ataagaccaatggcgagaggagcgatggttccgagagaacccttcttgggatcagcggcg 497 Query: 439 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 488 |||||||| || |||||||| | ||||||||| ||||||||||||||| Sbjct: 496 gtggcgtagacagtgtagaccaaagcgaaggtgatgatgatctccatcac 447
>gb|BT016300.1| Zea mays clone Contig133 mRNA sequence Length = 1112 Score = 107 bits (54), Expect = 5e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||||| |||| | || ||||||||||| || ||||||||| Sbjct: 693 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcgcccacgatgaag 634 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||||||||||||||||||||| ||| |||||||| ||||| | || || ||| Sbjct: 633 ccgatggcgatgggggcgatggtgcccaggctgcccttcttcgggtccaccgccgtcgcg 574 Query: 445 tacacggtgtagacgagcccgaaggt 470 ||||| ||||| || ||||||||||| Sbjct: 573 tacaccgtgtacaccagcccgaaggt 548 Score = 48.1 bits (24), Expect = 0.038 Identities = 42/48 (87%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||| ||||||||||| || ||| ||||||| Sbjct: 796 gtagatgacgccggcgaggccgccgccgatgaggggcccgacccagta 749 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 645 gccgaaggtgacggcagggttcacgtg 671 ||||||||| ||||||||||||||||| Sbjct: 370 gccgaaggtcacggcagggttcacgtg 344
>gb|AY104464.1| Zea mays PCO114899 mRNA sequence Length = 1167 Score = 107 bits (54), Expect = 5e-20 Identities = 123/146 (84%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 ||||||||||| ||||| ||||| |||| | || |||||||||||||| ||||||||| Sbjct: 692 gggttcatggacgcgccgtcgaaggcgccgcccaccaggatgttggcccccacgatgaag 633 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 |||||||| ||||||||||||||||| ||| |||||||| ||||| | || || ||| Sbjct: 632 ccgatggcaatgggggcgatggtgcccaggctgcccttcttcgggtccaccgccgtcgcg 573 Query: 445 tacacggtgtagacgagcccgaaggt 470 ||||| ||||| || ||||||||||| Sbjct: 572 tacaccgtgtacaccagcccgaaggt 547 Score = 56.0 bits (28), Expect = 2e-04 Identities = 43/48 (89%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatgagcgggccggcccagta 269 ||||| || |||||||||||| ||||||||||| |||||| ||||||| Sbjct: 795 gtagatgacgccggcgaggccgccgccgatgagggggccgacccagta 748
>dbj|AB010416.1| Raphanus sativus VIP3 mRNA for delta-VM23, complete cds Length = 911 Score = 99.6 bits (50), Expect = 1e-17 Identities = 140/170 (82%) Strand = Plus / Minus Query: 319 cgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacg 378 ||||| ||||||||||| || || ||||| || ||||| | ||||||||||| |||||| Sbjct: 640 cgtgctgggttcatggatccaccagagaatggaccggcggctaggatgttggcaccgacg 581 Query: 379 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 438 |||| || ||||||| ||| |||||||| ||||| || ||||| ||||| || |||||| Sbjct: 580 atgagaccaatggcgaggggagcgatggttccgagagaaccctttttgggatcagcggcg 521 Query: 439 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatcac 488 |||| ||| ||||||||||| | ||| |||| ||||||||||||||| Sbjct: 520 gtggggtagacggtgtagactaaagagaaagtgatgatgatctccatcac 471
>gb|U62778.1|GHU62778 Gossypium hirsutum delta-tonoplast intrinsic protein mRNA, complete cds Length = 997 Score = 97.6 bits (49), Expect = 5e-17 Identities = 184/229 (80%) Strand = Plus / Minus Query: 263 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 322 ||||||||||||| ||| | |||||||||| || || || || || ||||| ||||| | Sbjct: 692 cccagtagatccatatgccgttgaagtcgccactagccactgctggtccgaaggagcgag 633 Query: 323 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 382 | ||||||||||| || || ||||| || || || | | ||||||||| || || |||| Sbjct: 632 ctgggttcatggatccaccagagaatggaccagcggccaagatgttggcaccaacaatga 573 Query: 383 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtgg 442 |||||||||| ||||| || ||||| ||||| ||||||||||| ||||| || ||||| | Sbjct: 572 agccgatggcaatgggtgcaatggtcccgagtgatcccttctttgggtcagctgcggttg 513 Query: 443 cgtacacggtgtagacgagcccgaaggtgacgatgatctccatcaccac 491 | ||||| ||||| || | | || |||| |||||||||||||||||| Sbjct: 512 catacactgtgtaaaccaatgcaaatgtgatgatgatctccatcaccac 464
>gb|U39486.1|ATU39486 Arabidopsis thaliana delta tonoplast integral protein gene, partial cds Length = 2235 Score = 97.6 bits (49), Expect = 5e-17 Identities = 124/149 (83%) Strand = Plus / Minus Query: 340 ccggagaaggggccggcaacgaggatgttggccccgacgatgaagccgatggcgatgggg 399 |||||||| || ||||| ||||||||||||| || ||||| | || ||||||| || Sbjct: 2228 ccggagaatggaccggcggcgaggatgttggcaccaacgataagaccaatggcgagagga 2169 Query: 400 gcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacg 459 |||||||| ||||| || ||||||||||| || |||||||||||||| || |||||||| Sbjct: 2168 gcgatggttccgagagaacccttcttgggatcagcggcggtggcgtagacagtgtagacc 2109 Query: 460 agcccgaaggtgacgatgatctccatcac 488 | ||||||||| ||||||||||||||| Sbjct: 2108 aaagcgaaggtgatgatgatctccatcac 2080
>gb|AF271661.1|AF271661 Vitis berlandieri x Vitis rupestris putative aquaporin TIP1 (TIP1) mRNA, complete cds Length = 1057 Score = 91.7 bits (46), Expect = 3e-15 Identities = 91/106 (85%) Strand = Plus / Minus Query: 263 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 322 |||||||||||||| ||| |||||||||||||| | |||||||||||||| ||||| | Sbjct: 697 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 638 Query: 323 cagggttcatggaaccgccggagaaggggccggcaacgaggatgtt 368 | |||||||| || || |||||||| ||||||||| | |||||||| Sbjct: 637 cggggttcattgatccaccggagaatgggccggcagccaggatgtt 592 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 586 agctgcgcaacccagtagaagaggccggtgaggatggtgatctgacc 632 ||||| |||| |||||| |||| ||| ||||| |||||||||||||| Sbjct: 368 agctgggcaatccagtacaagatgccagtgagaatggtgatctgacc 322
>dbj|AK060994.1| Oryza sativa (japonica cultivar-group) cDNA clone:006-203-E02, full insert sequence Length = 870 Score = 89.7 bits (45), Expect = 1e-14 Identities = 66/73 (90%) Strand = Plus / Minus Query: 418 cccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatg 477 |||||||||||||| |||||||||||||||||||||||||||| |||||||| | || | Sbjct: 588 cccttcttggggtcaacggcggtggcgtacacggtgtagacgaggccgaaggtcatgacg 529 Query: 478 atctccatcacca 490 ||||||| ||||| Sbjct: 528 atctccagcacca 516 Score = 46.1 bits (23), Expect = 0.15 Identities = 29/31 (93%) Strand = Plus / Minus Query: 222 gtagacgatgccggcgaggccaccgccgatg 252 ||||| || |||||||||||||||||||||| Sbjct: 622 gtagatgacgccggcgaggccaccgccgatg 592 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Minus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 ||||||||| ||||| |||||||||||||| Sbjct: 358 gccgaaggtcacggccgggttcacgtggcc 329
>emb|BX824373.1|CNS0A6WG Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH44ZA10 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 887 Score = 87.7 bits (44), Expect = 4e-14 Identities = 95/112 (84%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | | Sbjct: 448 cgaggatgttcgctccaacgatgaaacctatggcgattggtgcgattgttccgagagtgc 389 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 388 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 337 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 154 ccgaaggtaacggcagggttaacgtggcc 126
>emb|AJ314583.1|POC314583 Posidonia oceanica mRNA for putative tonoplast intrinsic protein (tip1 gene) Length = 1112 Score = 85.7 bits (43), Expect = 2e-13 Identities = 76/87 (87%) Strand = Plus / Minus Query: 384 gccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggc 443 ||||||||||| ||| ||||| ||||||| || ||| |||||||||||| ||||||||| Sbjct: 616 gccgatggcgaggggagcgatagtgccgatggctcctttcttggggtcgatggcggtggc 557 Query: 444 gtacacggtgtagacgagcccgaaggt 470 ||| ||||||||||| || |||||||| Sbjct: 556 gtagacggtgtagactagtccgaaggt 530 Score = 40.1 bits (20), Expect = 9.2 Identities = 47/56 (83%) Strand = Plus / Minus Query: 221 ggtagacgatgccggcgaggccaccgccgatgagcgggccggcccagtagatccag 276 |||||||||||||||||| | | | |||| || |||||| |||||||||||||| Sbjct: 779 ggtagacgatgccggcgatggctgcaccgactagtgggccgacccagtagatccag 724
>emb|AJ289696.1|POC289696 Posidonia oceanica partial mRNA for putative aquaporin (aq1 gene) Length = 428 Score = 85.7 bits (43), Expect = 2e-13 Identities = 76/87 (87%) Strand = Plus / Minus Query: 384 gccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggc 443 ||||||||||| ||| ||||| ||||||| || ||| |||||||||||| ||||||||| Sbjct: 304 gccgatggcgaggggagcgatagtgccgatggctcctttcttggggtcgatggcggtggc 245 Query: 444 gtacacggtgtagacgagcccgaaggt 470 ||| ||||||||||| || |||||||| Sbjct: 244 gtagacggtgtagactagtccgaaggt 218
>gb|AF133532.1|AF133532 Mesembryanthemum crystallinum water channel protein MipK (MipK) mRNA, complete cds Length = 1076 Score = 85.7 bits (43), Expect = 2e-13 Identities = 127/155 (81%) Strand = Plus / Minus Query: 304 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 363 ||||| ||||||||||| || ||||||||||| || || ||||| |||||||| | | | Sbjct: 696 gcgggcccgaatgagcgggctgggttcatggatccaccagagaatgggccggcggccaag 637 Query: 364 atgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttc 423 |||||||| || || ||||| || || || |||||||| |||||||| | || ||| || Sbjct: 636 atgttggctccaacaatgaacccaatagcaatgggggcaatggtgcccactgagcccctc 577 Query: 424 ttggggtcggcggcggtggcgtacacggtgtagac 458 |||||||| | ||||||||||| ||||||||||| Sbjct: 576 ttggggtcaactgcggtggcgtagacggtgtagac 542
>emb|AJ289866.2|VVI289866 Vitis vinifera mRNA for putative aquaporin (delta-TIP gene) Length = 1017 Score = 83.8 bits (42), Expect = 7e-13 Identities = 90/106 (84%) Strand = Plus / Minus Query: 263 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 322 |||||||||||||| ||| |||||||||||||| | |||||||||||||| ||||| | Sbjct: 655 cccagtagatccagttgtccttgaagtcgccgctgacgacggcggggccgaaggagcggg 596 Query: 323 cagggttcatggaaccgccggagaaggggccggcaacgaggatgtt 368 | |||||||| || || |||||||| ||||| ||| | |||||||| Sbjct: 595 cggggttcattgatccaccggagaatgggcctgcagccaggatgtt 550 Score = 46.1 bits (23), Expect = 0.15 Identities = 41/47 (87%) Strand = Plus / Minus Query: 586 agctgcgcaacccagtagaagaggccggtgaggatggtgatctgacc 632 ||||| |||| |||||| |||| ||| ||||| |||||||||||||| Sbjct: 326 agctgggcaatccagtacaagatgccagtgagaatggtgatctgacc 280
