ナショナルバイオリソースプロジェクト
-Barley Genetic Resources Database-
Japanese | English
更新日:2016年5月1日

Clone Information

BLAST Search Result

Clone Name rbasd24i22
Clone Library Name barley_pub

No. Definition Score
(bits)
E
Value
1gb|AC107085.2| Oryza sativa (japonica cultivar-group) chromosome... 111 2e-21
2dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic D... 111 2e-21
3dbj|AK119412.1| Oryza sativa (japonica cultivar-group) cDNA clon... 111 2e-21
4gb|BT016690.1| Zea mays clone Contig523 mRNA sequence 107 4e-20
5ref|NM_100771.2| Arabidopsis thaliana ANP1 (NPK1-RELATED PROTEIN... 46 0.11
6ref|NM_100772.3| Arabidopsis thaliana hydrolase, hydrolyzing O-g... 46 0.11
7gb|AY045934.1| Arabidopsis thaliana At1g09010 mRNA sequence 46 0.11
8dbj|AB122060.1| Arabidopsis thaliana AtEBM mRNA for endo-beta-ma... 46 0.11
9gb|AC000106.1|F7G19 Sequence of BAC F7G19 from Arabidopsis thali... 46 0.11
10emb|CR854849.7| Human DNA sequence from clone RP13-79M23 on chro... 42 1.7
11emb|AL603749.6| Human DNA sequence from clone RP11-133N1 on chro... 42 1.7
12emb|AL365443.16| Human DNA sequence from clone RP11-219C24 on ch... 42 1.7
13ref|NG_005161.1| Homo sapiens preferentially expressed antigen i... 42 1.7
14gb|AC026179.5|AC026179 Homo sapiens chromosome 3 clone RP11-264H... 42 1.7
15gb|AC066584.6|AC066584 Homo sapiens chromosome 3 clone RP11-244G... 42 1.7
16gb|AC018493.6|AC018493 Homo sapiens chromosome 3 clone RP11-163M... 42 1.7
17gb|AC011327.17|AC011327 Homo sapiens 3 BAC RP11-77I5 (Roswell Pa... 42 1.7
18emb|AL935264.12| Mouse DNA sequence from clone RP23-118A9 on chr... 42 1.7
19gb|AC023485.6| Homo sapiens chromosome 3 clone RP11-489D19 map 3... 42 1.7
20gb|AC153508.2| Mus musculus 10 BAC RP23-233B6 (Roswell Park Canc... 40 6.8
21ref|NM_001017061.2| Xenopus tropicalis hypothetical protein LOC5... 40 6.8
22gb|AY633104.1| Cicurina pallida haplotype TX365 cytochrome oxida... 40 6.8
23gb|AY633103.1| Cicurina pallida haplotype TX363 cytochrome oxida... 40 6.8
24gb|AC135239.3| Mus musculus BAC clone RP23-324D2 from chromosome... 40 6.8
25gb|AC110566.17| Mus musculus chromosome 5, clone RP23-300A10, co... 40 6.8
26emb|AL353744.18| Human DNA sequence from clone RP13-100A9 on chr... 40 6.8
27emb|AL353808.14| Human DNA sequence from clone RP11-152M16 on ch... 40 6.8
28gb|AC163212.3| Mus musculus chromosome 3, clone RP24-102O2, comp... 40 6.8
29emb|BX901878.6| Zebrafish DNA sequence from clone DKEY-11O15 in ... 40 6.8
30emb|BX284112.25| Zebrafish DNA sequence from clone DKEYP-75A7 in... 40 6.8
31emb|BX470110.2| Mouse DNA sequence from clone RP23-374D8 on chro... 40 6.8
32gb|AC151426.32| Medicago truncatula clone mth2-6o22, complete se... 40 6.8
33gb|DQ174430.1| Diaea sp. JEG-696 cytochrome oxidase subunit I (C... 40 6.8
34gb|DQ174429.1| Diaea sp. JEG-697 cytochrome oxidase subunit I (C... 40 6.8
35gb|DQ174399.1| Diaea sp. JEG-692 cytochrome oxidase subunit I (C... 40 6.8
36gb|DQ174374.1| Misumenops melloleitaio isolate 368 cytochrome ox... 40 6.8
37gb|DQ174373.1| Misumenops melloleitaio isolate 484 cytochrome ox... 40 6.8
38emb|BX537275.8| Zebrafish DNA sequence from clone DKEYP-120E12 i... 40 6.8
39emb|CR761653.2| Xenopus tropicalis finished cDNA, clone TGas033k12 40 6.8
40gb|AC170746.3| Loxodonta africana clone VMRC15-355K9, complete s... 40 6.8
41emb|BX005168.10| Mouse DNA sequence from clone RP23-204O8 on chr... 40 6.8

