>gb|BC093559.1| Xenopus laevis cDNA clone MGC:115331 IMAGE:6948940, complete cds
          Length = 2739

 Score = 42.1 bits (21), Expect = 0.48
 Identities = 24/25 (96%)
 Strand = Plus / Minus

                                    
Query: 103 tctcatggttcagttgctccacagg 127
           ||||||||||||| |||||||||||
Sbjct: 730 tctcatggttcagctgctccacagg 706

>emb|AL008730.1|HS487J7 Human DNA sequence from clone RP3-487J7 on chromosome 6q21-22.1
             Contains the C6orf5 gene  for chromosome 6 open reading
             frame 5 (NFkB-activating protein ACT1, connection to IKK
             and SAPK/JNK, chromosome 6 open reading frame 6) (ACT1,
             CIKS, C6ORF6, DKFZP586G0522)(contains FLJ22949) and the 3'
             end of a novel gene, complete sequence
          Length = 116513

 Score = 40.1 bits (20), Expect = 1.9
 Identities = 20/20 (100%)
 Strand = Plus / Minus

                                 
Query: 86    tgaattctaaatctcagtct 105
             ||||||||||||||||||||
Sbjct: 36835 tgaattctaaatctcagtct 36816

>gb|CP000017.1| Streptococcus pyogenes MGAS5005, complete genome
          Length = 1838554

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 44      tgattctgatggggacgattaac 66
               ||||||||||| |||||||||||
Sbjct: 1342798 tgattctgatgaggacgattaac 1342820

>gb|CP000003.1| Streptococcus pyogenes MGAS10394, complete genome
          Length = 1899877

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 44      tgattctgatggggacgattaac 66
               ||||||||||| |||||||||||
Sbjct: 1414927 tgattctgatgaggacgattaac 1414949

>gb|AE006597.1| Streptococcus pyogenes M1 GAS, section 126 of 167 of the complete
             genome
          Length = 14017

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 44    tgattctgatggggacgattaac 66
             ||||||||||| |||||||||||
Sbjct: 11951 tgattctgatgaggacgattaac 11973

>gb|CP000262.1| Streptococcus pyogenes MGAS10750, complete genome
          Length = 1937111

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 44      tgattctgatggggacgattaac 66
               ||||||||||| |||||||||||
Sbjct: 1419911 tgattctgatgaggacgattaac 1419933

>gb|CP000261.1| Streptococcus pyogenes MGAS2096, complete genome
          Length = 1860355

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 44      tgattctgatggggacgattaac 66
               ||||||||||| |||||||||||
Sbjct: 1361242 tgattctgatgaggacgattaac 1361264

>gb|CP000260.1| Streptococcus pyogenes MGAS10270, complete genome
          Length = 1928252

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 44      tgattctgatggggacgattaac 66
               ||||||||||| |||||||||||
Sbjct: 1436370 tgattctgatgaggacgattaac 1436392

>gb|CP000259.1| Streptococcus pyogenes MGAS9429, complete genome
          Length = 1836467

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 44      tgattctgatggggacgattaac 66
               ||||||||||| |||||||||||
Sbjct: 1337401 tgattctgatgaggacgattaac 1337423

>gb|CP000056.1| Streptococcus pyogenes MGAS6180, complete genome
          Length = 1897573

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 44      tgattctgatggggacgattaac 66
               ||||||||||| |||||||||||
Sbjct: 1412455 tgattctgatgaggacgattaac 1412477

>emb|AL354864.16| Human DNA sequence from clone RP11-435D7 on chromosome 1 Contains the
             5' end of the PSMB2 gene for proteasome (prosome,
             macropain) subunit, beta type, 2, a novel transcript
             (FLJ38984), a putative novel transcript, the CLSPN gene
             for claspin homolog (Xenopus laevis) and the 5' end of the
             EIF2C4 gene for eukaryotic translation initiation factor
             2C, 4, complete sequence
          Length = 194296

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 19/19 (100%)
 Strand = Plus / Plus

                                
Query: 108   tggttcagttgctccacag 126
             |||||||||||||||||||
Sbjct: 26481 tggttcagttgctccacag 26499

>gb|AE010079.1| Streptococcus pyogenes strain MGAS8232, section 127 of 173 of the
             complete genome
          Length = 13328

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                    
Query: 44    tgattctgatggggacgattaac 66
             ||||||||||| |||||||||||
Sbjct: 11263 tgattctgatgaggacgattaac 11285

>gb|AE014074.1| Streptococcus pyogenes MGAS315, complete genome
          Length = 1900521

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Plus

                                      
Query: 44      tgattctgatggggacgattaac 66
               ||||||||||| |||||||||||
Sbjct: 1451328 tgattctgatgaggacgattaac 1451350

>dbj|BA000034.2| Streptococcus pyogenes SSI-1 DNA, complete genome
          Length = 1894275

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 22/23 (95%)
 Strand = Plus / Minus

                                     
Query: 44     tgattctgatggggacgattaac 66
              ||||||||||| |||||||||||
Sbjct: 445557 tgattctgatgaggacgattaac 445535

>emb|BX001038.6| Zebrafish DNA sequence from clone CH211-12M10 in linkage group 17,
             complete sequence
          Length = 180659

 Score = 38.2 bits (19), Expect = 7.5
 Identities = 25/27 (92%)
 Strand = Plus / Minus

                                        
Query: 94    aaatctcagtctcatggttcagttgct 120
             ||||||||||||| || ||||||||||
Sbjct: 48185 aaatctcagtctcttgcttcagttgct 48159


  Database: nt
    Posted date:  May 29, 2006 11:10 AM
  Number of letters in database: 3,984,495,279
  Number of sequences in database:  917,343
  
  Database: /shigen/export/home/twatanab/db/nt/nt.01
    Posted date:  May 29, 2006 11:16 AM
  Number of letters in database: 3,988,174,986
  Number of sequences in database:  835,257
  
  Database: /shigen/export/home/twatanab/db/nt/nt.02
    Posted date:  May 29, 2006 11:21 AM
  Number of letters in database: 3,991,246,324
  Number of sequences in database:  771,481
  
  Database: /shigen/export/home/twatanab/db/nt/nt.03
    Posted date:  May 29, 2006 11:27 AM
  Number of letters in database: 3,990,718,311
  Number of sequences in database:  977,174
  
  Database: /shigen/export/home/twatanab/db/nt/nt.04
    Posted date:  May 29, 2006 11:29 AM
  Number of letters in database: 1,278,410,368
  Number of sequences in database:  400,813
  
Lambda     K      H
    1.37    0.711     1.31 

Gapped
Lambda     K      H
    1.37    0.711     1.31 


Matrix: blastn matrix:1 -3
Gap Penalties: Existence: 5, Extension: 2
Number of Hits to DB: 873,486
Number of Sequences: 3902068
Number of extensions: 873486
Number of successful extensions: 58000
Number of sequences better than 10.0: 15
Number of HSP's better than 10.0 without gapping: 15
Number of HSP's successfully gapped in prelim test: 0
Number of HSP's that attempted gapping in prelim test: 57927
Number of HSP's gapped (non-prelim): 73
length of query: 156
length of database: 17,233,045,268
effective HSP length: 22
effective length of query: 134
effective length of database: 17,147,199,772
effective search space: 2297724769448
effective search space used: 2297724769448
T: 0
A: 0
X1: 6 (11.9 bits)
X2: 15 (29.7 bits)
S1: 12 (24.3 bits)
S2: 19 (38.2 bits)