>gb|AC183494.1| Brassica oleracea Contig C, complete sequence Length = 285752 Score = 83.8 bits (42), Expect = 7e-13 Identities = 108/130 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| || |||||||| || || ||||| || |||||||| ||||| |||| Sbjct: 123743 cgaggatgttggcaccaacgatgaaaccaatagcgattggtgcgatggttccgagcgatc 123684 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatga 478 | ||||| || || || || |||||||| ||||||||||| | | ||||| ||||||| Sbjct: 123683 ctttctttggatcagcagctgtggcgtaaacggtgtagaccaaagcaaaggtcacgatga 123624 Query: 479 tctccatcac 488 |||||||||| Sbjct: 123623 tctccatcac 123614
>emb|BX822968.1|CNS0A5UC Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB77ZF06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 945 Score = 81.8 bits (41), Expect = 3e-12 Identities = 77/89 (86%) Strand = Plus / Minus Query: 400 gcgatggtgccgagggatcccttcttggggtcggcggcggtggcgtacacggtgtagacg 459 |||||||| ||||| || ||||||||||| || |||||||||||||| || |||||||| Sbjct: 573 gcgatggttccgagagaacccttcttgggatcagcggcggtggcgtagacagtgtagacc 514 Query: 460 agcccgaaggtgacgatgatctccatcac 488 | ||||||||| ||||||||||||||| Sbjct: 513 aaagcgaaggtgatgatgatctccatcac 485
>gb|AF009567.1|AF009567 Gossypium hirsutum delta-TIP homolog (MIP) mRNA, partial cds Length = 316 Score = 81.8 bits (41), Expect = 3e-12 Identities = 107/129 (82%) Strand = Plus / Minus Query: 363 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 422 ||||||||| || || |||||||||||||| ||||| || ||||| ||||| |||||||| Sbjct: 289 gatgttggcaccaacaatgaagccgatggcaatgggtgcaatggtcccgagtgatccctt 230 Query: 423 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 482 ||| ||||| || ||||| || ||||| ||||| || | | || |||| ||||||||| Sbjct: 229 ctttgggtcagctgcggttgcatacactgtgtaaaccaatgcaaatgtgatgatgatctc 170 Query: 483 catcaccac 491 ||||||||| Sbjct: 169 catcaccac 161
>ref|NM_124117.2| Arabidopsis thaliana AtTIP2;3; water channel AT5G47450 (AtTIP2;3) mRNA, complete cds Length = 1051 Score = 79.8 bits (40), Expect = 1e-11 Identities = 85/100 (85%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| || || ||||||||||||||||| || |||||||| || || |||| Sbjct: 597 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 538 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagac 458 | ||||| || || || || |||||||| ||||||||||| Sbjct: 537 ctttctttggatcagctgctgtggcgtaaacggtgtagac 498
>ref|NM_113559.3| Arabidopsis thaliana TIP2 (TONOPLAST INTRINSIC PROTEIN 2); water channel AT3G26520 (TIP2) mRNA, complete cds Length = 1201 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 680 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 621 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 620 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 569 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 387 ccgaaggtaacggcagggttaacgtggcc 359
>gb|BT011663.1| Arabidopsis thaliana At5g47450 mRNA, complete cds Length = 753 Score = 79.8 bits (40), Expect = 1e-11 Identities = 85/100 (85%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| || || ||||||||||||||||| || |||||||| || || |||| Sbjct: 559 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 500 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagac 458 | ||||| || || || || |||||||| ||||||||||| Sbjct: 499 ctttctttggatcagctgctgtggcgtaaacggtgtagac 460
>gb|BT011212.1| Arabidopsis thaliana At5g47450 gene, complete cds Length = 853 Score = 79.8 bits (40), Expect = 1e-11 Identities = 85/100 (85%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| || || ||||||||||||||||| || |||||||| || || |||| Sbjct: 587 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 528 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagac 458 | ||||| || || || || |||||||| ||||||||||| Sbjct: 527 ctttctttggatcagctgctgtggcgtaaacggtgtagac 488
>gb|AY079114.1| Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 762 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 568 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 509 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 508 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 457 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 275 ccgaaggtaacggcagggttaacgtggcc 247
>gb|AF419613.1|AF419613 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 1061 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 630 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 571 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 570 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 519 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 337 ccgaaggtaacggcagggttaacgtggcc 309
>gb|AF428341.1|AF428341 Arabidopsis thaliana AT3g26520/MFE16_3 mRNA, complete cds Length = 1066 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 635 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 576 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 575 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 524 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 342 ccgaaggtaacggcagggttaacgtggcc 314
>gb|AF004393.1|AF004393 Arabidopsis thaliana salt-stress induced tonoplast intrinsic protein mRNA, complete cds Length = 1072 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 642 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 583 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 582 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 531 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 349 ccgaaggtaacggcagggttaacgtggcc 321
>emb|BX822807.1|CNS0A75T Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB65ZD08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1010 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 618 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 559 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 558 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 507 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 325 ccgaaggtaacggcagggttaacgtggcc 297
>emb|BX822624.1|CNS0A742 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB53ZH08 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1020 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 616 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 557 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 556 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 505 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 323 ccgaaggtaacggcagggttaacgtggcc 295
>emb|BX824073.1|CNS0A6T2 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH1ZE06 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1008 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 616 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 557 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 556 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 505 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 323 ccgaaggtaacggcagggttaacgtggcc 295
>emb|BX822975.1|CNS0A733 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB78ZD01 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1054 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 607 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 548 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 547 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 496 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 314 ccgaaggtaacggcagggttaacgtggcc 286
>emb|BX824311.1|CNS0A6PE Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH38ZH05 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 995 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 625 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 566 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 565 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 514 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 332 ccgaaggtaacggcagggttaacgtggcc 304
>emb|BX823637.1|CNS0A6I3 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS5ZE05 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 960 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 439 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 380 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 379 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 328 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 146 ccgaaggtaacggcagggttaacgtggcc 118
>emb|BX823607.1|CNS0A6MK Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS56ZB09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1012 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 616 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 557 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 556 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 505 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 323 ccgaaggtaacggcagggttaacgtggcc 295
>dbj|AB028611.1| Arabidopsis thaliana genomic DNA, chromosome 3, P1 clone:MFE16 Length = 82646 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Plus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 15558 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 15617 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 15618 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 15669 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Plus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 16023 ccgaaggtaacggcagggttaacgtggcc 16051