>gb|AC107085.2| Oryza sativa (japonica cultivar-group) chromosome 5 clone OJ1764_D01,
             complete sequence
          Length = 164709

 Score =  111 bits (56), Expect = 2e-21
 Identities = 184/226 (81%), Gaps = 3/226 (1%)
 Strand = Plus / Minus

                                                                         
Query: 239   gcatggttcagatgatagttccagcctctcagaatgaccctgggcttggatccttcgggt 298
             ||||||| ||| ||||||||||||||| ||||||||||||||||  ||||||| | ||| 
Sbjct: 42054 gcatggtccaggtgatagttccagcctttcagaatgaccctgggggtggatccctggggg 41995

                                                                         
Query: 299   gcctcgaaggagatgtcagttgtcatcttctccccgggggtgagcgaaaaatagttgtct 358
             |||||||| ||||||||  | | |||||||||||| ||   ||| || || |||||||| 
Sbjct: 41994 gcctcgaacgagatgtcgatggccatcttctcccccggtacgagggagaagtagttgtcg 41935

                                                                         
Query: 359   gagtagtgtaccggaaggattctagtgtccctgtaattctccccaatggatgat---tca 415
             |||||||| || || |||||||| |||||| |||||   |||  | ||||||||   |||
Sbjct: 41934 gagtagtggacagggaggattcttgtgtccttgtaaacatcctgactggatgatggctca 41875

                                                           
Query: 416   gaggtgtgcactgagaaatgaaggaaaaacgctacacctgaatcgg 461
             || ||||| || |||||||| ||||||||||  || ||||||||||
Sbjct: 41874 gatgtgtgtaccgagaaatggaggaaaaacgagacgcctgaatcgg 41829



to top

>dbj|AP008211.1| Oryza sativa (japonica cultivar-group) genomic DNA, chromosome 5, complete
                sequence
          Length = 29737217

 Score =  111 bits (56), Expect = 2e-21
 Identities = 184/226 (81%), Gaps = 3/226 (1%)
 Strand = Plus / Minus

                                                                            
Query: 239      gcatggttcagatgatagttccagcctctcagaatgaccctgggcttggatccttcgggt 298
                ||||||| ||| ||||||||||||||| ||||||||||||||||  ||||||| | ||| 
Sbjct: 18874676 gcatggtccaggtgatagttccagcctttcagaatgaccctgggggtggatccctggggg 18874617

                                                                            
Query: 299      gcctcgaaggagatgtcagttgtcatcttctccccgggggtgagcgaaaaatagttgtct 358
                |||||||| ||||||||  | | |||||||||||| ||   ||| || || |||||||| 
Sbjct: 18874616 gcctcgaacgagatgtcgatggccatcttctcccccggtacgagggagaagtagttgtcg 18874557

                                                                            
Query: 359      gagtagtgtaccggaaggattctagtgtccctgtaattctccccaatggatgat---tca 415
                |||||||| || || |||||||| |||||| |||||   |||  | ||||||||   |||
Sbjct: 18874556 gagtagtggacagggaggattcttgtgtccttgtaaacatcctgactggatgatggctca 18874497

