>gb|AC094668.10| Rattus norvegicus  BAC CH230-5F18 (Children's Hospital Oakland Research
             Institute Rat (BN/SsNHsd/MCW) BAC library) complete
             sequence
          Length = 212263

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 26    ggcaggaaaaccaaagtaagg 46
             |||||||||||||||||||||
Sbjct: 49164 ggcaggaaaaccaaagtaagg 49144

>ref|XM_653411.1| Aspergillus nidulans FGSC A4 hypothetical protein (AN0899.2), mRNA
          Length = 2385

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 71   cctcgaacctcttcacttcag 91
            |||||||||||||||||||||
Sbjct: 1324 cctcgaacctcttcacttcag 1344

>ref|NM_001024368.1| Rattus norvegicus similar to protein P3 (LOC501665), mRNA
          Length = 1900

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 26 ggcaggaaaaccaaagtaagg 46
          |||||||||||||||||||||
Sbjct: 62 ggcaggaaaaccaaagtaagg 42

>gb|BC086556.1| Rattus norvegicus similar to protein P3, mRNA (cDNA clone
          MGC:105543 IMAGE:7304843), complete cds
          Length = 1900

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                               
Query: 26 ggcaggaaaaccaaagtaagg 46
          |||||||||||||||||||||
Sbjct: 62 ggcaggaaaaccaaagtaagg 42

>emb|AL844570.9| Zebrafish DNA sequence from clone DKEY-20D18, complete sequence
          Length = 240816

 Score = 42.1 bits (21), Expect = 0.80
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 80     tcttcacttcagacctccagc 100
              |||||||||||||||||||||
Sbjct: 107081 tcttcacttcagacctccagc 107061


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 1,634,520
Number of Sequences: 3902068
Number of extensions: 1634520
Number of successful extensions: 32399
Number of sequences better than 10.0: 5
Number of HSP's better than 10.0 without gapping: 5
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 32393
Number of HSP's gapped (non-prelim): 6
length of query: 246
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 224
effective length of database: 17,147,199,772
effective search space: 3840972748928
effective search space used: 3840972748928
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)