>dbj|AB025628.1| Arabidopsis thaliana genomic DNA, chromosome 5, P1 clone:MNJ7 Length = 80117 Score = 79.8 bits (40), Expect = 1e-11 Identities = 85/100 (85%) Strand = Plus / Plus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||||||||| || || ||||||||||||||||| || |||||||| || || |||| Sbjct: 8647 cgaggatgttggcaccaactatgaagccgatggcgattggagcgatggtccctagcgatc 8706 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagac 458 | ||||| || || || || |||||||| ||||||||||| Sbjct: 8707 ctttctttggatcagctgctgtggcgtaaacggtgtagac 8746
>gb|AF118381.1|AF118381 Brassica napus tonoplast intrinsic protein (gamma-TIP2) mRNA, complete cds Length = 1020 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 577 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 518 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 517 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 466
>dbj|D84669.1| Raphanus sativus mRNA for VM23, complete sequence Length = 1054 Score = 79.8 bits (40), Expect = 1e-11 Identities = 94/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || ||||| || || ||||| || ||||| | Sbjct: 638 cgaggatgttagctccaacgatgaaacctatggcaattggtgcgattgttccgagactac 579 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | |||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 578 cgttcttggggtcgacggctgtggcgtaaacggtgtagacgagcccgaaggt 527
>emb|AJ245953.1|SOL245953 Spinacia oleracea mRNA for delta tonoplast intrinsic protein (dtip gene) Length = 1101 Score = 75.8 bits (38), Expect = 2e-10 Identities = 56/62 (90%) Strand = Plus / Minus Query: 610 ccggtgaggatggtgatctgaccgccgagcgcgaggccgaaggtgacggcagggttcacg 669 ||||||||||||||||| ||||||||||| || | ||||||||||||||| ||||| ||| Sbjct: 404 ccggtgaggatggtgatttgaccgccgagggccaagccgaaggtgacggcggggttgacg 345 Query: 670 tg 671 || Sbjct: 344 tg 343 Score = 44.1 bits (22), Expect = 0.59 Identities = 43/50 (86%) Strand = Plus / Minus Query: 307 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggc 356 ||||||||||| || || |||||||| ||||| || ||||| |||||||| Sbjct: 713 gggccgaatgaacgggctgggttcattgaaccaccagagaacgggccggc 664
>gb|DQ442393.1| Striga asiatica clone St461 aquaporin mRNA, partial cds Length = 493 Score = 71.9 bits (36), Expect = 3e-09 Identities = 90/108 (83%) Strand = Plus / Minus Query: 567 gccgacgatggcaccgaggagctgcgcaacccagtagaagaggccggtgaggatggtgat 626 |||||||| ||| || || ||||| |||| ||||||||| | ||||||||||||||||| Sbjct: 366 gccgacgacggcgcccagaagctgggcaatccagtagaatattccggtgaggatggtgat 307 Query: 627 ctgaccgccgagcgcgaggccgaaggtgacggcagggttcacgtggcc 674 || ||||| | ||| || || ||||||||||| ||||| |||||||| Sbjct: 306 ttggccgcccaccgccagcccaaaggtgacggccgggttgacgtggcc 259
>emb|BX822304.1|CNS0A7A0 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTFB27ZF06 of Flowers and buds of strain col-0 of Arabidopsis thaliana (thale cress) Length = 628 Score = 71.9 bits (36), Expect = 3e-09 Identities = 93/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 182 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 123 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| ||| |||||||| ||||||||||||||||||||||| Sbjct: 122 cgttcttggggtctacggttgtggcgtagacggtgtagacgagcccgaaggt 71
>emb|BX825064.1|CNS0A6TA Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH92ZF07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 931 Score = 71.9 bits (36), Expect = 3e-09 Identities = 93/112 (83%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| | |||||||| || ||||| ||||||| | Sbjct: 604 cgaggatgttcgctccaacgatgaaacttatggcgattggtgcgattttgccgagaatac 545 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 544 cgttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 493 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 311 ccgaaggtaacggcagggttgacgtggcc 283
>dbj|AB000506.1| Carrot mRNA for root specific gene, complete cds Length = 992 Score = 71.9 bits (36), Expect = 3e-09 Identities = 123/152 (80%) Strand = Plus / Minus Query: 307 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 366 ||||||||||| || || |||||||| || || ||| ||| ||||| ||| | | ||| Sbjct: 639 gggccgaatgatcgggccgggttcattgagccaccgctgaatgggccagcagccaaaatg 580 Query: 367 ttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttg 426 ||||| || |||||||| || ||||| ||||| || |||||||| || || ||||| ||| Sbjct: 579 ttggcaccaacgatgaaaccaatggcaatgggtgcaatggtgcctagtgagccctttttg 520 Query: 427 gggtcggcggcggtggcgtacacggtgtagac 458 || || ||||| |||||||| ||||||||||| Sbjct: 519 ggatccgcggctgtggcgtaaacggtgtagac 488
>emb|BX842211.1|CNS09YE1 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL65ZH05 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1014 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 421 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 546 ttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 497
>emb|BX842163.1|CNS09YDT Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH74ZE01 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 921 Score = 67.9 bits (34), Expect = 4e-08 Identities = 46/50 (92%) Strand = Plus / Minus Query: 421 ttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 ||||||||||| |||| |||||||| ||||||||||||||||||||||| Sbjct: 554 ttcttggggtcaacggctgtggcgtagacggtgtagacgagcccgaaggt 505 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 323 ccgaaggtaacggcagggttaacgtggcc 295
>emb|BX842138.1|CNS09YDN Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS54ZD02 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 1062 Score = 65.9 bits (33), Expect = 2e-07 Identities = 90/109 (82%) Strand = Plus / Minus Query: 362 ggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccct 421 ||||||| || || |||||||| || |||||||| || ||||| || ||||| || | Sbjct: 613 ggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactaccgt 554 Query: 422 tcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 |||||||||| |||| |||||||| |||||| |||||||||||||||| Sbjct: 553 tcttggggtcaacggctgtggcgtagacggtgcagacgagcccgaaggt 505 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 323 ccgaaggtaacggcagggttaacgtggcc 295
>gb|AF047173.1| Vernicia fordii aquaporin mRNA, complete cds Length = 1049 Score = 65.9 bits (33), Expect = 2e-07 Identities = 180/229 (78%) Strand = Plus / Minus Query: 263 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 322 |||||||||||||| ||| | |||||| ||||| | || || || ||||| ||||| | Sbjct: 736 cccagtagatccagttgtcgtggaagtcaccgcttaccacagctggcccgaaggagcggg 677 Query: 323 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 382 | |||| |||||| || || ||||| ||||| ||| | | |||||||| || || |||| Sbjct: 676 ctgggtacatggatccaccagagaatgggcctgcagccaaaatgttggcaccaacaatga 617 Query: 383 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtgg 442 | || ||||| ||||| || |||||||| || ||||| ||||||||||| || ||||| | Sbjct: 616 aaccaatggcaatgggagcaatggtgcctagtgatcctttcttggggtcagctgcggttg 557 Query: 443 cgtacacggtgtagacgagcccgaaggtgacgatgatctccatcaccac 491 | || || |||||||| | | || |||| |||||||||||| ||||| Sbjct: 556 catatactgtgtagaccaaagcaaatgtgatgatgatctccataaccac 508
>ref|XM_473251.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 798 Score = 63.9 bits (32), Expect = 6e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 428 ggtcggcggcggtggcgtacacggtgtagacgagcccgaa 467 ||||| |||||||||||||||||||||| ||||||||||| Sbjct: 517 ggtcgacggcggtggcgtacacggtgtacacgagcccgaa 478
>emb|AL663019.2|OSJN00221 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0038O10, complete sequence Length = 141545 Score = 63.9 bits (32), Expect = 6e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 428 ggtcggcggcggtggcgtacacggtgtagacgagcccgaa 467 ||||| |||||||||||||||||||||| ||||||||||| Sbjct: 131227 ggtcgacggcggtggcgtacacggtgtacacgagcccgaa 131188
>dbj|AK108116.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-139-C05, full insert sequence Length = 912 Score = 63.9 bits (32), Expect = 6e-07 Identities = 38/40 (95%) Strand = Plus / Minus Query: 428 ggtcggcggcggtggcgtacacggtgtagacgagcccgaa 467 ||||| |||||||||||||||||||||| ||||||||||| Sbjct: 583 ggtcgacggcggtggcgtacacggtgtacacgagcccgaa 544
>gb|AF057137.1|AF057137 Arabidopsis thaliana gamma tonoplast intrinsic protein 2 (TIP2) mRNA, complete cds Length = 1035 Score = 63.9 bits (32), Expect = 6e-07 Identities = 92/112 (82%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| Sbjct: 621 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactag 562 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 | |||||||| || |||| |||||||| ||||||||||||||||||||||| Sbjct: 561 cgttcttgggatcaacggctgtggcgtagacggtgtagacgagcccgaaggt 510 Score = 42.1 bits (21), Expect = 2.3 Identities = 27/29 (93%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtggcc 674 |||||||| ||||||||||| |||||||| Sbjct: 328 ccgaaggtaacggcagggttaacgtggcc 300
>gb|AF326505.1|AF326505 Zea mays tonoplast membrane integral protein ZmTIP4-1 mRNA, complete cds Length = 1125 Score = 61.9 bits (31), Expect = 3e-06 Identities = 112/139 (80%) Strand = Plus / Minus Query: 244 ccgccgatgagcgggccggcccagtagatccagatgttggtgaagtcgccgctggcaacg 303 ||||||| ||||||||| |||||||| |||| ||| || |||| ||| |||| | | Sbjct: 825 ccgccgagcagcgggccgatccagtagacccagtggtttgtccagtccccggtggccagg 766 Query: 304 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 363 || |||||||| |||||||| ||||||||||| |||||| |||| |||| | ||||| Sbjct: 765 gccgggccgaaggagcgtgccgggttcatggacgcgccggtgaagttgccgccggcgagg 706 Query: 364 atgttggccccgacgatga 382 ||||||| |||||||||| Sbjct: 705 ctgttggcgccgacgatga 687
>ref|NM_188624.1| Oryza sativa (japonica cultivar-group), Ozsa8227 predicted mRNA Length = 756 Score = 60.0 bits (30), Expect = 1e-05 Identities = 69/82 (84%) Strand = Plus / Minus Query: 307 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 366 |||||||| ||||| || ||||||||||| |||||||| |||| ||| | |||||||| Sbjct: 608 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 549 Query: 367 ttggccccgacgatgaagccga 388 ||||| ||||||| || ||||| Sbjct: 548 ttggcgccgacgacgaggccga 527