                                                              
Query: 416      gaggtgtgcactgagaaatgaaggaaaaacgctacacctgaatcgg 461
                || ||||| || |||||||| ||||||||||  || ||||||||||
Sbjct: 18874496 gatgtgtgtaccgagaaatggaggaaaaacgagacgcctgaatcgg 18874451



to top

>dbj|AK119412.1| Oryza sativa (japonica cultivar-group) cDNA clone:001-132-F10, full
            insert sequence
          Length = 3621

 Score =  111 bits (56), Expect = 2e-21
 Identities = 184/226 (81%), Gaps = 3/226 (1%)
 Strand = Plus / Minus

                                                                        
Query: 239  gcatggttcagatgatagttccagcctctcagaatgaccctgggcttggatccttcgggt 298
            ||||||| ||| ||||||||||||||| ||||||||||||||||  ||||||| | ||| 
Sbjct: 3072 gcatggtccaggtgatagttccagcctttcagaatgaccctgggggtggatccctggggg 3013

                                                                        
Query: 299  gcctcgaaggagatgtcagttgtcatcttctccccgggggtgagcgaaaaatagttgtct 358
            |||||||| ||||||||  | | |||||||||||| ||   ||| || || |||||||| 
Sbjct: 3012 gcctcgaacgagatgtcgatggccatcttctcccccggtacgagggagaagtagttgtcg 2953

                                                                        
Query: 359  gagtagtgtaccggaaggattctagtgtccctgtaattctccccaatggatgat---tca 415
            |||||||| || || |||||||| |||||| |||||   |||  | ||||||||   |||
Sbjct: 2952 gagtagtggacagggaggattcttgtgtccttgtaaacatcctgactggatgatggctca 2893

                                                          
Query: 416  gaggtgtgcactgagaaatgaaggaaaaacgctacacctgaatcgg 461
            || ||||| || |||||||| ||||||||||  || ||||||||||
Sbjct: 2892 gatgtgtgtaccgagaaatggaggaaaaacgagacgcctgaatcgg 2847



to top

>gb|BT016690.1| Zea mays clone Contig523 mRNA sequence
          Length = 1207

 Score =  107 bits (54), Expect = 4e-20
 Identities = 185/228 (81%), Gaps = 3/228 (1%)
 Strand = Plus / Minus

                                                                        
Query: 242  tggttcagatgatagttccagcctctcagaatgaccctgggcttggatccttcgggtgcc 301
            |||| |||||||| |||||||||||| || |  || |||||  |||| || | ||| |||
Sbjct: 1049 tggtccagatgatggttccagcctctgaggacaactctgggactggacccctggggagcc 990

                                                                        
Query: 302  tcgaaggagatgtcagttgtcatcttctccccgggggtgagcgaaaaatagttgtctgag 361
            ||||| ||||||||    | ||| |||||||| || || |||||||| |||||||| |||
Sbjct: 989  tcgaacgagatgtcgacggccatgttctcccccggcgtcagcgaaaagtagttgtccgag 930

                                                                        
Query: 362  tagtgtaccggaaggattctagtgtccctgtaattctccccaa---tggatgattcagag 418
            ||||| ||||| |||||||| |||||  |||| | ||||||     |||||||||| |||
Sbjct: 929  tagtggaccgggaggattcttgtgtcattgtattcctccccgtccgtggatgattcggag 870

                                                            
Query: 419  gtgtgcactgagaaatgaaggaaaaacgctacacctgaatcggtcccg 466
            ||||||||||||||||| ||||| || || || |||||||||||||||
Sbjct: 869  gtgtgcactgagaaatggaggaagaaggcaacccctgaatcggtcccg 822



to top

>ref|NM_100771.2| Arabidopsis thaliana ANP1 (NPK1-RELATED PROTEIN KINASE 1S); kinase
            AT1G09000 (ANP1) mRNA, complete cds
          Length = 2862

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Plus

                                   
Query: 347  aaatagttgtctgagtagtgtac 369
            |||||||||||||||||||||||
Sbjct: 2474 aaatagttgtctgagtagtgtac 2496



to top

>ref|NM_100772.3| Arabidopsis thaliana hydrolase, hydrolyzing O-glycosyl compounds
            AT1G09010 mRNA, complete cds
          Length = 3023

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 347  aaatagttgtctgagtagtgtac 369
            |||||||||||||||||||||||
Sbjct: 2803 aaatagttgtctgagtagtgtac 2781



to top

>gb|AY045934.1| Arabidopsis thaliana At1g09010 mRNA sequence
          Length = 3297

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 347  aaatagttgtctgagtagtgtac 369
            |||||||||||||||||||||||
Sbjct: 3072 aaatagttgtctgagtagtgtac 3050



to top

>dbj|AB122060.1| Arabidopsis thaliana AtEBM mRNA for endo-beta-mannosidase, complete
            cds
          Length = 2835

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                   
Query: 347  aaatagttgtctgagtagtgtac 369
            |||||||||||||||||||||||
Sbjct: 2708 aaatagttgtctgagtagtgtac 2686



to top

>gb|AC000106.1|F7G19 Sequence of BAC F7G19 from Arabidopsis thaliana chromosome 1, complete
             sequence
          Length = 110514

 Score = 46.1 bits (23), Expect = 0.11
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 347   aaatagttgtctgagtagtgtac 369
             |||||||||||||||||||||||
Sbjct: 47801 aaatagttgtctgagtagtgtac 47779



to top

>emb|CR854849.7| Human DNA sequence from clone RP13-79M23 on chromosome 1, complete
            sequence
          Length = 153012

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                 
Query: 267  tcagaatgaccctgggcttgg 287
            |||||||||||||||||||||
Sbjct: 6115 tcagaatgaccctgggcttgg 6095



to top

>emb|AL603749.6| Human DNA sequence from clone RP11-133N1 on chromosome 1 Contains two
             novel proteins similar to preferentially expressed antigen
             in melanoma (PRAME) and the 3' end of a novel leucine rich
             repeat domain containing protein, complete sequence
          Length = 102313

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                  
Query: 267   tcagaatgaccctgggcttgg 287
             |||||||||||||||||||||
Sbjct: 37412 tcagaatgaccctgggcttgg 37432



to top

>emb|AL365443.16| Human DNA sequence from clone RP11-219C24 on chromosome 1 Contains six
             novel genes similar to preferentially expressed antigen in
             melanoma (PRAME), two novel genes, two preferentially
             expressed antigen in melanoma (PRAME) pseudogenes and a
             CpG island, complete sequence
          Length = 184591

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 267   tcagaatgaccctgggcttgg 287
             |||||||||||||||||||||
Sbjct: 30970 tcagaatgaccctgggcttgg 30950



to top

>ref|NG_005161.1| Homo sapiens preferentially expressed antigen in melanoma (PRAME),
            pseudogene (LOC391001) on chromosome 1
          Length = 5181

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                 
Query: 267  tcagaatgaccctgggcttgg 287
            |||||||||||||||||||||
Sbjct: 4331 tcagaatgaccctgggcttgg 4351



to top

>gb|AC026179.5|AC026179 Homo sapiens chromosome 3 clone RP11-264H3 map 3p, complete sequence
          Length = 166488

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 174    atgtacttactttacatggat 194
              |||||||||||||||||||||
Sbjct: 152625 atgtacttactttacatggat 152605



to top

>gb|AC066584.6|AC066584 Homo sapiens chromosome 3 clone RP11-244G3 map 3p, complete sequence
          Length = 155825

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 174   atgtacttactttacatggat 194
             |||||||||||||||||||||
Sbjct: 76775 atgtacttactttacatggat 76755



to top

>gb|AC018493.6|AC018493 Homo sapiens chromosome 3 clone RP11-163M22 map 3p, complete sequence
          Length = 180299

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 174    atgtacttactttacatggat 194
              |||||||||||||||||||||
Sbjct: 171146 atgtacttactttacatggat 171166



to top

>gb|AC011327.17|AC011327 Homo sapiens 3 BAC RP11-77I5 (Roswell Park Cancer Institute Human BAC
              Library) complete sequence
          Length = 168812