>emb|X95650.1|TGTIP1GEN T.gesneriana mRNA for tonoplast intrinsic protein Length = 992 Score = 60.0 bits (30), Expect = 1e-05 Identities = 84/102 (82%) Strand = Plus / Minus Query: 364 atgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttc 423 |||||||| ||||||||||| ||||| || ||||| |||||||| || | |||||| Sbjct: 580 atgttggcaccgacgatgaatccgatcgcaatgggagcgatggttccaatatcccccttc 521 Query: 424 ttggggtcggcggcggtggcgtacacggtgtagacgagcccg 465 ||||| ||| | || || |||||||| ||||||||||||||| Sbjct: 520 ttgggatcgacagcagtagcgtacacagtgtagacgagcccg 479 Score = 52.0 bits (26), Expect = 0.002 Identities = 29/30 (96%) Strand = Plus / Minus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||||||||| ||||| Sbjct: 296 gccgaaggtgacggcagggttcacatggcc 267
>emb|AJ843991.1| Plantago major partial mRNA for aquaporin 1 (aqp1 gene) Length = 871 Score = 60.0 bits (30), Expect = 1e-05 Identities = 144/182 (79%) Strand = Plus / Minus Query: 307 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 366 ||||||||||| || || ||||||||||| || || ||| ||||||||| | | ||| Sbjct: 565 gggccgaatgatcgggctgggttcatggatccaccactgaatgggccggcagccaaaatg 506 Query: 367 ttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttg 426 ||||| || || ||||| || || || || ||||| || || || || || ||||||||| Sbjct: 505 ttggctccaacaatgaatccaattgccattggggcaattgttccaagtgaacccttcttg 446 Query: 427 gggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatgatctccatc 486 ||||| || || ||||| ||||| |||||||| || | ||||||| |||||| |||||| Sbjct: 445 gggtcagctgctgtggcatacacagtgtagactagggcaaaggtgatgatgatttccatc 386 Query: 487 ac 488 || Sbjct: 385 ac 384 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 592 gcaacccagtagaagaggccggtgaggatggtgat 626 |||| ||||||||||||||| |||| ||||||||| Sbjct: 274 gcaatccagtagaagaggccagtgatgatggtgat 240
>gb|AF290618.1|AF290618 Nicotiana glauca putative delta TIP (MIP2) mRNA, complete cds Length = 1072 Score = 60.0 bits (30), Expect = 1e-05 Identities = 81/98 (82%) Strand = Plus / Minus Query: 259 ccggcccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgag 318 ||||||||||| |||||| |||| ||||||||||| ||||| || || || || ||||| Sbjct: 719 ccggcccagtaaatccagttgttagtgaagtcgccactggccacagcaggcccaaatgaa 660 Query: 319 cgtgcagggttcatggaaccgccggagaaggggccggc 356 || || || ||||| || || |||||||| |||||||| Sbjct: 659 cgggccggattcattgatccaccggagaatgggccggc 622
>dbj|AP001550.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0431F01 Length = 143209 Score = 60.0 bits (30), Expect = 1e-05 Identities = 69/82 (84%) Strand = Plus / Minus Query: 307 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 366 |||||||| ||||| || ||||||||||| |||||||| |||| ||| | |||||||| Sbjct: 98901 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 98842 Query: 367 ttggccccgacgatgaagccga 388 ||||| ||||||| || ||||| Sbjct: 98841 ttggcgccgacgacgaggccga 98820
>dbj|AK069192.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023007E01, full insert sequence Length = 1112 Score = 60.0 bits (30), Expect = 1e-05 Identities = 69/82 (84%) Strand = Plus / Minus Query: 307 gggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgaggatg 366 |||||||| ||||| || ||||||||||| |||||||| |||| ||| | |||||||| Sbjct: 611 gggccgaaggagcgggccgggttcatggaggcgccggagtagggcccgccggcgaggatg 552 Query: 367 ttggccccgacgatgaagccga 388 ||||| ||||||| || ||||| Sbjct: 551 ttggcgccgacgacgaggccga 530
>gb|AF133531.1|AF133531 Mesembryanthemum crystallinum water channel protein MipI (MipI) mRNA, complete cds Length = 1035 Score = 58.0 bits (29), Expect = 4e-05 Identities = 47/53 (88%) Strand = Plus / Minus Query: 418 cccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 |||||||||||||| | || |||||||| ||||||||||| ||||||||||| Sbjct: 576 cccttcttggggtcaacagcagtggcgtagacggtgtagacaagcccgaaggt 524 Score = 44.1 bits (22), Expect = 0.59 Identities = 25/26 (96%) Strand = Plus / Minus Query: 646 ccgaaggtgacggcagggttcacgtg 671 ||||||||||| |||||||||||||| Sbjct: 342 ccgaaggtgacagcagggttcacgtg 317
>dbj|AB012271.1| Aster tripolium mRNA for SAMIPE, partial cds Length = 321 Score = 58.0 bits (29), Expect = 4e-05 Identities = 77/93 (82%) Strand = Plus / Minus Query: 363 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 422 ||||||||| |||||||| |||||||||||||| || || || ||||| | | ||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggcgatcggtgcaattgtgcccaatgcaccctt 262 Query: 423 cttggggtcggcggcggtggcgtacacggtgta 455 ||||||||| ||||||||||| |||||||| Sbjct: 261 cttggggtcacatgcggtggcgtaaacggtgta 229
>ref|XM_466869.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1214 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctcc 483 ||||||||||||||| |||||||| ||||||||||| Sbjct: 633 acggtgtagacgagcacgaaggtgccgatgatctcc 598
>gb|AY243802.1| Zea mays aquaporin (PIP2-5) mRNA, complete cds Length = 1104 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctcc 483 ||||||||||||||| |||||||| ||||||||||| Sbjct: 557 acggtgtagacgagcacgaaggtgccgatgatctcc 522 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggtt 665 |||||||||||||||||| ||||| Sbjct: 345 gaggccgaaggtgacggccgggtt 322
>emb|Z48232.1|PCRB7PRJ P.crispum mRNA for membrane intrinsic protein Length = 954 Score = 56.0 bits (28), Expect = 2e-04 Identities = 85/104 (81%) Strand = Plus / Minus Query: 379 atgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcg 438 |||||||| || || ||||| || ||||| || || || |||||||||||||| || || Sbjct: 586 atgaagccaattgcaatgggtgcaatggttccaagtgagcccttcttggggtctgcagca 527 Query: 439 gtggcgtacacggtgtagacgagcccgaaggtgacgatgatctc 482 |||||||| | ||||||||| || | ||||||| ||||||||| Sbjct: 526 gtggcgtagaaggtgtagaccagagcaaaggtgatgatgatctc 483
>gb|AC183495.1| Brassica oleracea Contig A, complete sequence Length = 356505 Score = 56.0 bits (28), Expect = 2e-04 Identities = 82/100 (82%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 ||||||| ||||| || |||||||| || || ||||| || || ||||| ||||| |||| Sbjct: 101446 cgaggatattggcaccaacgatgaaaccaatagcgatcggagcaatggttccgagcgatc 101387 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagac 458 |||| || || || || ||||||||||| ||||| ||||| Sbjct: 101386 ccttttttggatcagcagcggtggcgtaaacggtatagac 101347
>gb|AF326508.1|AF326508 Zea mays tonoplast membrane integral protein ZmTIP4-4 mRNA, complete cds Length = 955 Score = 56.0 bits (28), Expect = 2e-04 Identities = 64/76 (84%) Strand = Plus / Minus Query: 304 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaaggggccggcaacgagg 363 ||||||||||| ||||| || ||||||||||| ||||||||||||| ||| | |||| Sbjct: 708 gcggggccgaaggagcgcgcggggttcatggacgcgccggagaagggcccgccggcgagc 649 Query: 364 atgttggccccgacga 379 | |||||| ||||||| Sbjct: 648 acgttggcgccgacga 633
>gb|AF130975.1|AF130975 Zea mays plasma membrane intrinsic protein (pip2-5) mRNA, complete cds Length = 1207 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctcc 483 ||||||||||||||| |||||||| ||||||||||| Sbjct: 612 acggtgtagacgagcacgaaggtgccgatgatctcc 577 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggtt 665 |||||||||||||||||| ||||| Sbjct: 400 gaggccgaaggtgacggccgggtt 377
>emb|BX823560.1|CNS0A7QS Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS51ZB01 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 676 Score = 56.0 bits (28), Expect = 2e-04 Identities = 88/108 (81%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || | |||||| || ||||| || ||||| | Sbjct: 237 cgaggatgttcgctccaacgatgaaacccaaggcgattggtgcgattgttccgagacgac 178 Query: 419 ccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccga 466 | ||||||||||| |||| ||||||| ||||||||||||||||||| Sbjct: 177 cgttcttggggtcaacggctgtggcgtcgacggtgtagacgagcccga 130
>dbj|AP006168.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 2, BAC clone:B1469H02 Length = 136602 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctcc 483 ||||||||||||||| |||||||| ||||||||||| Sbjct: 82504 acggtgtagacgagcacgaaggtgccgatgatctcc 82469
>dbj|AK061782.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-039-E03, full insert sequence Length = 1214 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctcc 483 ||||||||||||||| |||||||| ||||||||||| Sbjct: 633 acggtgtagacgagcacgaaggtgccgatgatctcc 598
>gb|U43291.1|MCU43291 Mesembryanthemum crystallinum tonoplast intrinsic protein (TIP) mRNA, complete cds Length = 1235 Score = 56.0 bits (28), Expect = 2e-04 Identities = 88/108 (81%) Strand = Plus / Minus Query: 363 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 422 ||||||||| || |||||||| || ||||| || ||||| ||| | |||||| || | Sbjct: 612 gatgttggctccaacgatgaaaccaatggcaattggggcaatgattccgaggttgcctct 553 Query: 423 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 |||| ||||| ||| |||||||||||||||||||| || |||||||| Sbjct: 552 cttgtggtcgatggccgtggcgtacacggtgtagaccaggccgaaggt 505
>gb|L12257.1|SOYNODA Glycine max nodulin-26 mRNA, complete cds Length = 1047 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 241 ccaccgccgatgagcgggccggcccagtagatccag 276 ||||| |||||||| ||||||||||||||||||||| Sbjct: 788 ccacctccgatgagagggccggcccagtagatccag 753 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Minus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 ||||||||||||||| ||||| |||||||| Sbjct: 384 gccgaaggtgacggcggggttgacgtggcc 355
>dbj|AB012270.1| Aster tripolium mRNA for SAMIPD, partial cds Length = 321 Score = 56.0 bits (28), Expect = 2e-04 Identities = 34/36 (94%) Strand = Plus / Minus Query: 363 gatgttggccccgacgatgaagccgatggcgatggg 398 ||||||||| |||||||||||||||||||| ||||| Sbjct: 321 gatgttggcgccgacgatgaagccgatggcaatggg 286
>dbj|AB012267.1| Aster tripolium mRNA for SAMIPA, partial cds Length = 321 Score = 56.0 bits (28), Expect = 2e-04 Identities = 76/92 (82%) Strand = Plus / Minus Query: 367 ttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttg 426 ||||| |||||||| |||||||||||||| || || ||||| || || |||||||| || Sbjct: 317 ttggcgccgacgataaagccgatggcgattggtgcaatggttcctagtgatcccttttta 258 Query: 427 gggtcggcggcggtggcgtacacggtgtagac 458 ||||| || || || ||||| || |||||||| Sbjct: 257 gggtcagctgcagtcgcgtaaactgtgtagac 226
>ref|NM_187092.2| Oryza sativa (japonica cultivar-group), mRNA Length = 1242 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 676 acggtgtagacgagcacgaaggtgccgatgatctc 642
>ref|XM_507363.1| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117 mRNA Length = 1257 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 678 acggtgtagacgagcacgaaggtgccgatgatctc 644
>ref|XM_506304.2| PREDICTED Oryza sativa (japonica cultivar-group), OJ1047_A06.117 mRNA Length = 1298 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 679 acggtgtagacgagcacgaaggtgccgatgatctc 645
>ref|XM_473219.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 873 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 569 acggtgtagacgagcacgaaggtgccgatgatctc 535
>gb|BT016583.1| Zea mays clone Contig416 mRNA sequence Length = 1348 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 622 acggtgtagacgagcacgaaggtgccgatgatctc 588 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| | |||||| Sbjct: 410 gaggccgaaggtgacggcggggttgatgtggcc 378
>gb|AY243801.1| Zea mays aquaporin (PIP2-1) mRNA, complete cds Length = 1133 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 570 acggtgtagacgagcacgaaggtgccgatgatctc 536 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| | |||||| Sbjct: 358 gaggccgaaggtgacggcggggttgatgtggcc 326
>gb|AF388171.1|AF388171 Triticum boeoticum plasma membrane intrinsic protein 2 (PIP2) mRNA, partial cds Length = 411 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 221 acggtgtagacgagcacgaaggtgccgatgatctc 187
>dbj|AP008213.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, complete sequence Length = 29644043 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 15353540 acggtgtagacgagcacgaaggtgccgatgatctc 15353506 Score = 44.1 bits (22), Expect = 0.59 Identities = 22/22 (100%) Strand = Plus / Plus Query: 605 agaggccggtgaggatggtgat 626 |||||||||||||||||||||| Sbjct: 19919781 agaggccggtgaggatggtgat 19919802
>gb|AF326493.1|AF326493 Zea mays plasma membrane integral protein ZmPIP2-3 mRNA, complete cds Length = 1156 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 643 acggtgtagacgagcacgaaggtgccgatgatctc 609
>gb|AF326491.1|AF326491 Zea mays plasma membrane integral protein ZmPIP2-1 mRNA, complete cds Length = 1171 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 641 acggtgtagacgagcacgaaggtgccgatgatctc 607 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| | |||||| Sbjct: 429 gaggccgaaggtgacggcggggttgatgtggcc 397
>dbj|AB219525.1| Hordeum vulgare HvPIP2;4 mRNA for PIP aquaporin isoform, complete cds Length = 1343 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 639 acggtgtagacgagcacgaaggtgccgatgatctc 605
>dbj|AB029446.1| Oryza sativa (indica cultivar-group) rwc-2 mRNA for water channel protein, partial cds Length = 880 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 242 acggtgtagacgagcacgaaggtgccgatgatctc 208
>dbj|AP003802.2| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OJ1047_A06 Length = 111673 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 60539 acggtgtagacgagcacgaaggtgccgatgatctc 60505
>dbj|AP004668.3| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, PAC clone:P0475E07 Length = 139961 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 139553 acggtgtagacgagcacgaaggtgccgatgatctc 139519
>dbj|AK119656.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-130-H04, full insert sequence Length = 1216 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 676 acggtgtagacgagcacgaaggtgccgatgatctc 642
>dbj|AK105524.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-127-G02, full insert sequence Length = 1451 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 270 acggtgtagacgagcacgaaggtgccgatgatctc 236
>dbj|AK103970.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-B05, full insert sequence Length = 1242 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 676 acggtgtagacgagcacgaaggtgccgatgatctc 642
>dbj|AK103938.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-013-G03, full insert sequence Length = 1257 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 678 acggtgtagacgagcacgaaggtgccgatgatctc 644
>dbj|AK072519.1| Oryza sativa (japonica cultivar-group) cDNA clone:J023128K12, full insert sequence Length = 1298 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 679 acggtgtagacgagcacgaaggtgccgatgatctc 645
>gb|AF062393.1|AF062393 Oryza sativa aquaporin (PIP2a) mRNA, complete cds Length = 1328 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 666 acggtgtagacgagcacgaaggtgccgatgatctc 632
>gb|AY109332.1| Zea mays CL502_5 mRNA sequence Length = 1969 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 71 acggtgtagacgagcacgaaggtgccgatgatctc 37
>gb|AF133533.1|AF133533 Mesembryanthemum crystallinum water channel protein MipL (MipL) mRNA, partial cds Length = 768 Score = 54.0 bits (27), Expect = 6e-04 Identities = 60/71 (84%) Strand = Plus / Minus Query: 418 cccttcttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggtgacgatg 477 |||||||| ||||| || |||||||| || ||||||||||| || | ||||||| || | Sbjct: 368 cccttctttgggtcagctgcggtggcatagacggtgtagacaagtgcaaaggtgatgacg 309 Query: 478 atctccatcac 488 ||||||||||| Sbjct: 308 atctccatcac 298 Score = 48.1 bits (24), Expect = 0.038 Identities = 39/44 (88%) Strand = Plus / Minus Query: 592 gcaacccagtagaagaggccggtgaggatggtgatctgaccgcc 635 ||||||||||||| |||||| ||||||| |||||| || ||||| Sbjct: 188 gcaacccagtagatgaggccagtgaggacggtgatgtggccgcc 145
>emb|AL662958.3|OSJN00156 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0019D11, complete sequence Length = 163039 Score = 54.0 bits (27), Expect = 6e-04 Identities = 33/35 (94%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||||||| |||||||||| Sbjct: 107669 acggtgtagacgagcacgaaggtgccgatgatctc 107635
>dbj|AB012269.1| Aster tripolium mRNA for SAMIPC, partial cds Length = 321 Score = 54.0 bits (27), Expect = 6e-04 Identities = 51/59 (86%) Strand = Plus / Minus Query: 373 ccgacgatgaagccgatggcgatgggggcgatggtgccgagggatcccttcttggggtc 431 |||||||||||||||||||||| || || ||||| |||| || |||||||||||||| Sbjct: 311 ccgacgatgaagccgatggcgactggtgcaatggttccgaacgagcccttcttggggtc 253
>ref|NM_117838.2| Arabidopsis thaliana DELTA-TIP2/TIP2;2; water channel AT4G17340 (DELTA-TIP2/TIP2;2) mRNA, complete cds Length = 977 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 658 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 599 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 598 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 539 Query: 445 tacacggtgtagac 458 || || |||||||| Sbjct: 538 tagactgtgtagac 525
>emb|Z97343.1|ATFCA8 Arabidopsis thaliana DNA chromosome 4, ESSA I FCA contig fragment No. 8 Length = 207674 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 64861 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 64802 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 64801 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 64742 Query: 445 tacacggtgtagac 458 || || |||||||| Sbjct: 64741 tagactgtgtagac 64728
>emb|AL161546.2|ATCHRIV46 Arabidopsis thaliana DNA chromosome 4, contig fragment No. 46 Length = 198788 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 54226 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 54167 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 54166 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 54107 Query: 445 tacacggtgtagac 458 || || |||||||| Sbjct: 54106 tagactgtgtagac 54093
>gb|AY056063.1| Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds Length = 753 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 593 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 534 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 533 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 474 Query: 445 tacacggtgtagac 458 || || |||||||| Sbjct: 473 tagactgtgtagac 460
>gb|AF367283.1|AF367283 Arabidopsis thaliana AT4g17340/dl4705w mRNA, complete cds Length = 972 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 655 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 596 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 595 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 536 Query: 445 tacacggtgtagac 458 || || |||||||| Sbjct: 535 tagactgtgtagac 522
>emb|BX823744.1|CNS0A6NJ Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTLS71ZE09 of Adult vegetative tissue of strain col-0 of Arabidopsis thaliana (thale cress) Length = 573 Score = 52.0 bits (26), Expect = 0.002 Identities = 94/114 (82%), Gaps = 2/114 (1%) Strand = Plus / Minus Query: 359 cgaggatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatc 418 |||||||||| || || |||||||| || |||||||| || ||||| || ||||| | Sbjct: 143 cgaggatgttagctccaacgatgaaacctatggcgattggtgcgattgttccgagactac 84 Query: 419 ccttcttggggtcggcgg-cggtggcgtacacgg-tgtagacgagcccgaaggt 470 | ||||||||||| ||| | |||||||| |||| ||||||||||||||||||| Sbjct: 83 cgttcttggggtcaacgggctgtggcgtagacgggtgtagacgagcccgaaggt 30