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Plus

                                   
Query: 174    atgtacttactttacatggat 194
              |||||||||||||||||||||
Sbjct: 159653 atgtacttactttacatggat 159673



to top

>emb|AL935264.12| Mouse DNA sequence from clone RP23-118A9 on chromosome 4, complete
             sequence
          Length = 230886

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                  
Query: 158   ctgcactttattggggatgta 178
             |||||||||||||||||||||
Sbjct: 26959 ctgcactttattggggatgta 26939



to top

>gb|AC023485.6| Homo sapiens chromosome 3 clone RP11-489D19 map 3p, complete sequence
          Length = 179304

 Score = 42.1 bits (21), Expect = 1.7
 Identities = 21/21 (100%)
 Strand = Plus / Minus

                                   
Query: 174    atgtacttactttacatggat 194
              |||||||||||||||||||||
Sbjct: 100248 atgtacttactttacatggat 100228



to top

>gb|AC153508.2| Mus musculus 10 BAC RP23-233B6 (Roswell Park Cancer Institute (C57BL/6J
              Female) Mouse BAC Library) complete sequence
          Length = 190780

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 255    agttccagcctctcagaatg 274
              ||||||||||||||||||||
Sbjct: 140703 agttccagcctctcagaatg 140722



to top

>ref|NM_001017061.2| Xenopus tropicalis hypothetical protein LOC549815 (LOC549815), mRNA
          Length = 1786

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 258 tccagcctctcagaatgacc 277
           ||||||||||||||||||||
Sbjct: 332 tccagcctctcagaatgacc 351



to top

>gb|AY633104.1| Cicurina pallida haplotype TX365 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial
          Length = 984

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 181 tactttacatggatcttatt 200
           ||||||||||||||||||||
Sbjct: 678 tactttacatggatcttatt 697



to top

>gb|AY633103.1| Cicurina pallida haplotype TX363 cytochrome oxidase subunit I (COI)
           gene, partial cds; mitochondrial
          Length = 966

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 181 tactttacatggatcttatt 200
           ||||||||||||||||||||
Sbjct: 660 tactttacatggatcttatt 679



to top

>gb|AC135239.3| Mus musculus BAC clone RP23-324D2 from chromosome 3, complete sequence
          Length = 190178

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 160   gcactttattggggatgtacttac 183
             |||||| |||||||||||||||||
Sbjct: 91501 gcacttaattggggatgtacttac 91524



to top

>gb|AC110566.17| Mus musculus chromosome 5, clone RP23-300A10, complete sequence
          Length = 175471

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 306   aggagatgtcagttgtcatc 325
             ||||||||||||||||||||
Sbjct: 68168 aggagatgtcagttgtcatc 68149



to top

>emb|AL353744.18| Human DNA sequence from clone RP13-100A9 on chromosome Xq11.2-13.1
             Contains a GrpE-like 2 mitochondrial (E. coli) pseudogene
             and a novel pseudogene, complete sequence
          Length = 131070

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 311   atgtcagttgtcatcttctc 330
             ||||||||||||||||||||
Sbjct: 45557 atgtcagttgtcatcttctc 45538



to top

>emb|AL353808.14| Human DNA sequence from clone RP11-152M16 on chromosome 9, complete
             sequence
          Length = 44262

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 426   ctgagaaatgaaggaaaaac 445
             ||||||||||||||||||||
Sbjct: 24027 ctgagaaatgaaggaaaaac 24046



to top

>gb|AC163212.3| Mus musculus chromosome 3, clone RP24-102O2, complete sequence
          Length = 199319

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 160   gcactttattggggatgtacttac 183
             |||||| |||||||||||||||||
Sbjct: 61943 gcacttaattggggatgtacttac 61966



to top

>emb|BX901878.6| Zebrafish DNA sequence from clone DKEY-11O15 in linkage group 21,
             complete sequence
          Length = 217310

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 424   cactgagaaatgaaggaaaa 443
             ||||||||||||||||||||
Sbjct: 93143 cactgagaaatgaaggaaaa 93124



to top

>emb|BX284112.25| Zebrafish DNA sequence from clone DKEYP-75A7 in linkage group 21,
             complete sequence
          Length = 216476