>emb|BX825196.1|CNS0A4OU Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTSIL1ZB11 of Silique of strain col-0 of Arabidopsis thaliana (thale cress) Length = 954 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 641 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 582 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 581 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 522 Query: 445 tacacggtgtagac 458 || || |||||||| Sbjct: 521 tagactgtgtagac 508
>emb|BX828364.1|CNS0A340 Arabidopsis thaliana Full-length cDNA Complete sequence from clone GSLTPGH80ZD07 of Hormone Treated Callus of strain col-0 of Arabidopsis thaliana (thale cress) Length = 936 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 616 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 557 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 556 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 497 Query: 445 tacacggtgtagac 458 || || |||||||| Sbjct: 496 tagactgtgtagac 483
>dbj|AB206106.1| Mimosa pudica tip2;1 mRNA for tonoplast intrinsic protein 2;1, complete cds Length = 1001 Score = 52.0 bits (26), Expect = 0.002 Identities = 158/202 (78%) Strand = Plus / Minus Query: 263 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 322 |||||||||||||| |||||||||||| ||| | |||| ||||||||||| || | Sbjct: 707 cccagtagatccagtagttggtgaagtcaccggatacggcggctgggccgaatgaacggg 648 Query: 323 cagggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatga 382 | |||||||| |||||||| || ||||||||| | | ||||||||| || || |||| Sbjct: 647 ccgggttcattgaaccgccactaaatgggccggcagccaagatgttggcaccaacaatga 588 Query: 383 agccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtgg 442 |||| || || ||||| || || |||| | |||||||| |||||||| || || |||| Sbjct: 587 agcctattgcaatgggtgcaataatgcccaatgatccctttttggggtcagcagctgtgg 528 Query: 443 cgtacacggtgtagacgagccc 464 | || || ||||| || ||||| Sbjct: 527 cataaacagtgtatacaagccc 506
>gb|AY088929.1| Arabidopsis thaliana clone 99796 mRNA, complete sequence Length = 969 Score = 52.0 bits (26), Expect = 0.002 Identities = 107/134 (79%) Strand = Plus / Minus Query: 325 gggttcatggaaccgccggagaaggggccggcaacgaggatgttggccccgacgatgaag 384 |||||||||||||| ||| ||||| || || ||||||||||||| || |||||||| Sbjct: 659 gggttcatggaaccaccgctaaagggacccgctgcgaggatgttggcaccaacgatgaaa 600 Query: 385 ccgatggcgatgggggcgatggtgccgagggatcccttcttggggtcggcggcggtggcg 444 ||||| || || || || ||||| ||||| || || ||||| || || || || |||||| Sbjct: 599 ccgatagcaattggagcaatggtcccgagtgaacctttctttggatcagccgctgtggcg 540 Query: 445 tacacggtgtagac 458 || || |||||||| Sbjct: 539 tagactgtgtagac 526
>gb|AF275315.1|AF275315 Lotus japonicus water-selective transport intrinsic membrane protein 1 mRNA, complete cds Length = 1162 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| |||||||| Sbjct: 335 gaggccgaaggtgacggcggggttgacgtggcc 303
>dbj|AP004479.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT03H13, TM0012b, complete sequence Length = 41820 Score = 50.1 bits (25), Expect = 0.010 Identities = 31/33 (93%) Strand = Plus / Plus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| |||||||| Sbjct: 10570 gaggccgaaggtgacggcggggttgacgtggcc 10602
>emb|AJ271796.1|ZMA271796 Zea mays mRNA for plasma membrane intrinsic protein (pip4 gene) Length = 1364 Score = 48.1 bits (24), Expect = 0.038 Identities = 33/36 (91%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctcc 483 ||||||||||||||| |||||||| ||| ||||||| Sbjct: 662 acggtgtagacgagcacgaaggtgccgacgatctcc 627 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| | |||||| Sbjct: 450 gaggccgaaggtgacggccgggttgatgtggcc 418
>emb|AJ243309.1|PSA243309 Pisum sativum mRNA for putative tonoplast intrinsic protein (gene tip1-1) Length = 1104 Score = 48.1 bits (24), Expect = 0.038 Identities = 33/36 (91%) Strand = Plus / Minus Query: 241 ccaccgccgatgagcgggccggcccagtagatccag 276 ||||| ||||| || ||||||||||||||||||||| Sbjct: 755 ccaccaccgataagtgggccggcccagtagatccag 720
>gb|U92651.2|BOU92651 Brassica oleracea var. botrytis tonoplast intrinsic protein bobTIP26-1 mRNA, complete cds Length = 942 Score = 48.1 bits (24), Expect = 0.038 Identities = 87/108 (80%) Strand = Plus / Minus Query: 363 gatgttggccccgacgatgaagccgatggcgatgggggcgatggtgccgagggatccctt 422 ||||||||| || || ||||| ||||| |||||||| || || || || || ||| || Sbjct: 597 gatgttggcaccaacaatgaaaccgatagcgatgggagctattgttccaagacttccgtt 538 Query: 423 cttggggtcggcggcggtggcgtacacggtgtagacgagcccgaaggt 470 |||||| || ||||||||||||| || ||||| || ||||||||||| Sbjct: 537 cttgggatcaacggcggtggcgtagactgtgtaaactagcccgaaggt 490
>gb|AF326509.1|AF326509 Zea mays tonoplast membrane integral protein ZmTIP5-1 mRNA, complete cds Length = 1021 Score = 48.1 bits (24), Expect = 0.038 Identities = 45/52 (86%) Strand = Plus / Minus Query: 284 tgaagtcgccgctggcaacggcggggccgaatgagcgtgcagggttcatgga 335 |||||| ||||||| | ||||| |||||||| ||||| || ||||||||||| Sbjct: 719 tgaagtggccgctgacgacggccgggccgaacgagcgggccgggttcatgga 668 Score = 40.1 bits (20), Expect = 9.2 Identities = 26/28 (92%) Strand = Plus / Minus Query: 647 cgaaggtgacggcagggttcacgtggcc 674 |||| |||||||||||||| |||||||| Sbjct: 323 cgaacgtgacggcagggttgacgtggcc 296
>gb|AF326489.1|AF326489 Zea mays plasma membrane integral protein ZmPIP1-5 mRNA, complete cds Length = 1338 Score = 48.1 bits (24), Expect = 0.038 Identities = 33/36 (91%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctcc 483 ||||||||||||||| |||||||| ||| ||||||| Sbjct: 653 acggtgtagacgagcacgaaggtgccgacgatctcc 618 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| | |||||| Sbjct: 441 gaggccgaaggtgacggccgggttgatgtggcc 409
>dbj|AB219366.1| Hordeum vulgare HvPIP2;1 mRNA for PIP aquaporin, complete cds Length = 1318 Score = 48.1 bits (24), Expect = 0.038 Identities = 30/32 (93%) Strand = Plus / Minus Query: 451 gtgtagacgagcccgaaggtgacgatgatctc 482 |||||||||||| |||||||| |||||||||| Sbjct: 692 gtgtagacgagcacgaaggtgccgatgatctc 661
>gb|AY107675.1| Zea mays PCO112712 mRNA sequence Length = 791 Score = 48.1 bits (24), Expect = 0.038 Identities = 33/36 (91%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctcc 483 ||||||||||||||| |||||||| ||| ||||||| Sbjct: 86 acggtgtagacgagcacgaaggtgccgacgatctcc 51
>dbj|AB009307.1| Hordeum vulgare HvPIP2;1 mRNA, complete cd Length = 1251 Score = 48.1 bits (24), Expect = 0.038 Identities = 30/32 (93%) Strand = Plus / Minus Query: 451 gtgtagacgagcccgaaggtgacgatgatctc 482 |||||||||||| |||||||| |||||||||| Sbjct: 612 gtgtagacgagcacgaaggtgccgatgatctc 581
>gb|AE016825.1| Chromobacterium violaceum ATCC 12472, complete genome Length = 4751080 Score = 48.1 bits (24), Expect = 0.038 Identities = 33/36 (91%) Strand = Plus / Minus Query: 368 tggccccgacgatgaagccgatggcgatgggggcga 403 |||| ||||||||||||||| || |||||||||||| Sbjct: 3239016 tggcgccgacgatgaagccggtgacgatgggggcga 3238981
>ref|XM_470886.1| Oryza sativa (japonica cultivar-group), mRNA Length = 1812 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 275 agatgttggtgaagtcgccgctg 297 ||||||||||||||||||||||| Sbjct: 877 agatgttggtgaagtcgccgctg 855
>gb|BT018182.1| Zea mays clone EL01N0557H10.c mRNA sequence Length = 1215 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||| ||| |||||||||| Sbjct: 661 acggtgtagacgagcacgaacgtgccgatgatctc 627
>gb|AC091787.6| Oryza sativa (japonica cultivar-group) chromosome 3 clone OSJNBa0087G11, complete sequence Length = 169728 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Plus Query: 275 agatgttggtgaagtcgccgctg 297 ||||||||||||||||||||||| Sbjct: 59831 agatgttggtgaagtcgccgctg 59853
>emb|X76911.1|HVEMIP H.vulgare mRNA for transmembrane protein Length = 1225 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 |||||||||||||| |||||||| |||||||||| Sbjct: 651 acggtgtagacgaggacgaaggtgccgatgatctc 617
>emb|AL606622.3|OSJN00059 Oryza sativa genomic DNA, chromosome 4, BAC clone: OSJNBa0004N05, complete sequence Length = 158601 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Plus Query: 275 agatgttggtgaagtcgccgctg 297 ||||||||||||||||||||||| Sbjct: 106408 agatgttggtgaagtcgccgctg 106430
>emb|AJ310639.1|HVU310639 Hordeum vulgare partial pip1 gene for putative aquaporin Length = 1291 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 |||||||||||||| |||||||| |||||||||| Sbjct: 368 acggtgtagacgaggacgaaggtgccgatgatctc 334
>gb|CP000250.1| Rhodopseudomonas palustris HaA2, complete genome Length = 5331656 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Minus Query: 231 gccggcgaggccaccgccgatga 253 ||||||||||||||||||||||| Sbjct: 505313 gccggcgaggccaccgccgatga 505291 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 231 gccggcgaggccaccgccga 250 |||||||||||||||||||| Sbjct: 1274146 gccggcgaggccaccgccga 1274165
>gb|AF342809.1|AF342809 Zea mays tonoplast membrane integral protein ZmTIP3-2 mRNA, complete cds Length = 1156 Score = 46.1 bits (23), Expect = 0.15 Identities = 26/27 (96%) Strand = Plus / Minus Query: 645 gccgaaggtgacggcagggttcacgtg 671 ||||||||||||||| ||||||||||| Sbjct: 407 gccgaaggtgacggccgggttcacgtg 381
>gb|AF326495.1|AF326495 Zea mays plasma membrane integral protein ZmPIP2-6 mRNA, complete cds Length = 1257 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| ||||||| |||||||||| Sbjct: 653 acggtgtagacgagcacgaaggtaccgatgatctc 619
>gb|AF326494.1|AF326494 Zea mays plasma membrane integral protein ZmPIP2-4 mRNA, complete cds Length = 1171 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 ||||||||||||||| |||| ||| |||||||||| Sbjct: 653 acggtgtagacgagcacgaacgtgccgatgatctc 619
>dbj|AK107457.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-128-C11, full insert sequence Length = 1679 Score = 46.1 bits (23), Expect = 0.15 Identities = 23/23 (100%) Strand = Plus / Plus Query: 275 agatgttggtgaagtcgccgctg 297 ||||||||||||||||||||||| Sbjct: 794 agatgttggtgaagtcgccgctg 816
>gb|DQ149581.1| Xerophyta humilis PIP1 aquaporin mRNA, complete cds Length = 1262 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 |||||||||||||| |||||||| |||||||||| Sbjct: 663 acggtgtagacgaggacgaaggtgccgatgatctc 629
>gb|AY902360.1| Triticum aestivum water channel protein PIP4 (AQP) gene, partial sequence Length = 645 Score = 46.1 bits (23), Expect = 0.15 Identities = 32/35 (91%) Strand = Plus / Plus Query: 448 acggtgtagacgagcccgaaggtgacgatgatctc 482 |||||||||||||| |||||||| |||||||||| Sbjct: 233 acggtgtagacgaggacgaaggtgccgatgatctc 267
>ref|NM_187411.1| Oryza sativa (japonica cultivar-group), mRNA Length = 921 Score = 44.1 bits (22), Expect = 0.59 Identities = 22/22 (100%) Strand = Plus / Minus Query: 605 agaggccggtgaggatggtgat 626 |||||||||||||||||||||| Sbjct: 457 agaggccggtgaggatggtgat 436
>gb|BT016509.1| Zea mays clone Contig342 mRNA sequence Length = 1237 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Minus Query: 645 gccgaaggtgacggcagggttcacgtggcc 674 ||||||||||||||| ||||| |||||||| Sbjct: 432 gccgaaggtgacggccgggttgacgtggcc 403
>ref|XM_856403.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 2 (LOC607978), mRNA Length = 1082 Score = 44.1 bits (22), Expect = 0.59 Identities = 40/46 (86%) Strand = Plus / Minus Query: 303 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 348 |||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 588 ggcggggccgaaggagcgggccgggttcatggagcagccggtgaag 543
>ref|XM_845359.1| PREDICTED: Canis familiaris similar to aquaporin 6, transcript variant 1 (LOC607978), mRNA Length = 1067 Score = 44.1 bits (22), Expect = 0.59 Identities = 40/46 (86%) Strand = Plus / Minus Query: 303 ggcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 348 |||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 573 ggcggggccgaaggagcgggccgggttcatggagcagccggtgaag 528
>dbj|AP005103.5| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 7, BAC clone:OSJNBa0036M16 Length = 158880 Score = 44.1 bits (22), Expect = 0.59 Identities = 22/22 (100%) Strand = Plus / Plus Query: 605 agaggccggtgaggatggtgat 626 |||||||||||||||||||||| Sbjct: 84431 agaggccggtgaggatggtgat 84452
>dbj|AB012272.1| Aster tripolium mRNA for SAMIPF, partial cds Length = 321 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Minus Query: 363 gatgttggccccgacgatgaagccgatggc 392 ||||||||| |||||||| ||||||||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292
>dbj|AB012268.1| Aster tripolium mRNA for SAMIPB, partial cds Length = 321 Score = 44.1 bits (22), Expect = 0.59 Identities = 28/30 (93%) Strand = Plus / Minus Query: 363 gatgttggccccgacgatgaagccgatggc 392 ||||||||| |||||||| ||||||||||| Sbjct: 321 gatgttggcgccgacgataaagccgatggc 292
>ref|NM_188789.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 639 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 429 gtcggcggcggtggcgtacacggtg 453 ||||||||||| ||||||||||||| Sbjct: 342 gtcggcggcggcggcgtacacggtg 318
>ref|NM_197137.1| Oryza sativa (japonica cultivar-group) putative beta-tonoplast intrinsic protein (OSJNBa0051D19.19), mRNA Length = 1186 Score = 42.1 bits (21), Expect = 2.3 Identities = 36/41 (87%) Strand = Plus / Minus Query: 569 cgacgatggcaccgaggagctgcgcaacccagtagaagagg 609 |||||| ||| ||||||||||| || | ||||||||||||| Sbjct: 512 cgacgacggcgccgaggagctgggcgagccagtagaagagg 472
>gb|DQ226889.1| Boechera divaricarpa isolate SLW-D-E07 mRNA sequence Length = 980 Score = 42.1 bits (21), Expect = 2.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 232 ccggcgaggccaccgccgatgagcgggccggcccagtagatccag 276 ||||||| |||||||||| ||| || ||||||||||||| |||| Sbjct: 705 ccggcgattccaccgccgacgagaggtccggcccagtagacccag 661
>ref|XM_001003742.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA Length = 890 Score = 42.1 bits (21), Expect = 2.3 Identities = 33/37 (89%) Strand = Plus / Minus Query: 301 acggcggggccgaatgagcgtgcagggttcatggaac 337 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577
>ref|XM_994651.1| PREDICTED: Mus musculus aquaporin 6 (Aqp6), mRNA Length = 890 Score = 42.1 bits (21), Expect = 2.3 Identities = 33/37 (89%) Strand = Plus / Minus Query: 301 acggcggggccgaatgagcgtgcagggttcatggaac 337 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 613 acggcagggccgaaggagcgggctgggttcatggaac 577
>ref|XM_543677.2| PREDICTED: Canis familiaris similar to Aquaporin 5 (LOC486551), mRNA Length = 1556 Score = 42.1 bits (21), Expect = 2.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 304 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 348 ||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 794 gcggggccgaaagagcgggccgggttcatggagcagccggtgaag 750
>gb|AC023240.9| Oryza sativa chromosome 10 BAC OSJNBa0051D19 genomic sequence, complete sequence Length = 131984 Score = 42.1 bits (21), Expect = 2.3 Identities = 36/41 (87%) Strand = Plus / Plus Query: 569 cgacgatggcaccgaggagctgcgcaacccagtagaagagg 609 |||||| ||| ||||||||||| || | ||||||||||||| Sbjct: 26536 cgacgacggcgccgaggagctgggcgagccagtagaagagg 26576
>gb|AC007789.1| Oryza sativa BAC OSJNBa0049B20 genomic sequence, complete sequence Length = 182756 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 429 gtcggcggcggtggcgtacacggtg 453 ||||||||||| ||||||||||||| Sbjct: 157003 gtcggcggcggcggcgtacacggtg 156979
>gb|DQ450071.1| Arachis hypogaea clone 8A4R19G1 putative major intrinsic protein mRNA, partial cds Length = 770 Score = 42.1 bits (21), Expect = 2.3 Identities = 69/85 (81%) Strand = Plus / Minus Query: 263 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 322 |||||||||||||| || |||||||| || ||| ||| || || || || ||||||| Sbjct: 484 cccagtagatccagtgattagtgaagtctccactgataacagcaggtccaaaggagcgtg 425 Query: 323 cagggttcatggaaccgccggagaa 347 |||||||||| || ||||| ||||| Sbjct: 424 cagggttcattgagccgccagagaa 400
>gb|DQ450067.1| Arachis hypogaea clone 2A1R19GZ delta-TIP-like protein mRNA, partial cds Length = 684 Score = 42.1 bits (21), Expect = 2.3 Identities = 69/85 (81%) Strand = Plus / Minus Query: 263 cccagtagatccagatgttggtgaagtcgccgctggcaacggcggggccgaatgagcgtg 322 |||||||||||||| || |||||||| || ||| ||| || || || || ||||||| Sbjct: 397 cccagtagatccagtgattagtgaagtctccactgataacagcaggtccaaaggagcgtg 338 Query: 323 cagggttcatggaaccgccggagaa 347 |||||||||| || ||||| ||||| Sbjct: 337 cagggttcattgagccgccagagaa 313
>ref|XM_844922.1| PREDICTED: Canis familiaris hypothetical protein LOC608029 (LOC608029), mRNA Length = 969 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 628 tgaccgccgagcgcgaggccg 648 ||||||||||||||||||||| Sbjct: 46 tgaccgccgagcgcgaggccg 26
>emb|Z29946.1|TRGTIPLP T.repens (Huia) mRNA for gamma-Tip-like protein Length = 991 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 256 gggccggcccagtagatccag 276 ||||||||||||||||||||| Sbjct: 655 gggccggcccagtagatccag 635
>emb|Y08962.1|OSTRAMBPR O.sativa mRNA for transmembrane protein Length = 1179 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| | |||||| Sbjct: 434 gaggccgaaggtgacggccgggttgatgtggcc 402
>emb|BX569693.1| Synechococcus sp. WH8102 complete genome; segment 5/7 Length = 349213 Score = 42.1 bits (21), Expect = 2.3 Identities = 21/21 (100%) Strand = Plus / Minus Query: 419 ccttcttggggtcggcggcgg 439 ||||||||||||||||||||| Sbjct: 320884 ccttcttggggtcggcggcgg 320864
>dbj|AK082699.1| Mus musculus 0 day neonate cerebellum cDNA, RIKEN full-length enriched library, clone:C230090D02 product:aquaporin 6, full insert sequence Length = 2066 Score = 42.1 bits (21), Expect = 2.3 Identities = 33/37 (89%) Strand = Plus / Minus Query: 301 acggcggggccgaatgagcgtgcagggttcatggaac 337 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578
>dbj|AP008216.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 10, complete sequence Length = 22685906 Score = 42.1 bits (21), Expect = 2.3 Identities = 36/41 (87%) Strand = Plus / Minus Query: 569 cgacgatggcaccgaggagctgcgcaacccagtagaagagg 609 |||||| ||| ||||||||||| || | ||||||||||||| Sbjct: 18186592 cgacgacggcgccgaggagctgggcgagccagtagaagagg 18186552
>gb|AF326492.1|AF326492 Zea mays plasma membrane integral protein ZmPIP2-2 mRNA, complete cds Length = 1268 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| | |||||| Sbjct: 482 gaggccgaaggtgacggccgggttgatgtggcc 450
>dbj|AP002865.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 1, PAC clone:P0034C11 Length = 139399 Score = 42.1 bits (21), Expect = 2.3 Identities = 24/25 (96%) Strand = Plus / Minus Query: 429 gtcggcggcggtggcgtacacggtg 453 ||||||||||| ||||||||||||| Sbjct: 110600 gtcggcggcggcggcgtacacggtg 110576
>gb|AF139814.1|AF139814 Triticum aestivum plasma membrane intrinsic protein 1 (PIP1) mRNA, complete cds Length = 1283 Score = 42.1 bits (21), Expect = 2.3 Identities = 34/37 (91%), Gaps = 1/37 (2%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtg-acgatgatctcc 483 ||||||||||||||| |||||||| ||||||||||| Sbjct: 643 acggtgtagacgagcacgaaggtgcccgatgatctcc 607 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| | |||||| Sbjct: 431 gaggccgaaggtgacggccgggttgatgtggcc 399
>emb|AJ555456.1|ECA555456 Equus caballus partial mRNA for aquaporin 5 (aqp5 gene) Length = 535 Score = 42.1 bits (21), Expect = 2.3 Identities = 39/45 (86%) Strand = Plus / Minus Query: 304 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 348 ||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 534 gcggggccgaaagagcgggctgggttcatggagcagccggtgaag 490
>dbj|AK111931.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-016-C03, full insert sequence Length = 1200 Score = 42.1 bits (21), Expect = 2.3 Identities = 36/41 (87%) Strand = Plus / Minus Query: 569 cgacgatggcaccgaggagctgcgcaacccagtagaagagg 609 |||||| ||| ||||||||||| || | ||||||||||||| Sbjct: 521 cgacgacggcgccgaggagctgggcgagccagtagaagagg 481