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                 
Query: 424   cactgagaaatgaaggaaaa 443
             ||||||||||||||||||||
Sbjct: 73559 cactgagaaatgaaggaaaa 73578



to top

>emb|BX470110.2| Mouse DNA sequence from clone RP23-374D8 on chromosome 4, complete
              sequence
          Length = 194185

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 379    tctagtgtccctgtaattct 398
              ||||||||||||||||||||
Sbjct: 187247 tctagtgtccctgtaattct 187266



to top

>gb|AC151426.32| Medicago truncatula clone mth2-6o22, complete sequence
          Length = 116955

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 38/44 (86%)
 Strand = Plus / Plus

                                                         
Query: 344   gaaaaatagttgtctgagtagtgtaccggaaggattctagtgtc 387
             ||||||||||| |||||||| || ||||| || ||||| |||||
Sbjct: 98753 gaaaaatagttatctgagtaatgaaccgggagaattcttgtgtc 98796



to top

>gb|DQ174430.1| Diaea sp. JEG-696 cytochrome oxidase subunit I (COI) gene, partial
           cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 181 tactttacatggatcttatt 200
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793



to top

>gb|DQ174429.1| Diaea sp. JEG-697 cytochrome oxidase subunit I (COI) gene, partial
           cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 181 tactttacatggatcttatt 200
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793



to top

>gb|DQ174399.1| Diaea sp. JEG-692 cytochrome oxidase subunit I (COI) gene, partial
           cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 181 tactttacatggatcttatt 200
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793



to top

>gb|DQ174374.1| Misumenops melloleitaio isolate 368 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 820

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 181 tactttacatggatcttatt 200
           ||||||||||||||||||||
Sbjct: 774 tactttacatggatcttatt 793



to top

>gb|DQ174373.1| Misumenops melloleitaio isolate 484 cytochrome oxidase subunit I
           (COI) gene, partial cds; mitochondrial
          Length = 819

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 181 tactttacatggatcttatt 200
           ||||||||||||||||||||
Sbjct: 773 tactttacatggatcttatt 792



to top

>emb|BX537275.8| Zebrafish DNA sequence from clone DKEYP-120E12 in linkage group 11,
              complete sequence
          Length = 173631

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                                  
Query: 424    cactgagaaatgaaggaaaa 443
              ||||||||||||||||||||
Sbjct: 163771 cactgagaaatgaaggaaaa 163790



to top

>emb|CR761653.2| Xenopus tropicalis finished cDNA, clone TGas033k12
          Length = 1786

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Plus

                               
Query: 258 tccagcctctcagaatgacc 277
           ||||||||||||||||||||
Sbjct: 332 tccagcctctcagaatgacc 351



to top

>gb|AC170746.3| Loxodonta africana clone VMRC15-355K9, complete sequence
          Length = 122744

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 425   actgagaaatgaaggaaaaa 444
             ||||||||||||||||||||
Sbjct: 59582 actgagaaatgaaggaaaaa 59563



to top

>emb|BX005168.10| Mouse DNA sequence from clone RP23-204O8 on chromosome X, complete
             sequence
          Length = 143588

 Score = 40.1 bits (20), Expect = 6.8
 Identities = 23/24 (95%)
 Strand = Plus / Plus

                                     
Query: 422   tgcactgagaaatgaaggaaaaac 445
             |||||||| |||||||||||||||
Sbjct: 29611 tgcactgaaaaatgaaggaaaaac 29634


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 3,626,592
Number of Sequences: 3902068
Number of extensions: 3626592
Number of successful extensions: 82516
Number of sequences better than 10.0: 41
Number of HSP's better than 10.0 without gapping: 41
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 82418
Number of HSP's gapped (non-prelim): 98
length of query: 505
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 483
effective length of database: 17,147,199,772
effective search space: 8282097489876
effective search space used: 8282097489876
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 20 (40.1 bits)
to top