>dbj|AB114828.1| Oryza sativa (japonica cultivar-group) OsTIP3 mRNA for tonoplast intrinsic protein, complete cds Length = 1178 Score = 42.1 bits (21), Expect = 2.3 Identities = 36/41 (87%) Strand = Plus / Minus Query: 569 cgacgatggcaccgaggagctgcgcaacccagtagaagagg 609 |||||| ||| ||||||||||| || | ||||||||||||| Sbjct: 504 cgacgacggcgccgaggagctgggcgagccagtagaagagg 464
>dbj|AK106383.1| Oryza sativa (japonica cultivar-group) cDNA clone:002-102-E03, full insert sequence Length = 1787 Score = 42.1 bits (21), Expect = 2.3 Identities = 36/41 (87%) Strand = Plus / Plus Query: 569 cgacgatggcaccgaggagctgcgcaacccagtagaagagg 609 |||||| ||| ||||||||||| || | ||||||||||||| Sbjct: 567 cgacgacggcgccgaggagctgggcgagccagtagaagagg 607
>dbj|AK104736.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-038-D02, full insert sequence Length = 1163 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| | |||||| Sbjct: 428 gaggccgaaggtgacggccgggttgatgtggcc 396
>dbj|AK098849.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013000E16, full insert sequence Length = 1164 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| | |||||| Sbjct: 429 gaggccgaaggtgacggccgggttgatgtggcc 397
>dbj|AK065188.1| Oryza sativa (japonica cultivar-group) cDNA clone:J013002E02, full insert sequence Length = 1167 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| | |||||| Sbjct: 431 gaggccgaaggtgacggccgggttgatgtggcc 399
>dbj|AK058323.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-014-B07, full insert sequence Length = 1462 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| | |||||| Sbjct: 727 gaggccgaaggtgacggccgggttgatgtggcc 695
>gb|AY610211.1| Sus scrofa clone Clu_9762.scr.msk.p1.Contig1, mRNA sequence Length = 2291 Score = 42.1 bits (21), Expect = 2.3 Identities = 39/45 (86%) Strand = Plus / Plus Query: 304 gcggggccgaatgagcgtgcagggttcatggaaccgccggagaag 348 ||||||||||| ||||| || ||||||||||| | ||||| |||| Sbjct: 2227 gcggggccgaaagagcgggctgggttcatggagcagccggtgaag 2271
>gb|AE016959.3| Oryza sativa (japonica cultivar-group) chromosome 10, complete sequence Length = 22698374 Score = 42.1 bits (21), Expect = 2.3 Identities = 36/41 (87%) Strand = Plus / Minus Query: 569 cgacgatggcaccgaggagctgcgcaacccagtagaagagg 609 |||||| ||| ||||||||||| || | ||||||||||||| Sbjct: 18195845 cgacgacggcgccgaggagctgggcgagccagtagaagagg 18195805
>gb|AC139317.4| Mus musculus BAC clone RP24-495N6 from 15, complete sequence Length = 182415 Score = 42.1 bits (21), Expect = 2.3 Identities = 33/37 (89%) Strand = Plus / Plus Query: 301 acggcggggccgaatgagcgtgcagggttcatggaac 337 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 98545 acggcagggccgaaggagcgggctgggttcatggaac 98581
>ref|NM_175087.2| Mus musculus aquaporin 6 (Aqp6), mRNA Length = 2066 Score = 42.1 bits (21), Expect = 2.3 Identities = 33/37 (89%) Strand = Plus / Minus Query: 301 acggcggggccgaatgagcgtgcagggttcatggaac 337 ||||| |||||||| ||||| || ||||||||||||| Sbjct: 614 acggcagggccgaaggagcgggctgggttcatggaac 578
>gb|U77297.1|OSU77297 Oryza sativa transmembrane protein mRNA, complete cds Length = 1179 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| | |||||| Sbjct: 434 gaggccgaaggtgacggccgggttgatgtggcc 402
>dbj|AP004484.1| Lotus japonicus genomic DNA, chromosome 1, clone:LjT06I17, TM0017, complete sequence Length = 121127 Score = 42.1 bits (21), Expect = 2.3 Identities = 30/33 (90%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggttcacgtggcc 674 |||||||||||||||||| ||||| | |||||| Sbjct: 34726 gaggccgaaggtgacggcggggttgatgtggcc 34694
>ref|NM_129238.2| Arabidopsis thaliana GAMMA-TIP; water channel AT2G36830 (GAMMA-TIP) mRNA, complete cds Length = 1058 Score = 40.1 bits (20), Expect = 9.2 Identities = 32/36 (88%) Strand = Plus / Minus Query: 241 ccaccgccgatgagcgggccggcccagtagatccag 276 |||||||||| ||| || ||||||||||||| |||| Sbjct: 747 ccaccgccgacgagaggtccggcccagtagacccag 712
>gb|AC130604.4| Oryza sativa (japonica cultivar-group) chromosome 5 clone B1155G07, complete sequence Length = 146712 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 426 ggggtcggcggcggtggcgt 445 |||||||||||||||||||| Sbjct: 72271 ggggtcggcggcggtggcgt 72290
>ref|XM_475029.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 849 Score = 40.1 bits (20), Expect = 9.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 448 acggtgtagacgagcccgaaggtgacgatgat 479 |||||||||||||| |||||||| ||||||| Sbjct: 539 acggtgtagacgaggacgaaggtgccgatgat 508
>ref|XM_473480.1| Oryza sativa (japonica cultivar-group), predicted mRNA Length = 849 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcagggtt 665 |||||||||||||||||| ||||| Sbjct: 351 gaggccgaaggtgacggccgggtt 328
>gb|DQ164589.1| Hepatitis C virus isolate BE00-17-3630 polyprotein gene, partial cds Length = 543 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 602 agaagaggccggtgaggatg 621 |||||||||||||||||||| Sbjct: 479 agaagaggccggtgaggatg 460
>gb|DQ164581.1| Hepatitis C virus isolate BE01-17-3630 polyprotein gene, partial cds Length = 543 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 602 agaagaggccggtgaggatg 621 |||||||||||||||||||| Sbjct: 479 agaagaggccggtgaggatg 460
>gb|AC108873.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1005_B11, complete sequence Length = 162772 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Plus Query: 426 ggggtcggcggcggtggcgt 445 |||||||||||||||||||| Sbjct: 152085 ggggtcggcggcggtggcgt 152104
>gb|AC006012.2| Homo sapiens PAC clone RP5-942I16 from 7, complete sequence Length = 121598 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 123 ggcatcatggaaaccaaaca 142 |||||||||||||||||||| Sbjct: 113843 ggcatcatggaaaccaaaca 113824
>emb|AM039952.1| Xanthomonas campestris pv. vesicatoria complete genome Length = 5178466 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 631 ccgccgagcgcgaggccgaaggtg 654 |||||||||||||| ||||||||| Sbjct: 2601045 ccgccgagcgcgagtccgaaggtg 2601022 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Minus Query: 628 tgaccgccgagcgcgaggccgaag 651 |||||||||||||||||| ||||| Sbjct: 1206220 tgaccgccgagcgcgaggacgaag 1206197
>ref|XM_743501.1| Aspergillus fumigatus Af293 MFS transporter (Afu3g02720) partial mRNA Length = 1734 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 642 gaggccgaaggtgacggcag 661 |||||||||||||||||||| Sbjct: 882 gaggccgaaggtgacggcag 863
>ref|XM_804228.1| Trypanosoma cruzi strain CL Brener hypothetical protein (Tc00.1047053507837.100) partial mRNA Length = 4953 Score = 40.1 bits (20), Expect = 9.2 Identities = 23/24 (95%) Strand = Plus / Plus Query: 384 gccgatggcgatgggggcgatggt 407 ||||||| |||||||||||||||| Sbjct: 4372 gccgatgacgatgggggcgatggt 4395
>gb|AC144721.18| Medicago truncatula clone mth2-11o23, complete sequence Length = 135959 Score = 40.1 bits (20), Expect = 9.2 Identities = 38/44 (86%) Strand = Plus / Plus Query: 586 agctgcgcaacccagtagaagaggccggtgaggatggtgatctg 629 ||||| |||| ||||||||||| || ||||||||||| ||||| Sbjct: 71539 agctgagcaatccagtagaagataccagtgaggatggtaatctg 71582
>gb|AC137077.26| Medicago truncatula clone mth2-8g15, complete sequence Length = 138303 Score = 40.1 bits (20), Expect = 9.2 Identities = 29/32 (90%) Strand = Plus / Minus Query: 307 gggccgaatgagcgtgcagggttcatggaacc 338 |||||||||||||| || |||||||| ||||| Sbjct: 90944 gggccgaatgagcgagccgggttcattgaacc 90913
>gb|CP000316.1| Polaromonas sp. JS666, complete genome Length = 5200264 Score = 40.1 bits (20), Expect = 9.2 Identities = 20/20 (100%) Strand = Plus / Minus Query: 562 aaggcgccgacgatggcacc 581 |||||||||||||||||||| Sbjct: 3143181 aaggcgccgacgatggcacc 3143162
>emb|X95952.1|HAAP H.annuus mRNA for aquaporin Length = 931 Score = 40.1 bits (20), Expect = 9.2 Identities = 38/44 (86%) Strand = Plus / Minus Query: 592 gcaacccagtagaagaggccggtgaggatggtgatctgaccgcc 635 |||| |||||| |||| ||| || ||||||||||| |||||||| Sbjct: 372 gcaatccagtaaaagatgccagttaggatggtgatttgaccgcc 329 Database: nt Posted date: May 29, 2006 11:10 AM Number of letters in database: 3,984,495,279 Number of sequences in database: 917,343 Database: /shigen/export/home/twatanab/db/nt/nt.01 Posted date: May 29, 2006 11:16 AM Number of letters in database: 3,988,174,986 Number of sequences in database: 835,257 Database: /shigen/export/home/twatanab/db/nt/nt.02 Posted date: May 29, 2006 11:21 AM Number of letters in database: 3,991,246,324 Number of sequences in database: 771,481 Database: /shigen/export/home/twatanab/db/nt/nt.03 Posted date: May 29, 2006 11:27 AM Number of letters in database: 3,990,718,311 Number of sequences in database: 977,174 Database: /shigen/export/home/twatanab/db/nt/nt.04 Posted date: May 29, 2006 11:29 AM Number of letters in database: 1,278,410,368 Number of sequences in database: 400,813 Lambda K H 1.37 0.711 1.31 Gapped Lambda K H 1.37 0.711 1.31 Matrix: blastn matrix:1 -3 Gap Penalties: Existence: 5, Extension: 2 Number of Hits to DB: 4,349,403 Number of Sequences: 3902068 Number of extensions: 4349403 Number of successful extensions: 99513 Number of sequences better than 10.0: 298 Number of HSP's better than 10.0 without gapping: 302 Number of HSP's successfully gapped in prelim test: 0 Number of HSP's that attempted gapping in prelim test: 95293 Number of HSP's gapped (non-prelim): 4179 length of query: 674 length of database: 17,233,045,268 effective HSP length: 23 effective length of query: 651 effective length of database: 17,143,297,704 effective search space: 11160286805304 effective search space used: 11160286805304 T: 0 A: 0 X1: 6 (11.9 bits) X2: 15 (29.7 bits) S1: 12 (24.3 bits) S2: 20 (40.1 bits)
